First report of a sequence type 239 vancomycin-intermediate Staphylococcus aureus isolate in Mainland China

Diagnostic Microbiology and Infectious Disease 77 (2013) 64–68

Contents lists available at SciVerse ScienceDirect

Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio

Antimicrobial Susceptibility Studies

First report of a sequence type 239 vancomycin-intermediate Staphylococcus aureus isolate in Mainland China Xia Zhang, Qiwen Hu, Wenchang Yuan, Weilong Shang, Hang Cheng, Jizhen Yuan, Junmin Zhu, Zhen Hu, Shu Li, Wei Chen, Xiaomei Hu ⁎, Xiancai Rao ⁎ Department of Microbiology, College of Basic Medical Sciences, Third Military Medical University, Key Laboratory of Microbial Engineering under the Educational Committee in Chongqing, Chongqing 400038, China

a r t i c l e

i n f o

Article history: Received 22 March 2013 Received in revised form 30 May 2013 Accepted 4 June 2013 Available online 19 July 2013 Keywords: MRSA VISA Vancomycin

a b s t r a c t Methicillin-resistant Staphylococcus aureus (MRSA) is an important pathogen that causes a wide range of both hospital- and community-acquired infections. The high prevalence of MRSA and the extensive use of vancomycin in Mainland China may lead to the emergence of vancomycin-intermediate S. aureus (VISA) isolates. In this case, we report a VISA isolate from a 34-year-old male patient with steam burn. The isolate was determined to be sequence type 239 staphylococcal cassette chromosome mec type III, the most prevalent MRSA clone in Mainland China. © 2013 Elsevier Inc. All rights reserved.

1. Introduction Vancomycin-intermediate Staphylococcus aureus (VISA) strains have been detected among clinical isolates in many countries. It was first reported in Japan in 1997 (Hiramatsu et al., 1997), then in the United States (Smith et al., 1999), France, Australia, Scotland, Brazil, South Korea, Thailand, Israel, and others countries (Howden et al., 2010). In China, the heterogeneous VISA (hVISA) and VISA strains were first reported in Hong Kong and then in Taiwan (Lu et al., 2005; Wong et al., 1999). In Mainland China, a VISA isolate with an MIC of 4 μg/mL has been determined in an epidemiological study of hVISA (Sun et al., 2009), and that isolate was sequence type 5 (ST5) staphylococcal cassette chromosome mec (SCCmec) type II methicillin-resistant S. aureus (MRSA). The epidemiological surveys showed that sequence type 239 (ST239) was the most popular MRSA prevalent in Mainland China, which dominated over 55% of all MRSA isolates (Cheng et al., 2013; Liu et al., 2009). In the present study, we phenotypically and molecularly characterized the first VISA isolate of ST239 MRSA from a steam burn patient hospitalized in Chongqing, Western China. 2. Case report A 34-year-old patient with 90% trunk steam burned was hospitalized on 19 February 2004. During his hospitalization, he underwent 2 skin operations on 23 February 2004 and 9 March 2004, respectively. Dexamethasone was routinely prescribed (5 mg pulver⁎ Corresponding authors. Department of Microbiology, Third Military Medical University, Chongqing 400038, China. Tel.:+86-23-68752240. E-mail addresses: [email protected] (X. Hu), [email protected] (X. Rao). 0732-8893/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2013.06.008

ized inhalation every 6 h) for the reduction of inflammation in his wound postburn. Gentamicin was prescribed (80,000 IU given intravenously every 24 h) to prevent bacterial infections, and vancomycin (1 g given intravenously every 24 h) was added (from 23 February to 27 February 2004) to enhance the anti-infection power after the first operation. The first S. aureus isolate was recovered from wound secretion samples on 4 March 2004, and the drug susceptibility test showed that this S. aureus isolate (designated as XN108) was resistant to all antibiotics tested, including piperacillin-tazobactam, tetracycline, cephazolin, ceftriaxone, cefoperazone, amikacin, aztreonam, ceftazidime, cefuroxime, cefotaxime, meropenem, levofloxacin, piperacillin, imipenem, tobramycin, and vancomycin. Therefore, vancomycin was still prescribed but with an increasing of dosage (1 g intravenous every 12 h) as an S. aureus medication from 8 March to 11 March 2004 for the second operation. A Proteus mirabilis was isolated on 10 March 2004; Pseduomonas aeruginosa and Escherichia coli were isolated from wounds on 12 March 2004. The patient expired in the morning of 16 March 2004. XN108 was first characterized by a Microscan Walkaway-40 Automatic Bacteria Analyzer (Dade Behring, USA). The 16S rRNA, mecA, femB, and pvl genes were detected using a multiplex polymerase chain reaction (PCR) assay as previously described (Yuan et al., 2013). XN108 was then subjected to molecular typing analysis, including pulsed-field gel electrophoresis (Chung et al., 2000), multilocus sequence typing (MLST) (Enright et al., 2000), SCCmec typing (Milheirico et al., 2007), and staphylococcal protein A (spa) gene typing (Aires-de-Sousa et al., 2006). The primers used in this study were listed in Table 1. The 16S rRNA sequencing revealed that XN108 is a staphylococcal strain. As expected, PCR amplification of the MRSA-specific mecA and femB genes yielded products and

X. Zhang et al. / Diagnostic Microbiology and Infectious Disease 77 (2013) 64–68

demonstrated XN108 as an MRSA isolate. XN108 had pvl gene. Furthermore, molecular typing methods revealed that XN108 was a SCCmec type III, multilocus ST239, and spa type 037 MRSA. The vancomycin MIC was determined by the standardized microbroth dilution methods, according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2011). The E-test was also performed with a vancomycin strip according to the instructions of the manufacturer (AB Biodisk, Solna, Sweden). A more detailed evaluation of vancomycin susceptibility was done by population analysis profile method as previously described (Hiramatsu et al., 1997). The MIC for XN108 against vancomycin was ≥8 μg/mL based on the broth dilution method, while it was 12 μg/mL by E-test (Fig. 1A). Population analysis showed that XN108 was intermediate resistant to vancomycin, with 100% of the population growing in the presence of 4 μg/mL vancomycin (Fig. 1B). According to CLSI criteria, these results demonstrated that XN108 was a VISA strain. The growth curve and Triton X-100 stimulated autolysis were determined according to the method as previously described (Passalacqua et al., 2012; Pillai et al., 2009). Similarly to Mu50, the first identified VISA strain (Hiramatsu et al., 1997), XN108 has slower growth rate and decreased Triton X-100–induced autolysis ability

65

compared with a vancomycin susceptible Staphylococcus aureus strain ATCC 25923 (Figs. 2A and 2B). The XN108 strain does not carry vanA, vanB, and vanC1-3 genes as detected by PCR with oligonucleotide primers (Table 1) and thermal conditions as described (Patel et al., 1998; Ramos-Trujillo et al., 2003), indicating that such genes do not contribute to reduced vancomycin susceptibility in XN108. Cui et al. (2003) reported that cell wall thickening is a common feature of VISA strains. To test this, XN108 and the control strains were prepared and observed under a TECNAI 10 transmission electron microscope (Philips, Eindhoven, The Netherlands), and the cell wall thickness was determined as previously described (Yuan et al., 2013). As expected, XN108 and Mu50 showed thicker cell walls (39.25 ± 2.95 nm and 37.46 ± 3.39 nm, respectively) in the presence of 8 μg/mL vancomycin than that of the control strain ATCC 25923 (17.83 ± 2.2 nm) (Figs. 3A and 3B). Furthermore, quantitative real-time PCR (qRT-PCR) to detect the genes that encode crucial enzymes for staphylococcal peptidoglycan assembly, including pbpB, murG, and glum, was performed as described (Yuan et al., 2013). The results demonstrated that the tested genes were more than 6-fold up-regulated after treatment with 8 μg/mL vancomycin (Fig. 3C).

Table 1 The primers used in this study. Category

Target gene

Sequence (5′→3′)

Size (bp)

Reference

Speciation gene

16S rRNA

756

Kobayashi et al., 1994

Virulence/drug resistance genes

pvl

AACTCTGTTATTAGGGAAGAACA CCACCTTCCTCCGGTTTGTCACC ATCATTAGGTAAAATGTCTGGACATGATCCA GCATCAAGTGTATTGGATAGCAAAAGC GTAGAAATGACTGAACGTCCGATAA CCAATTCCACATTGTTTCGGTCTAA TTACAGAGTTAACTGTTACC ATACAAATCCAGCACGCTCT AGACGATCCTTCGGTGAGC CAGCAGTAGTGCCGTTTG ATTGCCTTGATAATAGCCYTCT TAAAGGCATCAATGCACAAACACT CGTCTATTACAAGATGTTAAGGATAAT CCTTTATAGACTGGATTATTCAAAATAT GCCACTCATAACATATGGAA CATCCGAGTGAAACCCAAA TATACCAAACCCGACAACTAC CGGCTACAGTGATAACATCC TTGATTCACCAGCGCGTATTGTC AGGTATCTGCTTCAATCAGCG ATCGGAAATCCTATTTCACATTC GGTGTTGTATTAATAACGATATC CTAGGAACTGCAATCTTAATCC TGGTAAAATCGCATGTCCAATTC ATCGTTTTATCGGGACCATC TCATTAACTACAACGTAATCGTA GTTAAAATCGTATTACCTGAAGG GACCCTTTTGTTGAAAAGCTTAA TCGTTCATTCTGAACGTCGTGAA TTTGCACCTTCTAACAATTGTAC CAGCATACAGGACACCTATTGGC CGTTGAGGAATCGATACTGGAAC TCCTGCGACAAGTGAATTGAA AAAGCTGGACGCACAGTGTCT CTGCAATCGCTAACGGTGGT CCACACGTCTTTCGCTGCATT ACTTCCTAAGCTTCCACCCATAACA CTGACTTAACACCAGGATTAGCGA GCAACGCAAGCTGAAAAGGA TACACTTCTACGATGCCGCC GGGAAAACGACAATTGC GTACAATGCGGCCGTTA GTGCTGCGAGATACCACAGA CGAACACCATGCAACATTTC GATGGCWGTATCCAAGGA GTGATCGTGGCGCTG GATGGCWGTATCCAAGGA ATCGAAAAAGCCGTCTAC

433

Kobayashi et al., 1994

310

Kobayashi et al., 1994

651

Kobayashi et al., 1994

168

Aires-de-Sousa et al., 2006

937

Milheirico et al., 2007

518

Milheirico et al., 2007

415

Milheirico et al., 2007

359

Milheirico et al., 2007

456

Enright et al., 2000

456

Enright et al., 2000

465

Enright et al., 2000

429

Enright et al., 2000

474

Enright et al., 2000

402

Enright et al., 2000

516

Enright et al., 2000

198

Enright et al., 2000

190

Yuan et al., 2013

227

This study

196

This study

885

Ramos-Trujillo et al., 2003

885

Ramos-Trujillo et al., 2003

467

Patel et al., 1998

429

Patel et al., 1998

mecA femB spa typing

spa

SCCmec typing

ccrA2-B ccrC IS1272 mecA–IS431

MLST typing

arc aro glp gmk pta tpi yqi

qRT-PCR

pta pbpB murG glmU

Vancomycin resistance genes

vanA vanB vanC1 vanC2/3

66

X. Zhang et al. / Diagnostic Microbiology and Infectious Disease 77 (2013) 64–68

Fig. 1. Vancomycin susceptibility of VISA isolate XN108. (A) Strain XN108 was grown overnight in brain heart infusion medium and used to determine vancomycin MIC by E-test. (B) Population analysis of the VISA isolate XN108 and the control strains Mu50 and ATCC25923. The curves are representative of at least 3 experiments with each strain.

3. Discussion Vancomycin has traditionally been reserved as a drug of last resort that used only after treatment with other antibiotics had failed. Recently, the reduced vancomycin susceptibility in MRSA is associated with vancomycin treatment failure and persistent infection; however, VISA strains with a vancomycin MIC of ≥8 μg/mL are still uncommon (Howden et al., 2008). The emergence of VISA strains might be anticipated given the high prevalence of MRSA and extensive use of vancomycin in Mainland China. In a previous study, a VISA strain (4sy39) with an MIC of 4 μg/mL was reported (Sun et al., 2009), which was a ST5-SCCmec type II MRSA strain isolated from blood sample in 2005. Using MRSA isolates collected between 2005 and 2006, Liu et al. (2009) reported that ST239 and ST5 were the 2 major epidemic sequence types (STs) that dominated 80.8% and 16.7%, respectively, of all MRSA isolates in Mainland China. Therefore, to reveal whether there are VISA isolates among ST239 MRSA in Mainland China is

important and urgent. In our case, a VISA strain (XN108) with an MIC of 12 μg/mL against vancomycin was isolated from a 34-year-old male patient with steam burn. XN108 was characterized to be ST239SCCmec type III MRSA and is the first VISA strain reported to belong to ST239, the most popular ST prevalent in Mainland China. Although ST is not a prerequisite for VISA emergence, the VISA strains may commonly be characterized from the major epidemic STs of MRSA isolates distributed in different regions. The first VISA strain Mu50 reported from Japan was determined to be ST5 (Hiramatsu et al., 1997), and in Japan, the New York/Japan MRSA clone belonging to ST5 and possessing the SCCmec II is predominant among both inpatients and outpatients (Yamamoto et al., 2010). In Australia, the ST239 MRSA is the common health care-associated MRSA strain (Nimmo et al., 2006), and the reported 3 VISA strains in Australia are all of ST239 MRSA (Howden et al., 2008). The VISA strains reported in Korea had been ST5 or ST239, 2 popular health care–associated MRSA clones in this country (Chung et al., 2010). Recently, a VISA has been

Fig. 2. Phenotypic features of VISA isolate XN108, S. aureus ATCC 25923, and the VISA strain Mu50. (A) Growth curve. The overnight culture of each strain in the absence of vancomycin was 1:1000 diluted with fresh bacterial medium, the optical density (OD600) was measured with spectraMax M2e (Molecular Device, Sunnyvale, CA, USA) every 15 min for 24 h at 37 °C to draw the growth curve. The curves are representative of at least 3 independent experiments with each strain. (B) Triton X-100 stimulated autolysis assay. Bacterial cells were grown in BHI broth to mid-logarithmic phase, pelleted, washed twice with ice-cold water, and then resuspended in the Triton X-100 lysis buffer (0.05 mol/L TrisHCl, pH 7.2, 0.05% Triton X-100). The decrease in OD600 was determined every 15 min for 3 h. The percentage of the remaining optical density of each strain at each time point was plotted. The test was repeated 3 times, and 1 representative was indicated.

X. Zhang et al. / Diagnostic Microbiology and Infectious Disease 77 (2013) 64–68

67

Fig. 3. Transmission electron microscopy and qRT-PCR analysis of the representative VISA strains. (A) Transmission electron microscopy of S. aureus ATCC 25923 after growth in the absence of vancomycin (top panel), Mu50 after growth in the presence of 4 μg/mL vancomycin (central panel), and XN108 after growth in the presence of 8 μg/mL vancomycin (bottom panel), magnification, ×65000; bar = 100 nm. (B) Comparison of cell wall thickness between the strains ATCC 25923, Mu50, and XN108. The data are expressed as the mean ± SD of 30 cells of each strain for determination and were evaluated by the Student's t test, where a P value less than 0.05 were considered statistically significant and indicated. All statistical tests were 2 tailed. (C) Determination of the expression of pbpB, glum, and murG genes of XN108 after growth in the absence (0) or presence (8) of 8 μg/mL vancomycin by qRT-PCR. The P values that less than 0.05 were indicated.

determined to be ST72-MRSA-IV, also an important pathogen in the community and in hospitals in Korea during the past decade (Chung et al., 2012). The VISA isolates demonstrated phenotypic changes commonly associated with the intermediate resistance phenotype. XN108 has common features of VISA strains. It exhibits characteristic cell wall thickening together with decreased growth rate and Triton X-100– induced autolysis. The increased expressions of the pbpB, murG, and glmU genes in the presence of vancomycin may confer the thickened cell wall of XN108, resulting in the vancomycin resistant phenotype. Importantly, XN108 was isolated from the patient wound sample collected 5 days after the first vancomycin treatment, suggesting that the inappropriate usage of vancomycin (such lower dosage) may play an important role in the selection of VISA. XN108 was resistant to all antibiotics tested in the susceptibility determination; therefore, the patient was given higher dosage of vancomycin treatment for the second operation. This medication seems to be effective because no XN108-like S. aureus strains were isolated from samples collected

1 day and 3 days after the second operation. Our report that the first VISA characterized from ST239 MRSA rings an alarm that the most popular ST MRSA prevalent in Mainland China has accumulated the evolutionary power to resistant vancomycin, and we strongly recommend the appropriate usage of vancomycin in clinic. Acknowledgments The present work was supported by the National Natural Science Foundation of China (grant nos. 31270979 and 81171622) and the New Drug Development Project of China (grant no. 2012ZX09103301-038). References Aires-de-Sousa M, Boye K, de Lencastre H, Deplano A, Enright MC, Etienne J, et al. High interlaboratory reproducibility of DNA sequence-based typing of bacteria in a multicenter study. J Clin Microbiol 2006;44(2):619–21. Cheng H, Yuan W, Zeng F, Hu Q, Shang W, Tang D, et al. Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus

68

X. Zhang et al. / Diagnostic Microbiology and Infectious Disease 77 (2013) 64–68

clones associated with two characteristic antimicrobial resistance profiles in China. J Antimicrob Chemother 2013. http://dx.doi.org/10.1093/jac/dkt213. Chung M, de Lencastre H, Matthews P, Tomasz A, Adamsson I, Aires de Sousa M, et al. Molecular typing of methicillin-resistant Staphylococcus aureus by pulsed-field gel electrophoresis: comparison of results obtained in a multilaboratory effort using identical protocols and MRSA strains. Microb Drug Resist 2000;6(3):189–98. Chung G, Cha J, Han S, Jang H, Lee K, Yoo J, et al. Nationwide surveillance study of vancomycin intermediate Staphylococcus aureus strains in Korean hospitals from 2001 to 2006. J Microbiol Biotechnol 2010;20(3):637–42. Chung DR, Baek JY, Kim HA, Lim MH, Kim SH, Ko KS, et al. First report of vancomycinintermediate resistance in sequence type 72 community genotype methicillinresistant Staphylococcus aureus. J Clin Microbiol 2012;50(7):2513–4. Performance standards for Antimicrobial Susceptibility Testing; Twenty-First Information Supplement. CLSI document M100-S21. Wayne, PA: Clinical and Laboratory Standards Institute; 2011. Cui L, Ma X, Sato K, Okuma K, Tenover FC, Mamizuka EM, et al. Cell wall thickening is a common feature of vancomycin resistance in Staphylococcus aureus. J Clin Microbiol 2003;41(1):5–14. Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol 2000;38(3):1008–15. Hiramatsu K, Aritaka N, Hanaki H, Kawasaki S, Hosoda Y, Hori S, et al. Dissemination in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to vancomycin. Lancet 1997;350(9092):1670–3. Howden BP, Smith DJ, Mansell A, Johnson PD, Ward PB, Stinear TP, Davies JK. Different bacterial gene expression patterns and attenuated host immune responses are associated with the evolution of low-level vancomycin resistance during persistent methicillin-resistant Staphylococcus aureus bacteraemia. BMC Microbiol 2008;8:39. Howden BP, Davies JK, Johnson PD, Stinear TP, Grayson ML. Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomycin-intermediate and heterogeneous vancomycin-intermediate strains: resistance mechanisms, laboratory detection, and clinical implications. Clin Microbiol Rev 2010;23(1):99–139. Kobayashi N, Wu H, Kojima K, Taniguchi K, Urasawa S, Uehara N, et al. Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction. Epidemiol Infect 1994;113(2):259–66. Liu Y, Wang H, Du N, Shen E, Chen H, Niu J, et al. Molecular evidence for spread of two major methicillin-resistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals. Antimicrob Agents Chemother 2009;53(2):512–8.

Lu JJ, Lee SY, Hwa SY, Yang AH. Septic arthritis caused by vancomycin-intermediate Staphylococcus aureus. J Clin Microbiol 2005;43(8):4156–8. Milheirico C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51(9):3374–7. Nimmo GR, Coombs GW, Pearson JC, O'Brien FG, Christiansen KJ, Turnidge JD, et al. Methicillin-resistant Staphylococcus aureus in the Australian community: an evolving epidemic. Med J Aust 2006;184(8):384–8. Passalacqua KD, Satola SW, Crispell EK, Read TD. A mutation in the PP2C phosphatase gene in a Staphylococcus aureus USA300 clinical isolate with reduced susceptibility to vancomycin and daptomycin. Antimicrob Agents Chemother 2012;56: 5212–23. Patel R, Rouse MS, Piper KE, Cockerill 3rd FR, Steckelberg JM. In vitro activity of LY333328 against vancomycin-resistant enterococci, methicillin-resistant Staphylococcus aureus, and penicillin-resistant Streptococcus pneumoniae. Diagn Microbiol Infect Dis 1998;30(2):89–92. Pillai SK, Wennersten C, Venkataraman L, Eliopoulos GM, Moellering RC, Karchmer AW. Development of reduced vancomycin susceptibility in methicillin-susceptible Staphylococcus aureus. Clin Infect Dis 2009;49(8):1169–74. Ramos-Trujillo E, Perez-Roth E, Mendez-Alvarez S, Claverie-Martin F. Multiplex PCR for simultaneous detection of enterococcal genes vanA and vanB and staphylococcal genes mecA, ileS-2 and femB. Int Microbiol 2003;6(2):113–5. Smith TL, Pearson ML, Wilcox KR, Cruz C, Lancaster MV, Robinson-Dunn B, et al. Emergence of vancomycin resistance in Staphylococcus aureus. GlycopeptideIntermediate Staphylococcus aureus Working Group. N Engl J Med 1999;340(7): 493–501. Sun W, Chen H, Liu Y, Zhao C, Nichols WW, Chen M, et al. Prevalence and characterization of heterogeneous vancomycin-intermediate Staphylococcus aureus isolates from 14 cities in China. Antimicrob Agents Chemother 2009;53(9): 3642–9. Wong SS, Ho PL, Woo PC, Yuen KY. Bacteremia caused by staphylococci with inducible vancomycin heteroresistance. Clin Infect Dis 1999;29(4):760–7. Yamamoto T, Nishiyama A, Takano T, Yabe S, Higuchi W, Razvina O, Shi D. Communityacquired methicillin-resistant Staphylococcus aureus: community transmission, pathogenesis, and drug resistance. J Infect Chemother 2010;16(4):225–54. Yuan W, Hu Q, Cheng H, Shang W, Liu N, Hua Z, et al. Cell wall thickening is associated with adaptive resistance to amikacin in methicillin-resistant Staphylococcus aureus clinical isolates. J Antimicrob Chemother 2013;68(5):1089–96.