- Email: [email protected]
First case of Aeromonas schubertii infection in brackish water wild Nile tilapia, Oreochromis niloticus, in China
Aquaculture 501 (2019) 247–254
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
First case of Aeromonas schubertii infection in brackish water wild Nile tilapia, Oreochromis niloticus, in China
T
⁎
Zhuling Rena,c, Yan Caia,b, Shifeng Wanga,c, , Shubin Liua,c, An Lia,c, Youfei Xiongb, Jiaqing Tangb, ⁎ Yun Suna,c, Weiliang Guob, Yongcan Zhoua,b,c, a
State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, PR China Key Laboratory of Tropical Biological Resources of Ministry of Education, Hainan University, Haikou, Hainan, 570228, PR China c Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, College of Marine Science, Hainan University, Haikou, Hainan 570228, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Oreochromis niloticus Aeronomas schubertii LD50 Infection routes Pathology
To identify and characterize the etiological agent causing tilapia (Oreochromis niloticus) mortality in a lagoon located in Haikou, China, four isolates, designated ASL-1, ASB-2, ASB-3 and ASS-4, were recovered from moribund fish. They were gram-negative, motile, short and rod-shaped. Sequencing of the 16S rRNA gene, as well as of the housekeeping genes-dnaJ, elastase (ela) and gyrase subunit beta (gyrB), strongly indicated that the four isolates were identical to Aeronomas schubertii. A virulence test showed that ASS-4 was the most virulent, and the lethal dose (LD50) of 7 days was 4.91 × 104 CFU/g fish by intraperitoneal (i.p.) injection. Different infection routes with ASS-4 induced different mortality rates. Acute mortalities were present after both i.p. and intramuscular (i.s.) injections. Very low mortalities were observed after oral exposure, and no mortality was observed after immersion. This suggested that the natural infection routes of A. schubertii in tilapia might be through damaged body surface and/or digestive tract. The histopathology of challenged fish included livers showing vacuolation, spleens with hemorrhaging and brains with swelling capillaries. Antibiotic sensitivity testing indicated that ASS-4 was susceptible to norfloxacin and rifampicin but resistant to 10 different antibiotics. This is the first report that A. schubertii infected brackish water wild fish. This is also the first investigation of the possible entry routes of A. schubertii in fish. These results will shed light on the pathogenicity of A. schubertii and will help prevent and control A. schubertii infection in tilapia.
1. Introduction
et al., 1989; Hickman-Brenner et al., 1988; Kao and Kao, 2011), including wound infections (Carnahan et al., 1989), necrotizing fasciitis and progressive sepsis (Kao and Kao, 2011). However, very little information presently exists regarding the pathogenicity of A. schubertii in fish (Yu et al., 2009). Only Chen et al. (2012) and Liu and Li (2012) reported that A. schubertii caused mortality in snakehead fish. Tilapia is the second most farmed fish after carp (Ng and Romano, 2013) provides an inexpensive source of protein for the majority of developing countries, and contributes significantly to global food security (Bacharach et al., 2016; Cleasby et al., 2014; Gomna, 2011). In recent years, a high-density culture model and polluted aquatic environments have made tilapia more susceptible to bacterial pathogens and have resulted in considerable economic losses in practical fish farming (Kumari and Sahoo, 2006; Li et al., 2006). Many diseases have been reported in tilapia farming and have become limiting factors in the tilapia industry, including diseases caused by Streptococcus spp. (Soto et al., 2016; Su et al., 2017; Zhu et al., 2018), Aeromonas spp. (Dong
Aeromonas spp. are important pathogens of humans and mammals. In humans, Aeromonas spp. are primarily associated with gastroenteritis and wound infections. Aeromonas spp. have also been reported in severe infections ranging from septicemia (Ketover et al., 1973) and fulminant diarrhea (Dhalla and Flynn, 1980) to myonecrosis (Geller et al., 1983) gas gangrene (Suthipintawongs and Wanvaree, 1982) endocarditis, meningitis and pneumonia (Joseph et al., 1991). In fish, Aeromonas spp. can cause hemorrhagic septicemia, fin rot, soft tissue rot and furunculosis (Aberoum and Jooyandeh, 2010). Aeromonas spp. can also infect a variety of aquatic animals, including silver catfish (Souza et al., 2017), rainbow trout (Zepeda-Velázquez et al., 2017), grass carp (Yang et al., 2016), tilapia (Li et al., 2011; Yang et al., 2015), eels (Guo et al., 2016) and snakehead fish (Liu and Li, 2012). A. schubertii has been implicated in a variety of human and fish diseases. A. schubertii can cause serious disease in humans (Carnahan
⁎
Corresponding authors at: State Key laboratory of Marine Resource Utilization in South China Sea, Hainan University, Haikou, Hainan 570228, PR China. E-mail addresses: [email protected] (S. Wang), [email protected] (Y. Zhou).
https://doi.org/10.1016/j.aquaculture.2018.11.036 Received 17 July 2018; Received in revised form 15 November 2018; Accepted 15 November 2018 Available online 16 November 2018 0044-8486/ © 2018 Elsevier B.V. All rights reserved.
Aquaculture 501 (2019) 247–254
Z. Ren et al.
ASS-4, was recovered from the spleen. Isolates from the above pure cultures were then characterized by the biochemical method and used for molecular identification. All isolates were stored at −80 °C in 50% (v/v) glycerol.
Table 1 Primers used for PCR amplification of the 16S rRNA, dnaJ, ela and gyrB genes in this study. Primers
Sequence (5′-3′)
References
16S r RNA
27F:AGAGTTTGATCATGGCTCAG 1492R:TACGGTTACCTTGTTACGACTT dnaJF:CGAGATCAAGAAGGCGTACAAG dnaJ R: CACCACCTTGCACATCAGATC elaF:ACACGGTCAAGGAGATCAACGG elaR:GCTGGTGTTGGCCAGCAGCAGGTAG GyrBF:TCAACTCCGCTGTCTCTAACCTG GyrBR:GCACCCTTACGGCAAGTCATC
Weisburg et al., 1991
dnaJ ela gyrB
2.3. Virulence test and 7-day LD50
Nhung et al., 2007
To determine the virulent capacities of the obtained isolates, bacterial virulence was examined by experimentally infecting healthy tilapia. Tilapia (n = 25) were randomly divided into five groups and the water temperature was adjusted to 28–30 °C. The four isolates were grown overnight in 100 ml LB broth at 30 °C. The cells were harvested by centrifugation (3000 rpm, 15 min), washed and resuspended in phosphate buffer saline (PBS) to an OD600 of approximately 0.8. Four groups were i.p. (0.2 ml/fish) injected with four isolates and the control group was i.p. injected with sterile PBS. The experimental challenge was conducted to determine the lethal dose-50% end point (LD50) in tilapia. The strain ASS-4 was chosen as a representative for the challenge experiments. A total of 100 healthy tilapia was randomly divided into five groups and the water temperature was set to 28–30 °C. Bacterial infection groups were inoculated via i.p. injection with 0.2 mL of freshly cultured cells (after 10 h incubation in LB broth) at either 1.33 × 105, 1.33× 106, 1.33 × 107, 1.33 × 108 colony-forming units (CFU) ml−1, whereas the control group was inoculated with 0.2 mL of sterile PBS. Fish mortality was recorded every 24 h interval for 7 days. LD50 was calculated using the improved Karber's method. To satisfy Koch's postulate, the bacteria were re-isolated and identified from the kidneys, brains and livers of the moribund fish.
Mo et al., 2016 Liu et al., 2014
et al., 2017; Sami et al., 2018) and virus (Skliris and Richards, 2010; Tattiyapong et al., 2017). To date, there have been no documented reports of A. schubertii infecting tilapia. The experimental challenge was conducted through i.p. of pure cultures isolated from diseased fish to confirm pathogenicity. The aim of the study was to investigate the causative agent of the disease outbreak in tilapia using morphological and biochemical characteristics, as well as 16S rRNA gene and housekeeping gene sequence analysis. 2. Materials and methods 2.1. Fish A severe disease outbreak occurred in tilapia from a lagoon in Hainan University, Hainan Province, China, from September to October 2017. The average water temperature of the lagoon was 29 °C and the salinity was 18. Diseased tilapia had hemorrhages near the caudal, dorsal and anal fins, and three fishes (mean weight, 25.87 g) were collected for bacterial isolation. Healthy tilapia (Oreochromis niloticus), weighing 13.67 to 87.44 g and measuring between 95.3 and 181.4 mm in total length, with no record of disease were used for challenge experiments and were obtained from a farm located at Wenchang City, Hainan province, China. Prior to infection, tilapia were acclimatized for 7 d in aquaria with aeration. Fish were fed with commercial feed twice daily. Water was replaced daily and maintained at 28 ± 2 °C.
2.4. Physiological and biochemical tests The preliminary characterization of the isolated strains was carried out by Gram staining, and the morphological characteristics of the four colonies were observed using a microscope. The biochemical characteristics of ASS-4 were determined using microbial biochemical identification tubes (HuanKai Microbial Science and Technology Co. Ltd., Guangzhou, China) with reference to Bergey's Manual of Systematic Bacteriology.
2.2. Bacterial isolation
2.5. Molecular identification
For bacterial isolation, samples obtained from the liver, spleen, kidney and brain of moribund tilapia were streaked onto Luria-Bertani (LB) agar plates for each tissue under a sterile environment and incubated at 30 °C for 18 to 24 h. After 24 h, gray-white colonies with a central uplift, round, moist, smooth surface and a neat edge were observed on all the agar plates. All colonies appeared identical in morphology. Single colonies were picked and re-streaked on fresh LB plates until pure cultures were obtained. One pure culture, designated ASL-1, was recovered from the liver. Two pure cultures, designated ASB-2 and ASB-3, were recovered from the brain. One pure culture, designated
DNA of four isolates were extracted using the MiniBEST Bacterial Genomic DNA Extraction Kit (TaKaRa, Dalian, China) according to the manufacturer's protocol. The 16S rRNA and three housekeeping gene loci, including dnaJ, ela and gyrB, were amplified by PCR. The sequences of the primers used for amplification of the partial sequences of these four loci are listed in Table 1. The PCR conditions used to amplify the four loci were adopted from Liu and Li (2012). The PCR products were sequenced at the Beijing Genomics Institute (BGI) (Beijing, China). The four gene sequences were blasted against GenBank sequences. Multiple sequence alignments were obtained using the
Fig. 1. Clinical signs of tilapia (Oreochromis niloticus) infected with ASS-4. A) Hemorrhages in the caudal, pectoral and dorsal fins, B) effusion in the gut. 248
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 2. Cumulative mortality (%, mean ± SD) of tilapia (Oreochromis niloticus) injected with isolated strains and PBS: A) the cumulative mortality of tilapia injected with the four isolated strains and PBS, and B) the cumulative mortality of tilapia injected with various concentrations of ASS-4 and PBS.
the bacterial pellet was washed thrice with PBS. For the different routes of infection, a pathogen dose titration using 10-fold serial dilutions of ASS-4 was prepared such that the final cell suspensions were 6.87 × 106 CFU ml−1. For the i.p., i.s. and oral exposure routes, the two replicate cohorts of ten fish per treatment were challenged by injection with 0.2 ml of cell suspension. The control group was injected with 0.2 ml of PBS. The bath exposure had two replicates of ten fish. ASS-4 was diluted with fresh water to a concentration of 6.87 × 106 CFU ml−1 and then 20 tilapia were soaked in a diluted cell suspension for 3 h. Three hours later, they were observed in fresh water. The control group in the bath exposure was soaked in fresh water. The water temperature was set to 28–30 °C. Fish mortality was recorded every 24 h interval for 14 days.
Table 2 Comparative biochemical analysis of ASS-4 isolated from tilapia fingerlings with published biochemical data of A. schubertii (n = 3). Biochemical test
ASS-4
A. schubertiia ATCC43700
Glucose Lactose Maltose Mannitol Sucrose Arabinose Sorbitol Inositol Salicine Glycerol Esculin Phenylalanine Raffinose Lysine decarboxylase Ornithine decarboxylase Hydrogen sulfide Gelatine Editpotassium cyanide Gas from nitrite Gas from nitrate Gas from glucose D-Ribose Melezitose Tarch Melibiose Cellobiose Arginine double hydrolase Triple sugar iron
+ − + − − − + − − + + + − + − − + − − − − + − + − − − +
+ − + − − − + − − + − + − + +/− − + − − − − − − + − − +/− +
2.7. Histopathology The liver, spleen and brain of moribund tilapia with typical symptoms were fixed in paraformaldehyde (4%) solution, dehydrated in ethanol, embedded in paraffin wax blocks, sectioned at 6 μm, and stained with H&E for observation (Martoja and Martoja-Pierson, 1967). 2.8. Antimicrobial susceptibility test Thirty-five antibiotics (Hangzhou Microbial Reagent Co., Ltd., China) were used to determine the susceptibility of ASS-4 by the British society for antimicrobial chemotherapy (BSAC) standardized disc susceptibility testing method (Andrews, 2004). After incubation at 30 °C for 24 h, the diameters of the inhibition zones on LB agar plates were measured to determine the antimicrobial susceptibility (S), medium susceptibility (I) or resistance (R).
“+”: positive; “−”: negative;“+/−”: positive or negative. a Phenotypic characteristics of A. schubertii observed as described by Liu and Li (2012).
3. Results CLUSTALW software implemented in the software package MEGA 6.0. Phylogenetic reconstructions based on sequence data were performed using neighbor-joining (N-J). The robustness of each topology was checked with 1000 bootstrap replications (Cao et al., 2014).
3.1. Pathological symptoms investigation Moribund tilapia were sluggish, floating, or swimming alone. The clinical signs of diseased tilapia includes skin hemorrhages on the caudal, dorsal and anal fins (Fig. 1A). The diseased fish were dissected and found to have abdominal effusion (Fig. 1B). No parasites were found after microscopic examination of the diseased fish.
2.6. Infection route experiments To clarify the most efficient way to infect fish with ASS-4, different routes of infection were tested. ASS-4 was subcultured in 200 ml LB broth and was incubated at 30 °C for 10 h. Next, 200 ml of culture was centrifuged at 3000 rpm for 15 min. After discarding the supernatant,
3.2. Cumulative mortality and determination of LD50 Injections of the bacterial strains ASL-1, ASB-2, ASB-3 and ASS-4 249
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 3. N-J phylogenetic tree of the five isolates based on 16S rRNA and three housekeeping genes. A) 16S rRNA, B) ela, C) dnaJ, D) gyrB.
Fig. 2B. There was no mortality in the control fish injected with PBS up to 7 days post injection. The LD50 was 4.91 × 104 CFU/g fish for the i.p. challenge after one week. 3.3. Morphological and biochemical characteristics When incubated for 24 h, the obtained colonies were gray-white with a central uplift, round and moist, with a smooth surface and a neat edge. The four isolates stained purple after Gram staining, indicating that they were Gram-negative bacteria. ASS-4 was positive for glucose, maltose, sorbitol, glycerol, esculin, phenylalanine, lysine decarboxylase, gelatin, D-ribose, starch and triple sugar iron. Additionally, ASS-4 was negative for lactose, sucrose, arabinose, inositol, salicin, raffinose, ornithine decarboxylase, hydrogen sulfide, potassium cyanide, gas from nitrite, gas from nitrate, gas from glucose, melezitose, melibiose, cellobiose, mannitol and arginine double hydrolase (Table 2). Fig. 4. Cumulative mortality (%, mean ± SD) of tilapia injected with ASS-4 or PBS by i.p., i.s., oral exposure, or bath exposure.
3.4. Phylogenetic analysis based on 16S rRNA and housekeeping gene sequences
were lethal. Significant differences in the cumulative mortalities between the treatment and the control were found (P < .05) (Fig. 2A). At 1 day postchallenge, fish injected with ASS-4 died. The dominant strains could be re-isolated from the spleen and liver of the moribund or dead fish. The virulence test showed that ASS-4 was the most virulent strain. We characterized ASS-4 because it was the most virulent strain. The cumulative mortality rate of tilapia infected with ASS-4 is shown in
The four sequences formed a tight clade that branched within the genus Aeromonas. The similarity value among ASL-1 (GenBank Accession No. SUB3783063), ASB-2 (GenBank Accession No. SUB3783069), ASB-3 (GenBank Accession No. SUB3783075), ASS-4 (GenBank Accession No. SUB3783086) and A. schubertii (GenBank Accession No. MH050445) was 100%. Additionally, the 16S rRNA sequences showed fairly high homology (100% and 98.5%) among ASL-1, ASB-3, ASS-4 and ASB-2. In the N-J phylogenetic tree, the dnaJ genes 250
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 5. Histological section of fish injected with PBS and ASS-4 (H&E Staining: 200×): histological section of a liver from fish injected with A) PBS and B) ASS-4, showing vacuolar degeneration of the hepatocytes (V) and hepatic cell (HC) degeneration; histological section of a spleen from fish injected with C) PBS and D) ASS4, showing depletion of hematopoietic cells (H) and thickening of the ellipsoidal capillaries' wall (EC); histological section of a brain from fish injected with E) PBS and F) ASS-4, showing brain capillaries (BC) swelling.
3.6. Histopathology
and four isolates clustered with A. schubertii (GenBank Accession No. HQ731477) (98.5%, 98.5%, 98.1% and 98.7%); the gyrB genes and four isolates clustered with A. schubertii (GenBank Accession No. FN796751) (96.2%, 96.5%, 96.5% and 96.7%) and the ela genes and four isolates clustered with A. schubertii (GenBank Accession No. DQ124688) (94.5%, 93.3%, 93.9% and 87.9%) (Fig. 3).
The histopathological lesions in the experimentally infected fish were clear. In livers, we found marked vacuolation of the hepatocytes (Fig. 5B). In spleens, we found hemorrhage and depletion of hemopoietic tissue. Spleens showed thickening of the ellipsoidal capillaries' wall, perivascular edema and vascular thrombosis (Fig. 5D). Brains exhibited capillary swelling (Fig. 5F).
3.5. Different infection route experiments 3.7. Antimicrobial susceptibility results The cumulative mortality rates of tilapia after infection with ASS-4 are shown in Fig. 4. The highest cumulative mortality rates were 80%; 65% and 15% for the i.p., i.s., and oral exposure routes of infection, respectively. No mortality was observed for the control fish injected with PBS or bath exposure up to 14 days post injection. Bacterial strains were re-isolated from the dying fish and were identical to the injected strain.
The susceptibility pattern of the isolates from 35 antibacterial agents was carried out. The ASS-4 was susceptible to norfloxacin, rifampicin, aztreonam, cefoperazone, cefradine, florfenicol, furadantin, azlocillin, cefazolin, ceftazidime pentahydrate, piperacillin, cefotaxime, cephalothin, nalidixic acid, mezlocillin, trimethoprim, furazolidone, cefepime, tetracycline, chloramphenicol, ciprofloxacin, ofloxacin and 251
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Table 3 Sensitivity of the ASS-4 strain to antibacterial agents (n = 3). Antibiotics
Erythromycin Norfloxacin Bacitracin Rifampicin Aboren Aztreonam Cefoperazone Cefradine Florfenicol Furadantin Ampicillin Azlocillin Cefazolin Ceftazidime pentahydrate Oxacillin Piperacillin Cefotaxime Cephalothin Nalidixic acid Mezlocillin Penicillin Trimethoprim Furazolidone Cefepime Polymyxin B Streptomycin Tetracycline Chloramphenicol Ciprofloxacin Ofloxacin Neomycin Kanamycin Tobramycin Gentamycin Vancomycin
Content (μg/tablet)
15 10 0.04U 5 30 30 75 30 30 300 10 75 30 30 1 100 30 30 30 75 10 U 5 300 30 300U 10 30 30 5 5 30 30 10 10 30
Diameters of inhibition zone (mm)
11.64 36.04 7.44 24.03 0.00 35.37 32.79 21.39 34.23 21.88 0.00 21.19 22.14 41.12 0.00 30.63 42.95 25.05 41.53 28.13 0.00 26.90 27.48 43.56 15.12 0.00 22.66 32.12 31.84 33.98 14.16 15.06 9.67 17.83 11.23
Critical range
Susceptibility
R (mm)
I (mm)
S (mm)
≤13 ≤12 ≤8 ≤16 ≤13 ≤15 ≤15 ≤14 ≤12 ≤14 ≤13 ≤17 ≤14 ≤14 ≤10 ≤17 ≤14 ≤14 ≤13 ≤17 ≤14 ≤10 ≤14 ≤14 ≤8 ≤11 ≤14 ≤12 ≤15 ≤12 ≤12 ≤13 ≤12 ≤12 ≤9
14–22 13–16 9–12 17–19 14–17 16–21 16–20 15–17 13–17 15–16 14–16 – 15–17 15–17 11–12 18–20 15–22 15–17 14–18 18–20 – 11–15 15–16 15–17 8–11 12–14 15–18 13–17 16–20 13–15 13–16 14–17 13–14 13–14 10–11
≥23 ≥17 ≥13 ≥20 ≥18 ≥22 ≥21 ≥18 ≥18 ≥17 ≥17 ≥18 ≥18 ≥18 ≥13 ≥21 ≥23 ≥18 ≥19 ≥21 ≥15 ≥16 ≥17 ≥18 ≥12 ≥15 ≥19 ≥18 ≥21 ≥16 ≥17 ≥18 ≥15 ≥15 ≥12
R S R S R S S S S S R S S S R S S S S S R S S S R R S S S S I I R S R
Note: “S”: sensitive; “I”: intermediate; “R”: resistant.
(2017) reported that Aeromonas veronii infected Oreochromis niloticus exhibited hemorrhages over the entire body surface. Similar hemorrhagic symptoms were also found in snakehead fish infected by A. schubertii (Chen et al., 2012). In this study, tilapia was the second fish species found to be infected by A. schubertii after snakehead fish. The primary symptoms of tilapia infected with A. schubertii were skin hemorrhages. However, the typical symptoms of A. schubertiiin infected snakehead fish was not the same as those found by Liu and Li (2012), who observed hemorrhages around the mouth and at the base of the fins as well as ivory-white nodules in the kidney. In the same study (Liu and Li, 2012), the symptoms of zebrafish infected with A. schubertii included hemorrhages at the bases of fins; they did not find any ivorywhite nodules. The difference in the appearance of these symptoms may be due to factors such as differences in bacteria serotype, host species and environmental temperature et al. (Liu and Li, 2012; Liu et al., 2014; Mo et al., 2016). Therefore, the main symptom of tilapia infected by A. schubertii is hemorrhages. Up till now, only few studies have explored the possible routes of natural bacterial infection and the routes of A. schubertii's entry in fish remains unknown (Chen et al., 2012; Liu and Li, 2012). In the study of Philasterides dicentrarch infection routes in farmed turbot, Paramá et al. (2003) believed that the natural route of infection was probably through lesions in the gills and/or skin even though the i.p. remains to be the most appropriate route for experimental infection in a fast and reliable manner. In another study, Soto et al. (2016) compared four different entry routes of S. agalactiae in tilapia challenge experiments, and concluded that injectable methods of infection (i.p. and i.s.) may not mimic natural disease and the oral and immersion challenge routes
gentamycin. The ASS-4 was resistant to erythromycin, bacitracin, aboren, ampicillin, oxacillin, penicillin, polymyxin B, streptomycin, tobramycin and vancomycin. The ASS-4 showed intermediate resistance to neomycin and kanamycin (Table 3).
4. Discussion In this study, four isolates were recovered from moribund tilapia. In the pathogenicity test, ASL-1, ASB-2, ASB-3 and ASS-4 exhibited high toxicity, and the symptoms of the diseased fish were the same as naturally infected fish. With reference to Bergey's Manual of Determinative Bacteriology and ATCC 43700, we found that ASS-4 was similar to A. schubertii except for D-ribose. However, it is not surprising that different biotypes or serotype strains exhibit differences in biochemical characteristics. Molecular diagnostics are more precise and accurate for bacterial identification at the species level (Werckenthin et al., 2012; Zhou et al., 2010). Phylogenetic analysis based on 16S rRNA gene sequences (approximately 1500 bp) showed that four isolates had the highest homologies with A. schubertii. Furthermore, based on the housekeeping genes-gyrB, dnaJ and ela, the four isolates were clustered with A. schubertii. Therefore, the etiological agent of tilapia mortality was A. schubertii. Hemorrhages are one of the main symptoms of Aeromonas infection in fish. Aberoum and Jooyandeh (2010) reported that the clinical symptoms of Aeromonas spp. infection in marine fishes were hemorrhagic septicemia. Dias et al. (2016) reported that Aeromonas hydrophila infected Arapaima gigas exhibited hemorrhagic foci as well as necrotic hemorrhages in the kidney, liver and swim bladder. Hassan et al. 252
Aquaculture 501 (2019) 247–254
Z. Ren et al.
more closely resemble natural infection. This study challenged tilapia with A. schubertii via the same four different routes as Soto et al. (2016). High mortality was observed in i.p. and i.s. groups. Low mortality was shown in oral exposure groups and no mortality was observed in immersion group. This result indicated that the pathogenicity of A. schubertii was closely related to the route of infection. This was also consistent with the zero mortality in immersion exposure groups where skin and skill served as excellent barriers to fight back bacterial infection. As for the low mortality (15%) in oral exposure groups, we suspected that a certain percentage of A. schubertii could tolerant the gastrointestinal environment and enter the fish body through gastrointestinal mucosa. Based on the above results, we inferred that the potential infection routes of A. schubertii in tilapia might be through damaged body surface and/or digestive tract. From the antibiotic resistance assay in this study, the isolate ASS-4 was resistant to 10 of 35 (28.6%) antibiotics. This resistance level was similar to results obtained by Liu and Li (2012) who studied the antibiotic resistance profile of A. schubertii from freshwater farmed snakehead fish. The result of their study revealed that A. schubertii was resistant to 7 of 25 (28.0%) antibiotics, including bacitracin, ampicillin and vancomycin, which were also reported in the current study. The resistance of A. schubertii to tobramycin and streptomycin were reported in two other A. schubertii investigations (Mo et al., 2016; Overman and Janda, 1999), respectively. The finding that all four A. schubertii isolates in this study were resistant to ampicillin and penicillin, two β-lactam antibiotics, were in high accordance with many other Aeromonas spp. researches. The resistance of Aeromonas spp. towards ampicillin/penicillin is considered indigenous, i.e. the resistance is present naturally (Janda and Abbott, 2010). The major mechanism of β-lactam resistance in Aeromonas species were revealed extensively: at least three chromosomally mediated, inducible β-lactamases naturally exist in Aeromonas species (Jones and Wilcox, 1995; Walsh et al., 1995). As to the other antibiotics resistances discovered in A. schubertii, they were probably acquired through “horizontal resistance transfer”, where antibiotics resistance can be acquired as a result of microbes coming in contact with antibiotics in their environment. This type of resistance is often plasmid – extrachromosomal DNA mediated (Kümmerer, 2009). Considering the brackish lagoon in Hainan University was located near the Nandujiang River estuary, where urban wastewater effluents, including effluents from hospitals were discharged, it is not surprising that a high prevalence of multi-antimicrobial resistance was observed in the A. schubertii isolates in this study. In conclusion, this is the first report of A. schubertii infecting wild fish from brackish water. Moreover, experimental challenges via different routes indicated that the most possible natural infection routes of A. schubertii in tilapia was through damaged body surface and/or digestive tract. 16S rRNA, dnaJ, gyrB and ela gene sequence analysis of four isolates provides scientific reference data for fish disease diagnostics. The data presented will shed light on the pathogenicity of A. schubertii and will help prevent and control A. schubertii-induced diseases in fish.
Bacharach, E., Mishra, N., Briese, T., Zody, M.C., Kembou Tsofack, J.E., Zamostiano, R., Berkowitz, A., Ng, J., Nitido, A., 2016. Characterization of a novel orthomyxo-like virus causing mass die-offs of tilapia. MBio 7, 431–446. Cao, H., He, S., Lu, L., Yang, X., Chen, B., 2014. Identification of a Proteus penneri isolate as the causal agent for the red body disease of the cultured white shrimp Penaeus vannamei and its control with Bdellovibrio bacteriovorus. Antonie Van Leeuwenhoek 105, 423–430. Carnahan, A.M., Marii, M.A., Fanning, G.R., Pass, M.A., Joseph, S.W., 1989. Characterization of Aeromonas schubertii strains recently isolated from traumatic wound infections. J. Clin. Microbiol. 27, 1826–1830. Chen, Y.F., Liang, R.S., Zhuo, X.L., Wu, X.T., Zou, J.X., 2012. Isolation and characterization of Aeromonas schubertii from diseased snakehead, Channa maculata (lacepède). J. Fish Dis. 35 (6), 421. Cleasby, N., Schwarz, A.M., Phillips, M., Paul, C., Pant, J., Oeta, J., Pickering, T., Meloty, A., Laumani, M., Kori, M., 2014. The socio-economic context for improving food security through land based aquaculture in Solomon Islands: a pen-urban case study. Mar. Policy 45, 89–97. Dhalla, S., Flynn, J.T., 1980. Aeromonas hydrophila-induced fulminant diarrhea. New York State J. Med. 80 (13), 1965. Dias, M.K., Sampaio, L.S., Proiettijunior, A.A., Yoshioka, E.T., Rodrigues, D.P., Rodriguez, A.F., 2016. Lethal dose and clinical signs of Aeromonas hydrophila in Arapaima gigas (arapaimidae), the giant fish from amazon. Vet. Microbiol. 188, 12–15. Dong, H.T., Techatanakitarnan, C., Jindakittikul, P., Thaiprayoon, A., Taengphu, S., Charoensapsri, W., 2017. Aeromonas jandaei and Aeromonas veronii caused disease and mortality in nile tilapia, Oreochromis niloticus (L.). J. Fish Dis. 40 (10), 1395–1403. Geller, H.S., Tofte, R.W., Cunningham, B.L., 1983. Aeromonas hydrophila wound infection of the hand initially presenting as clostridial myonecrosis. J. Hand Surg. 8 (3), 333–335. Gomna, A., 2011. The role of tilapia in food security of fishing villages in Niger state, Nigeria. Afr. J. Food Agric. Nutr. Dev. 11 (7), 5561–5572. Guo, S.L., Yang, Q.H., Feng, J.J., Duan, L.H., Zhao, J.P., 2016. Phylogenetic analysis of the pathogenic genus Aeromonas spp. isolated from diseased eels in China. Microb. Pathog. 101, 12–23. Hassan, M.A., Noureldin, E.A., Mahmoud, M.A., Fita, N.A., 2017. Molecular identification and epizootiology of Aeromonas veronii, infection among farmed Oreochromis niloticus, in eastern province, ksa. Egypt. J. Aquat. Res. 43 (2), 161–167. Hickman-Brenner, F.W., Fanning, G.R., Arduino, M.J., Brenner, D.J., Farmer, J.J., 1988. Aeromonas schubertii, a new mannitol-negative species found in human clinical specimens. J. Clin. Microbiol. 26, 1561–1564. Janda, J.M., Abbott, S.L., 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23 (1), 35–73. Li, J., Ye, X., Lu, M.X., Deng, G.C., Chi, Y.Y., Huang, Z.H., 2011. Isolation and identification of Aeromonas veronii from infected tilapia fry and analysis of its drug sensitivity. J. Hydroecol. 32 (3), 132–136. Jones, B.L., Wilcox, M.H., 1995. Aeromonas infections and their treatment. J. Antimicrob. Chemother. 35 (4), 453–461. Joseph, S.W., Carnahan, A.M., Brayton, P.R., Fanning, G.R., Almazan, R., Drabick, C., 1991. Aeromonas jandaei and Aeromonas veronii dual infection of a human wound following aquatic exposure. J. Clin. Microbiol. 29 (3), 565–566. Kao, T.L., Kao, M.L., 2011. A fatal case of necrotizing Aeromonas schubertii fasciitis after penetrating injury. Am. J. Emerg. Med. 17, 1–3. Ketover, B.P., Young, L.S., Armstrong, D., 1973. Septicemia due to Aeromonas hydrophila: clinical and immunologic aspects. J. Infect. Dis. 127 (3), 284–290. Kumari, J., Sahoo, P.K., 2006. Non-specific immune response of healthy and immunocompromised Asian catfish (Clarias batrachus) to several immunostimulants. Aquaculture 255, 133–141. Kümmerer, K., 2009. Antibiotics in the aquatic environment-a review-part II. Chemosphere 75, 435–441. Li, G.F., Zhao, D.H., Huang, L., Sun, J.J., Gao, D., Wang, H.F., et al., 2006. Identification and phylogenetic analysis of Vibrio vulnificus isolated from diseased Trachinotus ovatus in cage mariculture. Aquaculture 261, 17–25. Liu, J.Y., Li, A.H., 2012. First case of Aeromonas schubertii infection in the freshwater cultured snakehead fish, Ophiocephalus argus (cantor), in China. J. Fish Dis. 35 (5), 335–342. Liu, C., Li, K.B., Wang, Q., Wang, F., Zeng, W.W., Shi, C.B., Wu, S.Q., 2014. Establishment of duplex PCR for detection of pathogenic Aeromonas schubertii. Chin. J. Prevent. Vet. Med. 36 (01), 54–57. Martoja, R., Martoja-Pierson, M., 1967. Initiation aux techniques de l'histologie animale. Masson et Cie, Paris (1232pp). Mo, J.F., Jiang, L., Wu, Z.H., 2016. Biological characteristics and drug susceptibility of Aeromonas schubertii WL-4 isolated from snakehead. J. Fish. China 40 (03), 484–494. Ng, W.K., Romano, N., 2013. A review of the nutrition and feeding management of farmed tilapia throughout the culture cycle. Rev. Aquac. 5 (4), 220–254. Nhung, P.H., Hata, H., Ohkusu, K., Noda, M., Shah, M.M., Goto, K., Ezak, T., 2007. Use of the novel phylogenetic marker dnaJ and DNA–DNA hybridization to clarify interrelationships within the genus Aeromonas. Int. J. Syst. Evol. Microbiol. 57, 1232–1237. Overman, T.L., Janda, J.M., 1999. Antimicrobial susceptibility patterns of Aeromonas jandaei, A. schubertii, A. trota, and A. veronii biotype veronii. J. Clin. Microbiol. 37 (3), 706. Paramá, A., Iglesias, R., Álvarez, M.F., Leiro, J., Aja, C., Sanmartı́N, M.L., 2003. Philasterides dicentrarchi, (ciliophora, scuticociliatida): experimental infection and possible routes of entry in farmed turbot (Scophthalmus maximus). Aquaculture 217 (1), 73–80. Sami, A.A., Fuad, A., Khalidah, S.A., Bashar, A.A., Sarfaraz, H., Ashraf, A.M., 2018.
Acknowledgment This study was funded by the National Natural Science Foundation of China (No. 31560725, No. 41666006); the Special Program for Marine Science and Technology of Hainan (No. 2015XH02); the Natural Science Foundation of Hainan Province (No. 2016CXTD005). We thank Yue Wu, Xin Chen and Qiming Li for their help in the experiments. References Aberoum, A., Jooyandeh, H., 2010. A review on occurrence and characterization of the Aeromonas species from marine Fishes. World J. Fish Mar. Sci. 2 (6), 519–523. Andrews, J.M., 2004. BSAC standardized disc susceptibility testing method (version 4). J. Antimicrob. Chemother. 53 (5), 713–728.
253
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703. Werckenthin, C., Gey, A., Straubinger, R.K., Poppert, S., 2012. Rapid identification of the animal pathogens Streptococcus uberis and Arcanobacterium pyogenes by fluorescence in situ hybridization (fish). Vet. Microbiol. 156 (3–4), 330–335. Yang, J.P., Mu, J.G., Liu, Y., Jin, H.E., Ren, S.M., Liu, X.C., 2015. Isolation and identification of Aeromonas veronii in Tilapia. Prog. Vet. Med. 36 (5), 40–43. Yang, Y., Yu, H., Li, H., Wang, A., 2016. Transcriptome profiling of grass carp (Ctenopharyngodon idellus) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 51, 329–336. Yu, H., He, Z., Yan, Y.B., Yang, G.Y., Hu, J., Zhou, M.J., 2009. Identification of Plesiomonas shigelloides and Aermonas schuberti from doctor fish (Garra rufa) and antibiotics sensitivity (in Chinese). Chin. J. Anim. Health Inspect. 7, 37–39. Zepeda-Velázquez, A.P., Vega-Sánchez, V., Ortega-Santana, C., Rubio-Godoy, M., OcaMira, D.M.D., Soriano-Vargas, E., 2017. Pathogenicity of Mexican isolates of Aeromonas sp. in immersion experimentally-infected rainbow trout (Oncorhynchus mykiss, walbaum 1792). Acta Trop. 169, 122–124. Zhou, S.M., Xie, M.Q., Zhu, X.Q., Ma, Y., Tan, Z.L., Li, A.X., 2010. Identification and genetic characterization of Streptococcus iniae strains isolated from diseased fish in China. J. Fish Dis. 31 (11), 869–875. Zhu, J.J., Gan, X., Ao, Q.W., Shen, X.S., Tan, Y., Chen, M., Luo, J., Wang, H., Jiang, H., Li, C., 2018. Basal polarization of the immune responses to Streptococcus agalactiae susceptible and resistant tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 75, 336–345.
Histopathological studies of experimental Aeromonas hydrophila infection in blue tilapia, Oreochromis aureus. Saudi J. Biol. Sci. 25, 182–185. Skliris, G.P., Richards, R.H., 2010. Nodavirus isolated from experimentally infected tilapia, Oreochromis mossambicus (peters). J. Fish Dis. 22 (4), 315–318. Soto, E., Zayas, M., Tobar, J., Illanes, O., Yount, S., Francis, S., Dennis, M.M., 2016. Laboratory-controlled challenges of Nile Tilapia (Oreochromis niloticus) with Streptococcus agalactiae: comparisons between immersion, oral, intracoelomic and intramuscular routes of infection. J. Comp. Pathol. 155, 339–345. Souza, C.F., Verdi, C.M., Baldissera, M.D., Doleski, P.H., Vizzotto, B.S., Santos, R., 2017. Xanthine oxidase activity affects pro-oxidative and pro-inflammatory profiles in spleen of silver catfish experimentally infected with Aeromonas caviae. Microb. Pathog. 113, 25–28. Su, Y., Feng, J., Liu, C., Li, W., Xie, Y., Li, A., 2017. Dynamic bacterial colonization and microscopic lesions in multiple organs of tilapia infected with low and high pathogenic Streptococcus agalactiae, strains. Aquaculture 471, 190–203. Suthipintawongs, C., Wanvaree, S., 1982. Gas gangrene: an unusual manifestation of Aeromonas infection. J. Med. Assoc. Thailand 65 (12), 678. Tattiyapong, P., Dachavichitlead, W., Surachetpong, W., 2017. Experimental infection of tilapia lake virus (tilv) in nile tilapia (Oreochromis niloticus), and red tilapia (oreochromis, spp.). Vet. Microbiol. 207, 170–177. Walsh, T.R., Payne, D.J., MacGowan, A.P., 1995. A Clinical Isolate of Aeromonas sobria With Three Chromosomally Mediated Inducible Beta-lactamases: A Cephalosporinase, a Penicillinase and a Third Enzyme, Displaying Carbapenemase Activity. 35(2). pp. 271–279.
254
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
First case of Aeromonas schubertii infection in brackish water wild Nile tilapia, Oreochromis niloticus, in China
T
⁎
Zhuling Rena,c, Yan Caia,b, Shifeng Wanga,c, , Shubin Liua,c, An Lia,c, Youfei Xiongb, Jiaqing Tangb, ⁎ Yun Suna,c, Weiliang Guob, Yongcan Zhoua,b,c, a
State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, PR China Key Laboratory of Tropical Biological Resources of Ministry of Education, Hainan University, Haikou, Hainan, 570228, PR China c Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, College of Marine Science, Hainan University, Haikou, Hainan 570228, PR China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Oreochromis niloticus Aeronomas schubertii LD50 Infection routes Pathology
To identify and characterize the etiological agent causing tilapia (Oreochromis niloticus) mortality in a lagoon located in Haikou, China, four isolates, designated ASL-1, ASB-2, ASB-3 and ASS-4, were recovered from moribund fish. They were gram-negative, motile, short and rod-shaped. Sequencing of the 16S rRNA gene, as well as of the housekeeping genes-dnaJ, elastase (ela) and gyrase subunit beta (gyrB), strongly indicated that the four isolates were identical to Aeronomas schubertii. A virulence test showed that ASS-4 was the most virulent, and the lethal dose (LD50) of 7 days was 4.91 × 104 CFU/g fish by intraperitoneal (i.p.) injection. Different infection routes with ASS-4 induced different mortality rates. Acute mortalities were present after both i.p. and intramuscular (i.s.) injections. Very low mortalities were observed after oral exposure, and no mortality was observed after immersion. This suggested that the natural infection routes of A. schubertii in tilapia might be through damaged body surface and/or digestive tract. The histopathology of challenged fish included livers showing vacuolation, spleens with hemorrhaging and brains with swelling capillaries. Antibiotic sensitivity testing indicated that ASS-4 was susceptible to norfloxacin and rifampicin but resistant to 10 different antibiotics. This is the first report that A. schubertii infected brackish water wild fish. This is also the first investigation of the possible entry routes of A. schubertii in fish. These results will shed light on the pathogenicity of A. schubertii and will help prevent and control A. schubertii infection in tilapia.
1. Introduction
et al., 1989; Hickman-Brenner et al., 1988; Kao and Kao, 2011), including wound infections (Carnahan et al., 1989), necrotizing fasciitis and progressive sepsis (Kao and Kao, 2011). However, very little information presently exists regarding the pathogenicity of A. schubertii in fish (Yu et al., 2009). Only Chen et al. (2012) and Liu and Li (2012) reported that A. schubertii caused mortality in snakehead fish. Tilapia is the second most farmed fish after carp (Ng and Romano, 2013) provides an inexpensive source of protein for the majority of developing countries, and contributes significantly to global food security (Bacharach et al., 2016; Cleasby et al., 2014; Gomna, 2011). In recent years, a high-density culture model and polluted aquatic environments have made tilapia more susceptible to bacterial pathogens and have resulted in considerable economic losses in practical fish farming (Kumari and Sahoo, 2006; Li et al., 2006). Many diseases have been reported in tilapia farming and have become limiting factors in the tilapia industry, including diseases caused by Streptococcus spp. (Soto et al., 2016; Su et al., 2017; Zhu et al., 2018), Aeromonas spp. (Dong
Aeromonas spp. are important pathogens of humans and mammals. In humans, Aeromonas spp. are primarily associated with gastroenteritis and wound infections. Aeromonas spp. have also been reported in severe infections ranging from septicemia (Ketover et al., 1973) and fulminant diarrhea (Dhalla and Flynn, 1980) to myonecrosis (Geller et al., 1983) gas gangrene (Suthipintawongs and Wanvaree, 1982) endocarditis, meningitis and pneumonia (Joseph et al., 1991). In fish, Aeromonas spp. can cause hemorrhagic septicemia, fin rot, soft tissue rot and furunculosis (Aberoum and Jooyandeh, 2010). Aeromonas spp. can also infect a variety of aquatic animals, including silver catfish (Souza et al., 2017), rainbow trout (Zepeda-Velázquez et al., 2017), grass carp (Yang et al., 2016), tilapia (Li et al., 2011; Yang et al., 2015), eels (Guo et al., 2016) and snakehead fish (Liu and Li, 2012). A. schubertii has been implicated in a variety of human and fish diseases. A. schubertii can cause serious disease in humans (Carnahan
⁎
Corresponding authors at: State Key laboratory of Marine Resource Utilization in South China Sea, Hainan University, Haikou, Hainan 570228, PR China. E-mail addresses: [email protected] (S. Wang), [email protected] (Y. Zhou).
https://doi.org/10.1016/j.aquaculture.2018.11.036 Received 17 July 2018; Received in revised form 15 November 2018; Accepted 15 November 2018 Available online 16 November 2018 0044-8486/ © 2018 Elsevier B.V. All rights reserved.
Aquaculture 501 (2019) 247–254
Z. Ren et al.
ASS-4, was recovered from the spleen. Isolates from the above pure cultures were then characterized by the biochemical method and used for molecular identification. All isolates were stored at −80 °C in 50% (v/v) glycerol.
Table 1 Primers used for PCR amplification of the 16S rRNA, dnaJ, ela and gyrB genes in this study. Primers
Sequence (5′-3′)
References
16S r RNA
27F:AGAGTTTGATCATGGCTCAG 1492R:TACGGTTACCTTGTTACGACTT dnaJF:CGAGATCAAGAAGGCGTACAAG dnaJ R: CACCACCTTGCACATCAGATC elaF:ACACGGTCAAGGAGATCAACGG elaR:GCTGGTGTTGGCCAGCAGCAGGTAG GyrBF:TCAACTCCGCTGTCTCTAACCTG GyrBR:GCACCCTTACGGCAAGTCATC
Weisburg et al., 1991
dnaJ ela gyrB
2.3. Virulence test and 7-day LD50
Nhung et al., 2007
To determine the virulent capacities of the obtained isolates, bacterial virulence was examined by experimentally infecting healthy tilapia. Tilapia (n = 25) were randomly divided into five groups and the water temperature was adjusted to 28–30 °C. The four isolates were grown overnight in 100 ml LB broth at 30 °C. The cells were harvested by centrifugation (3000 rpm, 15 min), washed and resuspended in phosphate buffer saline (PBS) to an OD600 of approximately 0.8. Four groups were i.p. (0.2 ml/fish) injected with four isolates and the control group was i.p. injected with sterile PBS. The experimental challenge was conducted to determine the lethal dose-50% end point (LD50) in tilapia. The strain ASS-4 was chosen as a representative for the challenge experiments. A total of 100 healthy tilapia was randomly divided into five groups and the water temperature was set to 28–30 °C. Bacterial infection groups were inoculated via i.p. injection with 0.2 mL of freshly cultured cells (after 10 h incubation in LB broth) at either 1.33 × 105, 1.33× 106, 1.33 × 107, 1.33 × 108 colony-forming units (CFU) ml−1, whereas the control group was inoculated with 0.2 mL of sterile PBS. Fish mortality was recorded every 24 h interval for 7 days. LD50 was calculated using the improved Karber's method. To satisfy Koch's postulate, the bacteria were re-isolated and identified from the kidneys, brains and livers of the moribund fish.
Mo et al., 2016 Liu et al., 2014
et al., 2017; Sami et al., 2018) and virus (Skliris and Richards, 2010; Tattiyapong et al., 2017). To date, there have been no documented reports of A. schubertii infecting tilapia. The experimental challenge was conducted through i.p. of pure cultures isolated from diseased fish to confirm pathogenicity. The aim of the study was to investigate the causative agent of the disease outbreak in tilapia using morphological and biochemical characteristics, as well as 16S rRNA gene and housekeeping gene sequence analysis. 2. Materials and methods 2.1. Fish A severe disease outbreak occurred in tilapia from a lagoon in Hainan University, Hainan Province, China, from September to October 2017. The average water temperature of the lagoon was 29 °C and the salinity was 18. Diseased tilapia had hemorrhages near the caudal, dorsal and anal fins, and three fishes (mean weight, 25.87 g) were collected for bacterial isolation. Healthy tilapia (Oreochromis niloticus), weighing 13.67 to 87.44 g and measuring between 95.3 and 181.4 mm in total length, with no record of disease were used for challenge experiments and were obtained from a farm located at Wenchang City, Hainan province, China. Prior to infection, tilapia were acclimatized for 7 d in aquaria with aeration. Fish were fed with commercial feed twice daily. Water was replaced daily and maintained at 28 ± 2 °C.
2.4. Physiological and biochemical tests The preliminary characterization of the isolated strains was carried out by Gram staining, and the morphological characteristics of the four colonies were observed using a microscope. The biochemical characteristics of ASS-4 were determined using microbial biochemical identification tubes (HuanKai Microbial Science and Technology Co. Ltd., Guangzhou, China) with reference to Bergey's Manual of Systematic Bacteriology.
2.2. Bacterial isolation
2.5. Molecular identification
For bacterial isolation, samples obtained from the liver, spleen, kidney and brain of moribund tilapia were streaked onto Luria-Bertani (LB) agar plates for each tissue under a sterile environment and incubated at 30 °C for 18 to 24 h. After 24 h, gray-white colonies with a central uplift, round, moist, smooth surface and a neat edge were observed on all the agar plates. All colonies appeared identical in morphology. Single colonies were picked and re-streaked on fresh LB plates until pure cultures were obtained. One pure culture, designated ASL-1, was recovered from the liver. Two pure cultures, designated ASB-2 and ASB-3, were recovered from the brain. One pure culture, designated
DNA of four isolates were extracted using the MiniBEST Bacterial Genomic DNA Extraction Kit (TaKaRa, Dalian, China) according to the manufacturer's protocol. The 16S rRNA and three housekeeping gene loci, including dnaJ, ela and gyrB, were amplified by PCR. The sequences of the primers used for amplification of the partial sequences of these four loci are listed in Table 1. The PCR conditions used to amplify the four loci were adopted from Liu and Li (2012). The PCR products were sequenced at the Beijing Genomics Institute (BGI) (Beijing, China). The four gene sequences were blasted against GenBank sequences. Multiple sequence alignments were obtained using the
Fig. 1. Clinical signs of tilapia (Oreochromis niloticus) infected with ASS-4. A) Hemorrhages in the caudal, pectoral and dorsal fins, B) effusion in the gut. 248
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 2. Cumulative mortality (%, mean ± SD) of tilapia (Oreochromis niloticus) injected with isolated strains and PBS: A) the cumulative mortality of tilapia injected with the four isolated strains and PBS, and B) the cumulative mortality of tilapia injected with various concentrations of ASS-4 and PBS.
the bacterial pellet was washed thrice with PBS. For the different routes of infection, a pathogen dose titration using 10-fold serial dilutions of ASS-4 was prepared such that the final cell suspensions were 6.87 × 106 CFU ml−1. For the i.p., i.s. and oral exposure routes, the two replicate cohorts of ten fish per treatment were challenged by injection with 0.2 ml of cell suspension. The control group was injected with 0.2 ml of PBS. The bath exposure had two replicates of ten fish. ASS-4 was diluted with fresh water to a concentration of 6.87 × 106 CFU ml−1 and then 20 tilapia were soaked in a diluted cell suspension for 3 h. Three hours later, they were observed in fresh water. The control group in the bath exposure was soaked in fresh water. The water temperature was set to 28–30 °C. Fish mortality was recorded every 24 h interval for 14 days.
Table 2 Comparative biochemical analysis of ASS-4 isolated from tilapia fingerlings with published biochemical data of A. schubertii (n = 3). Biochemical test
ASS-4
A. schubertiia ATCC43700
Glucose Lactose Maltose Mannitol Sucrose Arabinose Sorbitol Inositol Salicine Glycerol Esculin Phenylalanine Raffinose Lysine decarboxylase Ornithine decarboxylase Hydrogen sulfide Gelatine Editpotassium cyanide Gas from nitrite Gas from nitrate Gas from glucose D-Ribose Melezitose Tarch Melibiose Cellobiose Arginine double hydrolase Triple sugar iron
+ − + − − − + − − + + + − + − − + − − − − + − + − − − +
+ − + − − − + − − + − + − + +/− − + − − − − − − + − − +/− +
2.7. Histopathology The liver, spleen and brain of moribund tilapia with typical symptoms were fixed in paraformaldehyde (4%) solution, dehydrated in ethanol, embedded in paraffin wax blocks, sectioned at 6 μm, and stained with H&E for observation (Martoja and Martoja-Pierson, 1967). 2.8. Antimicrobial susceptibility test Thirty-five antibiotics (Hangzhou Microbial Reagent Co., Ltd., China) were used to determine the susceptibility of ASS-4 by the British society for antimicrobial chemotherapy (BSAC) standardized disc susceptibility testing method (Andrews, 2004). After incubation at 30 °C for 24 h, the diameters of the inhibition zones on LB agar plates were measured to determine the antimicrobial susceptibility (S), medium susceptibility (I) or resistance (R).
“+”: positive; “−”: negative;“+/−”: positive or negative. a Phenotypic characteristics of A. schubertii observed as described by Liu and Li (2012).
3. Results CLUSTALW software implemented in the software package MEGA 6.0. Phylogenetic reconstructions based on sequence data were performed using neighbor-joining (N-J). The robustness of each topology was checked with 1000 bootstrap replications (Cao et al., 2014).
3.1. Pathological symptoms investigation Moribund tilapia were sluggish, floating, or swimming alone. The clinical signs of diseased tilapia includes skin hemorrhages on the caudal, dorsal and anal fins (Fig. 1A). The diseased fish were dissected and found to have abdominal effusion (Fig. 1B). No parasites were found after microscopic examination of the diseased fish.
2.6. Infection route experiments To clarify the most efficient way to infect fish with ASS-4, different routes of infection were tested. ASS-4 was subcultured in 200 ml LB broth and was incubated at 30 °C for 10 h. Next, 200 ml of culture was centrifuged at 3000 rpm for 15 min. After discarding the supernatant,
3.2. Cumulative mortality and determination of LD50 Injections of the bacterial strains ASL-1, ASB-2, ASB-3 and ASS-4 249
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 3. N-J phylogenetic tree of the five isolates based on 16S rRNA and three housekeeping genes. A) 16S rRNA, B) ela, C) dnaJ, D) gyrB.
Fig. 2B. There was no mortality in the control fish injected with PBS up to 7 days post injection. The LD50 was 4.91 × 104 CFU/g fish for the i.p. challenge after one week. 3.3. Morphological and biochemical characteristics When incubated for 24 h, the obtained colonies were gray-white with a central uplift, round and moist, with a smooth surface and a neat edge. The four isolates stained purple after Gram staining, indicating that they were Gram-negative bacteria. ASS-4 was positive for glucose, maltose, sorbitol, glycerol, esculin, phenylalanine, lysine decarboxylase, gelatin, D-ribose, starch and triple sugar iron. Additionally, ASS-4 was negative for lactose, sucrose, arabinose, inositol, salicin, raffinose, ornithine decarboxylase, hydrogen sulfide, potassium cyanide, gas from nitrite, gas from nitrate, gas from glucose, melezitose, melibiose, cellobiose, mannitol and arginine double hydrolase (Table 2). Fig. 4. Cumulative mortality (%, mean ± SD) of tilapia injected with ASS-4 or PBS by i.p., i.s., oral exposure, or bath exposure.
3.4. Phylogenetic analysis based on 16S rRNA and housekeeping gene sequences
were lethal. Significant differences in the cumulative mortalities between the treatment and the control were found (P < .05) (Fig. 2A). At 1 day postchallenge, fish injected with ASS-4 died. The dominant strains could be re-isolated from the spleen and liver of the moribund or dead fish. The virulence test showed that ASS-4 was the most virulent strain. We characterized ASS-4 because it was the most virulent strain. The cumulative mortality rate of tilapia infected with ASS-4 is shown in
The four sequences formed a tight clade that branched within the genus Aeromonas. The similarity value among ASL-1 (GenBank Accession No. SUB3783063), ASB-2 (GenBank Accession No. SUB3783069), ASB-3 (GenBank Accession No. SUB3783075), ASS-4 (GenBank Accession No. SUB3783086) and A. schubertii (GenBank Accession No. MH050445) was 100%. Additionally, the 16S rRNA sequences showed fairly high homology (100% and 98.5%) among ASL-1, ASB-3, ASS-4 and ASB-2. In the N-J phylogenetic tree, the dnaJ genes 250
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Fig. 5. Histological section of fish injected with PBS and ASS-4 (H&E Staining: 200×): histological section of a liver from fish injected with A) PBS and B) ASS-4, showing vacuolar degeneration of the hepatocytes (V) and hepatic cell (HC) degeneration; histological section of a spleen from fish injected with C) PBS and D) ASS4, showing depletion of hematopoietic cells (H) and thickening of the ellipsoidal capillaries' wall (EC); histological section of a brain from fish injected with E) PBS and F) ASS-4, showing brain capillaries (BC) swelling.
3.6. Histopathology
and four isolates clustered with A. schubertii (GenBank Accession No. HQ731477) (98.5%, 98.5%, 98.1% and 98.7%); the gyrB genes and four isolates clustered with A. schubertii (GenBank Accession No. FN796751) (96.2%, 96.5%, 96.5% and 96.7%) and the ela genes and four isolates clustered with A. schubertii (GenBank Accession No. DQ124688) (94.5%, 93.3%, 93.9% and 87.9%) (Fig. 3).
The histopathological lesions in the experimentally infected fish were clear. In livers, we found marked vacuolation of the hepatocytes (Fig. 5B). In spleens, we found hemorrhage and depletion of hemopoietic tissue. Spleens showed thickening of the ellipsoidal capillaries' wall, perivascular edema and vascular thrombosis (Fig. 5D). Brains exhibited capillary swelling (Fig. 5F).
3.5. Different infection route experiments 3.7. Antimicrobial susceptibility results The cumulative mortality rates of tilapia after infection with ASS-4 are shown in Fig. 4. The highest cumulative mortality rates were 80%; 65% and 15% for the i.p., i.s., and oral exposure routes of infection, respectively. No mortality was observed for the control fish injected with PBS or bath exposure up to 14 days post injection. Bacterial strains were re-isolated from the dying fish and were identical to the injected strain.
The susceptibility pattern of the isolates from 35 antibacterial agents was carried out. The ASS-4 was susceptible to norfloxacin, rifampicin, aztreonam, cefoperazone, cefradine, florfenicol, furadantin, azlocillin, cefazolin, ceftazidime pentahydrate, piperacillin, cefotaxime, cephalothin, nalidixic acid, mezlocillin, trimethoprim, furazolidone, cefepime, tetracycline, chloramphenicol, ciprofloxacin, ofloxacin and 251
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Table 3 Sensitivity of the ASS-4 strain to antibacterial agents (n = 3). Antibiotics
Erythromycin Norfloxacin Bacitracin Rifampicin Aboren Aztreonam Cefoperazone Cefradine Florfenicol Furadantin Ampicillin Azlocillin Cefazolin Ceftazidime pentahydrate Oxacillin Piperacillin Cefotaxime Cephalothin Nalidixic acid Mezlocillin Penicillin Trimethoprim Furazolidone Cefepime Polymyxin B Streptomycin Tetracycline Chloramphenicol Ciprofloxacin Ofloxacin Neomycin Kanamycin Tobramycin Gentamycin Vancomycin
Content (μg/tablet)
15 10 0.04U 5 30 30 75 30 30 300 10 75 30 30 1 100 30 30 30 75 10 U 5 300 30 300U 10 30 30 5 5 30 30 10 10 30
Diameters of inhibition zone (mm)
11.64 36.04 7.44 24.03 0.00 35.37 32.79 21.39 34.23 21.88 0.00 21.19 22.14 41.12 0.00 30.63 42.95 25.05 41.53 28.13 0.00 26.90 27.48 43.56 15.12 0.00 22.66 32.12 31.84 33.98 14.16 15.06 9.67 17.83 11.23
Critical range
Susceptibility
R (mm)
I (mm)
S (mm)
≤13 ≤12 ≤8 ≤16 ≤13 ≤15 ≤15 ≤14 ≤12 ≤14 ≤13 ≤17 ≤14 ≤14 ≤10 ≤17 ≤14 ≤14 ≤13 ≤17 ≤14 ≤10 ≤14 ≤14 ≤8 ≤11 ≤14 ≤12 ≤15 ≤12 ≤12 ≤13 ≤12 ≤12 ≤9
14–22 13–16 9–12 17–19 14–17 16–21 16–20 15–17 13–17 15–16 14–16 – 15–17 15–17 11–12 18–20 15–22 15–17 14–18 18–20 – 11–15 15–16 15–17 8–11 12–14 15–18 13–17 16–20 13–15 13–16 14–17 13–14 13–14 10–11
≥23 ≥17 ≥13 ≥20 ≥18 ≥22 ≥21 ≥18 ≥18 ≥17 ≥17 ≥18 ≥18 ≥18 ≥13 ≥21 ≥23 ≥18 ≥19 ≥21 ≥15 ≥16 ≥17 ≥18 ≥12 ≥15 ≥19 ≥18 ≥21 ≥16 ≥17 ≥18 ≥15 ≥15 ≥12
R S R S R S S S S S R S S S R S S S S S R S S S R R S S S S I I R S R
Note: “S”: sensitive; “I”: intermediate; “R”: resistant.
(2017) reported that Aeromonas veronii infected Oreochromis niloticus exhibited hemorrhages over the entire body surface. Similar hemorrhagic symptoms were also found in snakehead fish infected by A. schubertii (Chen et al., 2012). In this study, tilapia was the second fish species found to be infected by A. schubertii after snakehead fish. The primary symptoms of tilapia infected with A. schubertii were skin hemorrhages. However, the typical symptoms of A. schubertiiin infected snakehead fish was not the same as those found by Liu and Li (2012), who observed hemorrhages around the mouth and at the base of the fins as well as ivory-white nodules in the kidney. In the same study (Liu and Li, 2012), the symptoms of zebrafish infected with A. schubertii included hemorrhages at the bases of fins; they did not find any ivorywhite nodules. The difference in the appearance of these symptoms may be due to factors such as differences in bacteria serotype, host species and environmental temperature et al. (Liu and Li, 2012; Liu et al., 2014; Mo et al., 2016). Therefore, the main symptom of tilapia infected by A. schubertii is hemorrhages. Up till now, only few studies have explored the possible routes of natural bacterial infection and the routes of A. schubertii's entry in fish remains unknown (Chen et al., 2012; Liu and Li, 2012). In the study of Philasterides dicentrarch infection routes in farmed turbot, Paramá et al. (2003) believed that the natural route of infection was probably through lesions in the gills and/or skin even though the i.p. remains to be the most appropriate route for experimental infection in a fast and reliable manner. In another study, Soto et al. (2016) compared four different entry routes of S. agalactiae in tilapia challenge experiments, and concluded that injectable methods of infection (i.p. and i.s.) may not mimic natural disease and the oral and immersion challenge routes
gentamycin. The ASS-4 was resistant to erythromycin, bacitracin, aboren, ampicillin, oxacillin, penicillin, polymyxin B, streptomycin, tobramycin and vancomycin. The ASS-4 showed intermediate resistance to neomycin and kanamycin (Table 3).
4. Discussion In this study, four isolates were recovered from moribund tilapia. In the pathogenicity test, ASL-1, ASB-2, ASB-3 and ASS-4 exhibited high toxicity, and the symptoms of the diseased fish were the same as naturally infected fish. With reference to Bergey's Manual of Determinative Bacteriology and ATCC 43700, we found that ASS-4 was similar to A. schubertii except for D-ribose. However, it is not surprising that different biotypes or serotype strains exhibit differences in biochemical characteristics. Molecular diagnostics are more precise and accurate for bacterial identification at the species level (Werckenthin et al., 2012; Zhou et al., 2010). Phylogenetic analysis based on 16S rRNA gene sequences (approximately 1500 bp) showed that four isolates had the highest homologies with A. schubertii. Furthermore, based on the housekeeping genes-gyrB, dnaJ and ela, the four isolates were clustered with A. schubertii. Therefore, the etiological agent of tilapia mortality was A. schubertii. Hemorrhages are one of the main symptoms of Aeromonas infection in fish. Aberoum and Jooyandeh (2010) reported that the clinical symptoms of Aeromonas spp. infection in marine fishes were hemorrhagic septicemia. Dias et al. (2016) reported that Aeromonas hydrophila infected Arapaima gigas exhibited hemorrhagic foci as well as necrotic hemorrhages in the kidney, liver and swim bladder. Hassan et al. 252
Aquaculture 501 (2019) 247–254
Z. Ren et al.
more closely resemble natural infection. This study challenged tilapia with A. schubertii via the same four different routes as Soto et al. (2016). High mortality was observed in i.p. and i.s. groups. Low mortality was shown in oral exposure groups and no mortality was observed in immersion group. This result indicated that the pathogenicity of A. schubertii was closely related to the route of infection. This was also consistent with the zero mortality in immersion exposure groups where skin and skill served as excellent barriers to fight back bacterial infection. As for the low mortality (15%) in oral exposure groups, we suspected that a certain percentage of A. schubertii could tolerant the gastrointestinal environment and enter the fish body through gastrointestinal mucosa. Based on the above results, we inferred that the potential infection routes of A. schubertii in tilapia might be through damaged body surface and/or digestive tract. From the antibiotic resistance assay in this study, the isolate ASS-4 was resistant to 10 of 35 (28.6%) antibiotics. This resistance level was similar to results obtained by Liu and Li (2012) who studied the antibiotic resistance profile of A. schubertii from freshwater farmed snakehead fish. The result of their study revealed that A. schubertii was resistant to 7 of 25 (28.0%) antibiotics, including bacitracin, ampicillin and vancomycin, which were also reported in the current study. The resistance of A. schubertii to tobramycin and streptomycin were reported in two other A. schubertii investigations (Mo et al., 2016; Overman and Janda, 1999), respectively. The finding that all four A. schubertii isolates in this study were resistant to ampicillin and penicillin, two β-lactam antibiotics, were in high accordance with many other Aeromonas spp. researches. The resistance of Aeromonas spp. towards ampicillin/penicillin is considered indigenous, i.e. the resistance is present naturally (Janda and Abbott, 2010). The major mechanism of β-lactam resistance in Aeromonas species were revealed extensively: at least three chromosomally mediated, inducible β-lactamases naturally exist in Aeromonas species (Jones and Wilcox, 1995; Walsh et al., 1995). As to the other antibiotics resistances discovered in A. schubertii, they were probably acquired through “horizontal resistance transfer”, where antibiotics resistance can be acquired as a result of microbes coming in contact with antibiotics in their environment. This type of resistance is often plasmid – extrachromosomal DNA mediated (Kümmerer, 2009). Considering the brackish lagoon in Hainan University was located near the Nandujiang River estuary, where urban wastewater effluents, including effluents from hospitals were discharged, it is not surprising that a high prevalence of multi-antimicrobial resistance was observed in the A. schubertii isolates in this study. In conclusion, this is the first report of A. schubertii infecting wild fish from brackish water. Moreover, experimental challenges via different routes indicated that the most possible natural infection routes of A. schubertii in tilapia was through damaged body surface and/or digestive tract. 16S rRNA, dnaJ, gyrB and ela gene sequence analysis of four isolates provides scientific reference data for fish disease diagnostics. The data presented will shed light on the pathogenicity of A. schubertii and will help prevent and control A. schubertii-induced diseases in fish.
Bacharach, E., Mishra, N., Briese, T., Zody, M.C., Kembou Tsofack, J.E., Zamostiano, R., Berkowitz, A., Ng, J., Nitido, A., 2016. Characterization of a novel orthomyxo-like virus causing mass die-offs of tilapia. MBio 7, 431–446. Cao, H., He, S., Lu, L., Yang, X., Chen, B., 2014. Identification of a Proteus penneri isolate as the causal agent for the red body disease of the cultured white shrimp Penaeus vannamei and its control with Bdellovibrio bacteriovorus. Antonie Van Leeuwenhoek 105, 423–430. Carnahan, A.M., Marii, M.A., Fanning, G.R., Pass, M.A., Joseph, S.W., 1989. Characterization of Aeromonas schubertii strains recently isolated from traumatic wound infections. J. Clin. Microbiol. 27, 1826–1830. Chen, Y.F., Liang, R.S., Zhuo, X.L., Wu, X.T., Zou, J.X., 2012. Isolation and characterization of Aeromonas schubertii from diseased snakehead, Channa maculata (lacepède). J. Fish Dis. 35 (6), 421. Cleasby, N., Schwarz, A.M., Phillips, M., Paul, C., Pant, J., Oeta, J., Pickering, T., Meloty, A., Laumani, M., Kori, M., 2014. The socio-economic context for improving food security through land based aquaculture in Solomon Islands: a pen-urban case study. Mar. Policy 45, 89–97. Dhalla, S., Flynn, J.T., 1980. Aeromonas hydrophila-induced fulminant diarrhea. New York State J. Med. 80 (13), 1965. Dias, M.K., Sampaio, L.S., Proiettijunior, A.A., Yoshioka, E.T., Rodrigues, D.P., Rodriguez, A.F., 2016. Lethal dose and clinical signs of Aeromonas hydrophila in Arapaima gigas (arapaimidae), the giant fish from amazon. Vet. Microbiol. 188, 12–15. Dong, H.T., Techatanakitarnan, C., Jindakittikul, P., Thaiprayoon, A., Taengphu, S., Charoensapsri, W., 2017. Aeromonas jandaei and Aeromonas veronii caused disease and mortality in nile tilapia, Oreochromis niloticus (L.). J. Fish Dis. 40 (10), 1395–1403. Geller, H.S., Tofte, R.W., Cunningham, B.L., 1983. Aeromonas hydrophila wound infection of the hand initially presenting as clostridial myonecrosis. J. Hand Surg. 8 (3), 333–335. Gomna, A., 2011. The role of tilapia in food security of fishing villages in Niger state, Nigeria. Afr. J. Food Agric. Nutr. Dev. 11 (7), 5561–5572. Guo, S.L., Yang, Q.H., Feng, J.J., Duan, L.H., Zhao, J.P., 2016. Phylogenetic analysis of the pathogenic genus Aeromonas spp. isolated from diseased eels in China. Microb. Pathog. 101, 12–23. Hassan, M.A., Noureldin, E.A., Mahmoud, M.A., Fita, N.A., 2017. Molecular identification and epizootiology of Aeromonas veronii, infection among farmed Oreochromis niloticus, in eastern province, ksa. Egypt. J. Aquat. Res. 43 (2), 161–167. Hickman-Brenner, F.W., Fanning, G.R., Arduino, M.J., Brenner, D.J., Farmer, J.J., 1988. Aeromonas schubertii, a new mannitol-negative species found in human clinical specimens. J. Clin. Microbiol. 26, 1561–1564. Janda, J.M., Abbott, S.L., 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23 (1), 35–73. Li, J., Ye, X., Lu, M.X., Deng, G.C., Chi, Y.Y., Huang, Z.H., 2011. Isolation and identification of Aeromonas veronii from infected tilapia fry and analysis of its drug sensitivity. J. Hydroecol. 32 (3), 132–136. Jones, B.L., Wilcox, M.H., 1995. Aeromonas infections and their treatment. J. Antimicrob. Chemother. 35 (4), 453–461. Joseph, S.W., Carnahan, A.M., Brayton, P.R., Fanning, G.R., Almazan, R., Drabick, C., 1991. Aeromonas jandaei and Aeromonas veronii dual infection of a human wound following aquatic exposure. J. Clin. Microbiol. 29 (3), 565–566. Kao, T.L., Kao, M.L., 2011. A fatal case of necrotizing Aeromonas schubertii fasciitis after penetrating injury. Am. J. Emerg. Med. 17, 1–3. Ketover, B.P., Young, L.S., Armstrong, D., 1973. Septicemia due to Aeromonas hydrophila: clinical and immunologic aspects. J. Infect. Dis. 127 (3), 284–290. Kumari, J., Sahoo, P.K., 2006. Non-specific immune response of healthy and immunocompromised Asian catfish (Clarias batrachus) to several immunostimulants. Aquaculture 255, 133–141. Kümmerer, K., 2009. Antibiotics in the aquatic environment-a review-part II. Chemosphere 75, 435–441. Li, G.F., Zhao, D.H., Huang, L., Sun, J.J., Gao, D., Wang, H.F., et al., 2006. Identification and phylogenetic analysis of Vibrio vulnificus isolated from diseased Trachinotus ovatus in cage mariculture. Aquaculture 261, 17–25. Liu, J.Y., Li, A.H., 2012. First case of Aeromonas schubertii infection in the freshwater cultured snakehead fish, Ophiocephalus argus (cantor), in China. J. Fish Dis. 35 (5), 335–342. Liu, C., Li, K.B., Wang, Q., Wang, F., Zeng, W.W., Shi, C.B., Wu, S.Q., 2014. Establishment of duplex PCR for detection of pathogenic Aeromonas schubertii. Chin. J. Prevent. Vet. Med. 36 (01), 54–57. Martoja, R., Martoja-Pierson, M., 1967. Initiation aux techniques de l'histologie animale. Masson et Cie, Paris (1232pp). Mo, J.F., Jiang, L., Wu, Z.H., 2016. Biological characteristics and drug susceptibility of Aeromonas schubertii WL-4 isolated from snakehead. J. Fish. China 40 (03), 484–494. Ng, W.K., Romano, N., 2013. A review of the nutrition and feeding management of farmed tilapia throughout the culture cycle. Rev. Aquac. 5 (4), 220–254. Nhung, P.H., Hata, H., Ohkusu, K., Noda, M., Shah, M.M., Goto, K., Ezak, T., 2007. Use of the novel phylogenetic marker dnaJ and DNA–DNA hybridization to clarify interrelationships within the genus Aeromonas. Int. J. Syst. Evol. Microbiol. 57, 1232–1237. Overman, T.L., Janda, J.M., 1999. Antimicrobial susceptibility patterns of Aeromonas jandaei, A. schubertii, A. trota, and A. veronii biotype veronii. J. Clin. Microbiol. 37 (3), 706. Paramá, A., Iglesias, R., Álvarez, M.F., Leiro, J., Aja, C., Sanmartı́N, M.L., 2003. Philasterides dicentrarchi, (ciliophora, scuticociliatida): experimental infection and possible routes of entry in farmed turbot (Scophthalmus maximus). Aquaculture 217 (1), 73–80. Sami, A.A., Fuad, A., Khalidah, S.A., Bashar, A.A., Sarfaraz, H., Ashraf, A.M., 2018.
Acknowledgment This study was funded by the National Natural Science Foundation of China (No. 31560725, No. 41666006); the Special Program for Marine Science and Technology of Hainan (No. 2015XH02); the Natural Science Foundation of Hainan Province (No. 2016CXTD005). We thank Yue Wu, Xin Chen and Qiming Li for their help in the experiments. References Aberoum, A., Jooyandeh, H., 2010. A review on occurrence and characterization of the Aeromonas species from marine Fishes. World J. Fish Mar. Sci. 2 (6), 519–523. Andrews, J.M., 2004. BSAC standardized disc susceptibility testing method (version 4). J. Antimicrob. Chemother. 53 (5), 713–728.
253
Aquaculture 501 (2019) 247–254
Z. Ren et al.
Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703. Werckenthin, C., Gey, A., Straubinger, R.K., Poppert, S., 2012. Rapid identification of the animal pathogens Streptococcus uberis and Arcanobacterium pyogenes by fluorescence in situ hybridization (fish). Vet. Microbiol. 156 (3–4), 330–335. Yang, J.P., Mu, J.G., Liu, Y., Jin, H.E., Ren, S.M., Liu, X.C., 2015. Isolation and identification of Aeromonas veronii in Tilapia. Prog. Vet. Med. 36 (5), 40–43. Yang, Y., Yu, H., Li, H., Wang, A., 2016. Transcriptome profiling of grass carp (Ctenopharyngodon idellus) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 51, 329–336. Yu, H., He, Z., Yan, Y.B., Yang, G.Y., Hu, J., Zhou, M.J., 2009. Identification of Plesiomonas shigelloides and Aermonas schuberti from doctor fish (Garra rufa) and antibiotics sensitivity (in Chinese). Chin. J. Anim. Health Inspect. 7, 37–39. Zepeda-Velázquez, A.P., Vega-Sánchez, V., Ortega-Santana, C., Rubio-Godoy, M., OcaMira, D.M.D., Soriano-Vargas, E., 2017. Pathogenicity of Mexican isolates of Aeromonas sp. in immersion experimentally-infected rainbow trout (Oncorhynchus mykiss, walbaum 1792). Acta Trop. 169, 122–124. Zhou, S.M., Xie, M.Q., Zhu, X.Q., Ma, Y., Tan, Z.L., Li, A.X., 2010. Identification and genetic characterization of Streptococcus iniae strains isolated from diseased fish in China. J. Fish Dis. 31 (11), 869–875. Zhu, J.J., Gan, X., Ao, Q.W., Shen, X.S., Tan, Y., Chen, M., Luo, J., Wang, H., Jiang, H., Li, C., 2018. Basal polarization of the immune responses to Streptococcus agalactiae susceptible and resistant tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 75, 336–345.
Histopathological studies of experimental Aeromonas hydrophila infection in blue tilapia, Oreochromis aureus. Saudi J. Biol. Sci. 25, 182–185. Skliris, G.P., Richards, R.H., 2010. Nodavirus isolated from experimentally infected tilapia, Oreochromis mossambicus (peters). J. Fish Dis. 22 (4), 315–318. Soto, E., Zayas, M., Tobar, J., Illanes, O., Yount, S., Francis, S., Dennis, M.M., 2016. Laboratory-controlled challenges of Nile Tilapia (Oreochromis niloticus) with Streptococcus agalactiae: comparisons between immersion, oral, intracoelomic and intramuscular routes of infection. J. Comp. Pathol. 155, 339–345. Souza, C.F., Verdi, C.M., Baldissera, M.D., Doleski, P.H., Vizzotto, B.S., Santos, R., 2017. Xanthine oxidase activity affects pro-oxidative and pro-inflammatory profiles in spleen of silver catfish experimentally infected with Aeromonas caviae. Microb. Pathog. 113, 25–28. Su, Y., Feng, J., Liu, C., Li, W., Xie, Y., Li, A., 2017. Dynamic bacterial colonization and microscopic lesions in multiple organs of tilapia infected with low and high pathogenic Streptococcus agalactiae, strains. Aquaculture 471, 190–203. Suthipintawongs, C., Wanvaree, S., 1982. Gas gangrene: an unusual manifestation of Aeromonas infection. J. Med. Assoc. Thailand 65 (12), 678. Tattiyapong, P., Dachavichitlead, W., Surachetpong, W., 2017. Experimental infection of tilapia lake virus (tilv) in nile tilapia (Oreochromis niloticus), and red tilapia (oreochromis, spp.). Vet. Microbiol. 207, 170–177. Walsh, T.R., Payne, D.J., MacGowan, A.P., 1995. A Clinical Isolate of Aeromonas sobria With Three Chromosomally Mediated Inducible Beta-lactamases: A Cephalosporinase, a Penicillinase and a Third Enzyme, Displaying Carbapenemase Activity. 35(2). pp. 271–279.
254