- Email: [email protected]
First report of THOC6 related intellectual disability (Beaulieu Boycott Innes syndrome) in two siblings from India
European Journal of Medical Genetics xxx (xxxx) xxxx
Contents lists available at ScienceDirect
European Journal of Medical Genetics journal homepage: www.elsevier.com/locate/ejmg
First report of THOC6 related intellectual disability (Beaulieu Boycott Innes syndrome) in two siblings from India Neerja Guptaa, , Sakshi Yadava, Venkatesh Babu Gurramkondaa, Ramprasad VLb, Thenral SGb, Madhulika Kabraa ⁎
a b
Division of Genetics, Department of Pediatrics, All India Institute of Medical Genetics, New Delhi, India Medgenome Laboratory Private Limited, 3rd Floor, 258/A, Narayana Health City, Hosur Road, Bommasandra, Bengaluru, India
ARTICLE INFO
ABSTRACT
Keywords: Beaulieu boycott innes syndrome Intellectual disability Chromosomal microarray Whole exome sequencing THOC6
THOC6 is a newly described causal gene for an autosomal recessive intellectual disability (ID) - Beaulieu Boycott Innes syndrome (BBIS) (OMIM # 613680). It is characterized by ID with dysmorphic facies, genitourinary, cardiac anomalies, and dentition problems. Here, we report the first two siblings of BBIS from the Indian subcontinent with previously unreported skeletal anomalies such as Sprengel shoulder, calcaneo valgus deformity, radioulnar dysostosis, and overlapping toes. Whole exome sequencing (WES) identified previously reported three missense variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) in THOC6. THOC6 is a subunit of TRanscription and EXport (TREX) complex involved in mRNA transcription, processing, and nuclear export of spliced mRNAs and has a potential role in neurodevelopment. Till date, only 12 patients with BBIS have been reported. This report reviews the phenotypic and genetic data of known BBIS cases in addition to the new phenotypic features, thereby expanding the phenotype of this rare syndrome.
1. Introduction Evaluation of Intellectual disability (ID) and global developmental delay (GDD) have always been challenging to geneticists. Owing to extreme genetic heterogeneity, genome-wide approaches such as chromosomal microarray (CMA) and whole exome sequencing (WES) are increasingly being used in the comprehensive evaluation of ID patients. This has not only helped in elucidating new genetic causes of ID but has also provided detailed information about prognosis, treatment options, and inheritance pattern (Vissers et al., 2015). Miller et al., in 2010 have recommended CMA to be used as a 1st tier for evaluation of ID patients with the diagnostic yield of 14–15% (Miller et al., 2010). The utility of CMA has been studied widely, including 106 Indian patients with ID and dysmorphism with or without multiple congenital anomalies with a diagnostic yield of up to 14.2% (Sharma et al., 2016). Next-generation sequencing (NGS) has strikingly enhanced the gene discovery and has helped identify genetic etiology (Rauch et al., 2012). So far more than 400 genes have been identified for autosomal dominant intellectual disability (ADID) through whole exome sequencing (WES) with a diagnostic yield of 20–60% for de novo variants (Wieczorek, 2018). Likewise, NGS of 136 consanguineous families identified 23 previously implicated ID genes and 50 novel candidate
⁎
genes, confirming the extreme genetic heterogeneity of underlying ID (Najmabadi et al., 2011). Beaulieu et al. (2013) have discovered one such novel gene, THOC6 (OMIM *615403), in 2013 in 4 patients of ID and dysmorphism using WES. Here, we report the first two Indian siblings with Beaulieu Boycott Innes syndrome (BBIS) (OMIM #613680) with three homozygous variants to expand the phenotype of BBIS and review the literature. This report also iterates the importance of reverse phenotyping after obtaining genomic test results. 2. Clinical report The study included two sibs with ID, born to a non-consanguineous Indian couple. 3. Patient 1 Nine-year-old male child (II-1) presented with global development delay and failure to thrive. He was born by cesarean section at 37 weeks because of maternal high blood pressure with a birth weight of 1.75 kg. Developmental milestones were delayed in all domains. Neck holding was achieved at 11 months, and he started walking independently at two years and six months. He pronounced the first bisyllabic sounds at
Corresponding author. Division of Genetics, Department of Paediatrics, AIIMS, New Delhi, 110029, India. E-mail address: [email protected] (N. Gupta).
https://doi.org/10.1016/j.ejmg.2019.103742 Received 4 March 2019; Received in revised form 8 June 2019; Accepted 13 August 2019 1769-7212/ © 2019 Elsevier Masson SAS. All rights reserved.
Please cite this article as: Neerja Gupta, et al., European Journal of Medical Genetics, https://doi.org/10.1016/j.ejmg.2019.103742
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
Fig. 1. 1 (A, B) (II-1) shows facial dysmorphism. Note deep-set eyes, synophrys, low hanging columella, epicanthal folds, and bulbous nose tip. 1(C) Left Sprengel shoulder. 1(D)X-Ray chest shows the right cervical rib (white arrow) and Sprengel shoulder. 1 (E, F) (II-2) with dysmorphic features. Note tall forehead, deep-set eyes, long hanging columella, and thin upper and lower lip. 1(G) Shows calcaneovalgus deformity in feet and overlapping toes.
perinatal period. He was noticed to have delayed milestones due to nonattainment of head control at six months. He started sitting without support at around 18 months, and presently, he could only walk with support. He could speak only monosyllabic words and recognized his parents. On anthropometry, his height, weight and OFC were 79 cm (−5.05 SD), 8.5 kg (−4.45 SD), 43 cm (−4.70 SD) respectively (WHO growth charts). He had similar features as his sib which included high forehead with high anterior hairline, deep-set eyes, short palpebral fissures with up slant, low hanging columella with bulbous nasal tip, thin upper and lower lip and prominent chin (Fig. 1E and 1F). Calcaneo valgus deformity with overlapping of toes (Fig. 1G) and left-sided cryptorchidism were other additional fndings. His SQ was 25 on VSMS scale (Hill et al., 2017). Ultrasound abdomen revealed a single left kidney with right renal agenesis. MRI brain and ECHO were normal. After an informed consent, molecular testing using chromosomal microarray (CMA) followed by whole exome sequencing was performed.
Fig. 2. Shows the pedigree and segregation analysis of the three variants.
three years and at presentation he could speak only 6–7 words and was unable to frame a complete sentence. On examination, his weight was 16 kg (at −4.23 SD), height was 122 cm (at −1.88 SD), and occipitofrontal circumference (OFC) was 45.5 cm (< -3 SD) (WHO growth charts). He had dysmorphic features such as synophrys, deep-set eyes, short palpebral fissures, epicanthic folds, prominent chin and nose with low hanging columella along with plagiocephaly (Fig. 1A and B). He also had left Sprengel shoulder (Fig. 1C) along with restricted movement at the radio-ulnar joint on the same side. Bilateral testes were undescended. His Social Quotient (SQ) on Vineland Social Maturity Scale (Hill et al., 2017) (VSMS) was 30. Rest of the examination was not contributory. X-ray chest and cervical spine confirmed the presence of left Sprengel shoulder in addition to the right cervical rib and 5th cervical hemivertebrae (Fig. 1D). Ultrasound abdomen revealed single malrotated kidney in the pelvis with normal corticomedullary differentiation. Tc99 dimercaptosuccinic acid (DMSA) scans showed normal renal function. Magnetic Resonance Imaging (MRI) brain and echocardiography (ECHO) were unremarkable.
5. Material and methods 5.1. Chromosomal microarray (CMA) HumanCytoSNP-12 Beadchip array (Illumina, San Diego, USA) was used that contain 300 K markers across the genome. The average spatial resolution between probes for the 300 K array was approximately 10 Kb. A copy number change was called when more than ten consecutive probes were involved in a segment. Data were analyzed using Karyostudio software. Genomic positions were based on the UCSC February 2009 human reference sequence (hg19) (NCBI build 37 reference sequence assembly). 5.2. Whole exome sequencing (WES) DNA extracted from blood was used to perform selective capturing of protein-coding genes using whole exome capture kit (Exome research panel, Integrated DNA Technologies, CA, USA). The libraries were sequenced to as 2 × 100 bp paired-end reads on an Illumina HiseqX and aligned to the human reference genome (GRch37/hg19) using BurrowsWheeler algorithm (BWA) (Li and Durbin, 2010). GATK best-practices variant-calling pipeline (McKenna et al., 2010) was used to identify
4. Patient 2 Three years old younger brother (II-2) of patient 1 also had global developmental delay. He was also born by cesarean section at 39 completed weeks, and birth weight was 2 kg and had uneventful 2
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
Fig. 3. (A) Diagrammatic representation of THOC6. (B) Schematic representation of THOC6 gene coding protein THO complex subunit six homolog and mutation spectrum-all reported variants till date and variants found in our studied subjects. (C) Phylogenetic conservation of variants shown by multiple sequence alignment of proteins among different species indicated by a rectangular box. (D) Sanger sequencing validation of the three variants identified in THOC6 gene.
variants which were annotated using variant effect predictor tool (Ensembl). The clinically relevant mutations were annotated using disease databases ClinVar, OMIM, HGMD, and SwissVar. The variants were filtered based on allele frequency in various population databases 1000 Genomes Phase 3, ExAC and our internal database (N = 1500). The effect of non-synonymous and splice sites was assessed using different algorithms such as SIFT, Polyphen-2, LRT, Mutation taster 2, SpanR, human splicing finder, and MutPred. The variants were analyzed using Varminer (in-house analysis tool) and interpreted based on the American College of Medical Genetics (2015) guidelines (Richards et al., 2015).
WES- We generated ~6 Gb of paired-end sequencing data with 5080x average on target depth of coverage. Approximately 92% of the sequenced bases had average base quality ≥ Q30 and ~95% of the reads aligned to the human genome (hg19). The common variants shared by the affected siblings were prioritized. Variants with high minor allele frequency > 1% in various population-based databases (ExAC,1000 Genome) or variants present in the homozygous state in the parental samples were filtered out. Shared homozygous variants observed in the two affected siblings in the LOH regions detected by microarray were selected. The variants were subsequently prioritized based on clinically relevant reported variants in literature, evolutionary conservation, in silico prediction (Liu et al., 2016) and clinical relevance. Following the prioritization of the variants, we detected three reported homozygous variants in THOC6 gene shared by both the affected siblings and were detected in the heterozygous state in the parental samples. The homozygous missense variants were detected at codon 100 (chr16:3076141T > A; p.Trp100Arg; ENST00000326266), at codon 234 (chr16:3077171G > C; p.Val234Leu; ENST00000326266) and at codon 275 (chr16:3077380G > A; p.Gly275Asp; ENST00000326266) in exons 4, 11 and 12 respectively (ClinVar accession number: SCV000920766, SCV000920767, SCV000920768, respectively). These were further validated by Sanger sequencing. Parents were heterozygous for all three variants (Fig. 2). These reference codons were conserved across species (Fig. 3). The minor allele frequency (MAF) of all three variants was 0.02% in 1000 genomes, 0.02% in ExAC, and 0.05% in our internal databases. The in silico predictions of all three missense variants were damaging by LRT and MutationTaster 2. The variant Trp100Arg was predicted to be damaging by SIFT and PolyPhen-2.
5.3. Sanger sequencing The variants in THOC6 gene were sequenced on an ABI 3730 genetic analyzer (Applied Biosystems, CA, USA), following PCR amplification using primers 5′TTCAGGACTTTGGGTGGGAT3′ and 5′GCTCCTTACAG CCCTTCAAA3′ for exon 4 and 5′TGTTTGGCAACTGATTCCGA3′ and 5′ CAGGTTGGTGAAGACATCCA3′ for exon 11 and 12, standardized at an annealing temperature of 60OC. 6. Results CMA analysis of patient 1 showed no copy number variations. Instead a long continuous stretch of copy neutral loss of heterozygosity (cnLOH) spanning around 200 genes on 16p13.3 (3.6 Mb, 2353151–6028451), 20p11.21p11.1 (3.1 Mb, 23028137–26225145) and 20q11.21p11.22 (3.2 Mb, 30221104–33451148) region was observed. Reverse phenotyping and correlation with the genes in the cnLOH on 16p13.3 narrowed the possibility of THOC6 related ID (Beaulieu et al., 2013). 3
4
A3 7 M French 3rd centile -1SD -1.5SD
Family Consanguinity Patient Gender Ethnicity Anthropometry
Development delay
Amos et al (2017) C3 9 M Iranian 3rd centile n/a -2SD
B3 8 F * -2SD +2SD -3SD Moderate ID
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Mutation in THOC6 gene
Authors
N/D
Neuroimaging
PDA, VSD Horse shoe kidney with duplex collecting system Dental malocclusion and caries
Nocturnal enuresis, velopharyngeal insufficiency
Skeletal anomaly
Teeth
Cardiac anomaly Genito urinary
Other Health issues
Associated congenital defects
Dysmorphism
Micrognathia
A4 10 F Italian -2.24SD -3.70SD -5.0SD
A5 11 M European -
B5 12 F European -
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Mattioli et al (2018)
N/D
Myopia, recurrent UTI, endometriosis
Dental caries
-
-
+ +
4 F Hutterite 10-25th centile 2nd centile Speech delay, learning disability moderate ID + + +
Myopia, recurrent UTI, premature ovarian failure, osteoporosis Normal
Dental caries
-
-
+ +
B + 3 F Hutterite 10-25th centile 2nd centile Speech delay, learning disability moderate ID + + +
Accogli et al (2018)
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
N/D
Nocturnal and daytime enuresis
Dental malocclusion and caries
VSD Absent left kidney
-
+ +
Tall forehead Deep set eyes Short up slant palpebral fissure Long nose Low Hanging columella Epicanthal fold Other features + +
Development delay
A + 1 F Hutterite 5th centile 2nd centile Speech delay, learning disability moderate ID + + +
Family Consanguinity Patient Gender Ethnicity Anthropometry
Height Weight Head circumference
2 F Hutterite 10th centile 2nd centile Speech delay, learning disability moderate ID + + +
Beaulieu et al. (2013)
Authors
Table 1 shows comparison of various phenotypic features of the present study and previous studies
A6 II-1 M Indian -1SD -3SD -2SD Severe ID
This study
Homozygous c.259C > T p.Arg87* (Non sense mutation)
N/D
Atopic dermatitis, over riding toes, imperforate anus
-
+ Pointed chin, mild camptodactyly ASD, VSD, PDA Undescended testes
+ +
+ + +
A1 + 5 M Arabian -2.3SD -2.7SD 10th centile Motor and speech delay
Anazi et al (2016)
(continued on next page)
II-2 M Indian -3SD -3SD -2SD Severe ID
Mild Ventriculomegaly, normal myelination Homozygousc.298T > A, p.Trp100Arg: c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Dental malocclusion and caries Pesplanus, fetal finger pad, Multiple epiphyseal dysplasia, Cyclical vomiting
Single duplex left kidney
+ Mild ptosis, sparse eyebrows
-
+ +
A2 6 F Irish 0.4-2nd centile 9th centile 2nd centile Motor and speech delay
Casey et al (2016)
N. Gupta, et al.
European Journal of Medical Genetics xxx (xxxx) xxxx
5
-
-
Corpus callosum dysgenesis
Compound hetero c.135C > A, p.Tyr45* c.569G > A, p.Gly190Glu (Non sense- missense)
Neuroimaging
Mutation in THOC6 gene Compound hetero c.748A > C, p.Thr250Pro c.259C > T, p.Arg87* (Missensenonsense)
Corpus callosum aplasia, Ventriculomegaly.
Hypothyroidism, strabismus, obsessive compulsive disorder, hearing loss
Homozygous c.611A > C p.Gln204Pro (Missense mutation)
Normal
Hearing loss
Hypoplastic fifth toenail
Dental caries
Dental malocclusion Lardosis
-
-
Vermiandysgenesis, hydrocephalous due to aqueduct stenosis, partial agenesis of septum pallucidum, hippocampal dysgenesis. Compound hetero c.577C > T,p.R193*, c.792_793delCA , p.V264Vfs*48 (Non sense mutation)
Supernumerary teeth, malocclusion Segmentation defect of cervical vertebra, scoliosis, cubitus valgus, Right trigger thumb, b/ lcamptodactyly of 3/4th fingers, right hip dislocation, b/l genu valgum, clinodactyly of 3rd /4th toes Hypergonadotropichypogonadism, myopia, optic disc hypoplasia, recto perineal fistula, imperforate anus
Mitral insufficiency, tachyarrhythmia Left ectopic dysplastic kidney in right hemi pelvis
Homozygous C.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A, p.Gly275Asp (Missense mutation)
Short corpus callosum
Feeding difficulty
-
-
Micropenis
-
Severe ID, speech delay, upper limb stereotypes + + + Retrognathia
Mattioli et al (2018)
Compound hetero c.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A, p.Gly275Asp, c.569G > A, p.Gly190Glu (Missense mutation)
Exostropia, nystagmus, hyperopia, hearing loss,poorfeeding,seizures, pulmonary hypertension Hydrocephalous
B/l overlapping toes
Malocclusion
-
+ + + + Microcephaly,cuppedears,tented upper lip,maxillary hypoplasia, cleft palate, choanal atresia, persistent fetal pads ASD, PDA
Severe motor and speech delay
Homozygous c.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Normal
Myopia
Sprengel shoulder, right cervical rib, 5th cervical hemi vertebra
-
Single malrotated kidney, both testes undescended
-
+ + + + + Synophrys, Prominent square chin, plagiocephaly. Prominent chin
This study
Homozygous c.298T > A, p.Trp100Arg: c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Normal
-
Calcaneovalgus deformity foot, over riding toes, 3rd/4thfinger camptodactyly
Left testis undescended, absent right kidney -
-
+ + + + + Thin upper and lower lip. Prominent chin.
M- male, F- female, B/l- bilateral, SD- standard deviation, ASD- atrial septal defect, VSD- ventricular septal defect, PDA- patent ductus arteriosus, UTI- urinary tract infection, N/D- not done * ethnicity not mentioned
Recurrent UTI
Pes valgus
Left testicular atopy
+ + + + + -
+ Low set ears, submucus cleft
+ + + + + -
VSD
Moderate ID and motor stereotypes
No speech, moderate- severe ID
Motor delay, severe speech delay, and ID + + Bifid nasal tip, wide mouth, thin lips, sparse and short eyebrows, bifid uvula, tall and pointed chin
Accogli et al (2018)
Amos et al (2017)
Other Health issues
Associated congenital defects
Dysmorphism
Authors
Table 1 (continued)
N. Gupta, et al.
European Journal of Medical Genetics xxx (xxxx) xxxx
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
7. Discussion
mammalian cells (Beaulieu et al., 2013). Later after three years, Anazi (Anazi et al., 2016) et al. identified the homozygous truncating mutation (p.Arg87*) in a Saudi patient with ID and overlapping clinical features to the Hutterite patients. Amos (Amos et al., 2017) et al. identified four novel (p.Tyr45*, p.Gly190Glu, p.Thr250Pro & p.Gln204Pro) and one previously reported (p.Arg87*) variant in unrelated patients with moderate to severe ID and additional clinical features. Recently Accogli (Accogli et al., 2018) et al. identified two novel compound heterozygous variants, p.R193* and p.V264Vfs*48, in THOC6 in an Italian patient with a severe phenotype including multiple brain and skeletal anomalies and they speculated that severe phenotype might be due to stop and frameshift mutations that resulted in THOC6 loss-of-function. Till date, seven missense and five non-sense variants in homozygous and compound heterozygous states have been reported in THOC6 in various domains (Fig. 2) with no established clear genotype-phenotype correlation. Of these variants, three common recurrent missense variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) are present in 5 patients in the homozygous/compound heterozygous state, including two patients in the present study. Mattioli (Mattioli et al., 2018) et al. have validated the pathogenicity of these three variants in THOC6 protein mislocalization and altered interaction with THOC1 and THOC5 in 2018. The group also mentioned about the highest frequency of these three variants in the European population (UK10K data 0.001 in 3577 individuals). In GnomAD database, these variants are also reported in the heterozygous state at the same MAF in different subpopulations that include South Asia. In the 1000 genomes database, the variants were reported in the European population but not observed in Indian representative population (Gujarati Indian in Houston (GIH) & Indian Telugu from the UK (ITU). This data suggests that these three missense variants are in total linkage disequilibrium in the European population. Interestingly, our patients have the same three variants as previously reported in three BBI individuals with Northern European origin. Genetic evidence indicates that Ancestral North Indians' are genetically closely related to Middle Easterners, Central Asians, and Europeans (Reich et al., 2009). Earlier studies also suggest that disease-related single nucleotide variations (SNVs) previously validated in European populations may be similar to non-European populations, particularly Indians (Pandit et al., 2011). To conclude, this report further expands the phenotypic spectrum of BBI syndrome due to 3 common missense variants. The relative rarity and the non-recognizable phenotype of BBIS poses diagnostic challenges and underscore the importance of NGS in the evaluation of idiopathic intellectual disability.
Beaulieu–Boycott–Innes syndrome (BBIS) is characterized by mild to moderate ID, with subtle dysmorphism, renal and cardiac malformations, and dental malocclusion/caries. Till date, twelve patients have been described (Beaulieu et al., 2013; Amos et al., 2017; Mattioli et al., 2018). We report the first two patients of BBI syndrome from the Indian subcontinent, with the previously reported homozygous pathogenic variants in THOC6 using whole exome sequencing. Table 1 compares the phenotypic features in the present report and the previously described 12 cases. Major features included moderate to severe ID (14/14), short palpebral fissures with upslant (13/14), tall forehead (12/14), long nose (11/14), low hanging columella (9/14), deep-set eyes (8/14), and retrognathia (5/14). Both of our patients had prominent chin instead of retrognathia. Three out of 10 had corpus callosal agenesis on MRI. One patient recently reported in 2018 by Accogli (Accogli et al., 2018) et al. had multiple CNS anomalies including cerebellar hypoplasia, mesencephalosynapsis, vermian dysgenesis, hydrocephalus, partial agenesis of septum pallucidum, and hippocampal dysgenesis. Our patients did not have any brain abnormality. Five out of fourteen patients had structural heart anomalies and one patient had mitral insufficiency and tachyarrhythmia. Dental malocclusion/caries was not present in our patients, although it has been a consistent finding in previously reported patients. In addition, both sibs had undescended testes and renal anomalies, including horseshoe kidney (in II-1) and unilateral renal agenesis (in II-2) which have been previously reported in 4 patients. Accogli (Accogli et al., 2018) et al. has reported multiple skeletal findings such as cervical vertebra, cubitus valgus, right trigger thumb, bilateral camptodactyly of 3rd/4th fingers, bilateral genu valgum, and dislocated right hip. Another Irish patient (Casey et al., 2016) was also reported to have a blended phenotype and had multiple epiphyseal dysplasia in addition to THOC6 related ID. In this report, both sibs had previously unreported variable skeletal features such as presence of left Sprengel shoulder with C5 hemi vertebra and right cervical rib, abnormal 3rd rib with constriction at posterior end and radioulnar dysostosis on left side in elder sib whereas younger sib had only 3rd and 4th finger camptodactyly and calcaneo valgus deformity with overriding of toes in both feet demonstrating intrafamilial variability. The candidate gene, THOC6, has been mapped to 5.1 Mb region at chromosome 16p13.3 (Online Mendelian Inherita, 1540). THOC6 is a subunit of the multimeric protein complex known as THO complex which is an integral part of TRanscription and EXport (TREX), a conserved multisubunit complex involved in mRNA transcription, processing and nuclear export of spliced mRNAs (Bretes et al., 2014). It is essential for embryogenesis, organogenesis, and cellular differentiation throughout life. In humans, the core THO subcomplex consists of following subunits THOC1, THOC2, THOC5-7 (Chi et al., 2013). Mutations in THOC2 have been described to cause X linked syndromic mental retardation (Kumar et al., 2015). Beaulieu et al. also studied the zebrafish thoc6 ortholog during embryonic development and in situ hybridization results confirmed that THOC6 was expressed in the midbrain and eyes and thus, may have a potential role in neuronal development (Beaulieu et al., 2013). THOC6 gene encodes 341 amino acids length protein, which is also known as WD (Tryptophan - Aspartic acid) repeat-containing protein, consisting of seven WD40 repeat domains (Xu and Min, 2011). In the present study, the reported three variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) are located in WD2, WD5, and WD6 domains, respectively (Fig. 2). Insilco stability analysis showed these three variants as highly destabilizing in nature (DDG < -0.5k) that may disrupt the function of the protein and cause a drastic phenotypic consequence. Beaulieu et al. first identified novel missense variant (p.Gly46Arg), in WD1 domain of THOC6 protein in the syndromic form of ID patients, which affects the normal protein function and causes protein mislocalization and invitro depletion of THOC6 also induces apoptosis in
Conflicts of interest There is no conflict of interest among authors. Acknowledgment We acknowledge the patients and their family for their participation in the study. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ejmg.2019.103742. References Accogli, A., Scala, M., Calcagno, A., et al., 2018. Novel CNS malformations and skeletal anomalies in a patient with Beaulieu-boycott-Innes syndrome. Am. J. Med. Genet. 176 (12), 2835–2840. https://doi.org/10.1002/ajmg.a.40534. Amos, J.S., Huang, L., Thevenon, J., et al., 2017. Autosomal recessive mutations in THOC6 cause intellectual disability: syndrome delineation requiring forward and reverse phenotyping. Clin. Genet. 91 (1), 92–99. https://doi.org/10.1111/cge.12793.
6
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al. Anazi, S., Alshammari, M., Moneis, D., Abouelhoda, M., Ibrahim, N., Alkuraya, F.S., 2016. Confirming the candidacy of THOC6 in the etiology of intellectual disability. Am. J. Med. Genet. 170A (5), 1367–1369. https://doi.org/10.1002/ajmg.a.37549. Beaulieu, C.L., Huang, L., Innes, A.M., et al., 2013. Intellectual disability associated with a homozygous missense mutation in THOC6. Orphanet J. Rare Dis. 8, 62. https://doi. org/10.1186/1750-1172-8-62. Bretes, H., Rouviere, J.O., Leger, T., et al., 2014. Sumoylation of the THO complex regulates the biogenesis of a subset of mRNPs. Nucleic Acids Res. 42 (8), 5043–5058. https://doi.org/10.1093/nar/gku124. Casey, J., Jenkinson, A., Magee, A., et al., 2016. Beaulieu-Boycott-Innes syndrome: an intellectual disability syndrome with characteristic facies. Clin. Dysmorphol. 25 (4), 146–151. https://doi.org/10.1097/MCD.0000000000000134. Chi, B., Wang, Q., Wu, G., et al., 2013. Aly and THO are required for assembly of the human TREX complex and association of TREX components with the spliced mRNA. Nucleic Acids Res. 41 (2), 1294–1306. https://doi.org/10.1093/nar/gks1188. Hill, T.L., Saulnier, C.A., Cicchetti, D., Gray, S.A.O., Carter, A.S., 2017. Vineland III. In: Encyclopedia of Autism Spectrum Disorders. Springer, pp. 1–4. Kumar, R., Corbett, M.A., van Bon, B.W.M., et al., 2015. THOC2 mutations implicate mRNA-export pathway in X-linked intellectual disability. Am. J. Hum. Genet. 97 (2), 302–310. https://doi.org/10.1016/j.ajhg.2015.05.021. Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26 (5), 589–595. https://doi.org/10.1093/bioinformatics/ btp698. Liu, X., Wu, C., Li, C., Boerwinkle, E., 2016. dbNSFP v3.0: a one-stop database of functional predictions and annotations for human nonsynonymous and splice-site SNVs. Hum. Mutat. 37 (3), 235–241. https://doi.org/10.1002/humu.22932. Mattioli, F., Isidor, B., Abdul-Rahman, O., et al., November 2018. Clinical and functional characterization of recurrent missense variants implicated in THOC6-related intellectual disability. Hum Mol Genet 10.1093/hmg/ddy391. doi:10.1093/hmg/ ddy391. McKenna, A., Hanna, M., Banks, E., et al., 2010. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20 (9), 1297–1303. https://doi.org/10.1101/gr.107524.110. Miller, D.T., Adam, M.P., Aradhya, S., et al., 2010. Consensus statement: chromosomal
microarray is a first-tier clinical diagnostic test for individuals with developmental disabilities or congenital anomalies. Am. J. Hum. Genet. 86 (5), 749–764. https:// doi.org/10.1016/j.ajhg.2010.04.006. Najmabadi, H., Hu, H., Garshasbi, M., et al., 2011. Deep sequencing reveals 50 novel genes for recessive cognitive disorders. Nature 478 (7367), 57–63. https://doi.org/ 10.1038/nature10423. Online mendelian inheritance in man, OMIM®. Johns Hopkins University, Baltimore MMN* 615403: 09/14/2018. WWWU. https://omim.org. Pandit, L., Ban, M., Sawcer, S., et al., 2011. Evaluation of the established non-MHC multiple sclerosis loci in an Indian population. Mult. Scler. 17 (2), 139–143. https:// doi.org/10.1177/1352458510384011. Rauch, A., Wieczorek, D., Graf, E., et al., 2012. Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study. Lancet (London, England) 380 (9854), 1674–1682. https://doi.org/10.1016/ S0140-6736(12)61480-9. Reich, D., Thangaraj, K., Patterson, N., Price, A.L., Singh, L., 2009. Reconstructing Indian population history. Nature 461, 489. https://doi.org/10.1038/nature08365. Richards, S., Aziz, N., Bale, S., et al., 2015. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of medical genetics and genomics and the association for molecular pathology. Genet. Med. 17 (5), 405–424. https://doi.org/10.1038/gim.2015.30. Sharma, P., Gupta, N., Chowdhury, M.R., et al., 2016. Application of chromosomal microarrays in the evaluation of intellectual disability/global developmental delay patients - a study from a tertiary care genetic centre in India. Gene 590 (1), 109–119. https://doi.org/10.1016/j.gene.2016.06.020. Vissers, L.E.L.M., Gilissen, C., Veltman, J.A., 2015. Genetic studies in intellectual disability and related disorders. Nat. Rev. Genet. 17, 9. https://doi.org/10.1038/ nrg3999. WHO growth charts http://www.who.int/childgrowth/en/. Wieczorek, D., 2018. Autosomal dominant intellectual disability. Medizinische Genet Mitteilungsblatt des Berufsverbandes Medizinische Genet eV 30 (3), 318–322. https://doi.org/10.1007/s11825-018-0206-2. Xu, C., Min, J., 2011. Structure and function of WD40 domain proteins. Protein Cell 2 (3), 202–214. https://doi.org/10.1007/s13238-011-1018-1.
7
Contents lists available at ScienceDirect
European Journal of Medical Genetics journal homepage: www.elsevier.com/locate/ejmg
First report of THOC6 related intellectual disability (Beaulieu Boycott Innes syndrome) in two siblings from India Neerja Guptaa, , Sakshi Yadava, Venkatesh Babu Gurramkondaa, Ramprasad VLb, Thenral SGb, Madhulika Kabraa ⁎
a b
Division of Genetics, Department of Pediatrics, All India Institute of Medical Genetics, New Delhi, India Medgenome Laboratory Private Limited, 3rd Floor, 258/A, Narayana Health City, Hosur Road, Bommasandra, Bengaluru, India
ARTICLE INFO
ABSTRACT
Keywords: Beaulieu boycott innes syndrome Intellectual disability Chromosomal microarray Whole exome sequencing THOC6
THOC6 is a newly described causal gene for an autosomal recessive intellectual disability (ID) - Beaulieu Boycott Innes syndrome (BBIS) (OMIM # 613680). It is characterized by ID with dysmorphic facies, genitourinary, cardiac anomalies, and dentition problems. Here, we report the first two siblings of BBIS from the Indian subcontinent with previously unreported skeletal anomalies such as Sprengel shoulder, calcaneo valgus deformity, radioulnar dysostosis, and overlapping toes. Whole exome sequencing (WES) identified previously reported three missense variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) in THOC6. THOC6 is a subunit of TRanscription and EXport (TREX) complex involved in mRNA transcription, processing, and nuclear export of spliced mRNAs and has a potential role in neurodevelopment. Till date, only 12 patients with BBIS have been reported. This report reviews the phenotypic and genetic data of known BBIS cases in addition to the new phenotypic features, thereby expanding the phenotype of this rare syndrome.
1. Introduction Evaluation of Intellectual disability (ID) and global developmental delay (GDD) have always been challenging to geneticists. Owing to extreme genetic heterogeneity, genome-wide approaches such as chromosomal microarray (CMA) and whole exome sequencing (WES) are increasingly being used in the comprehensive evaluation of ID patients. This has not only helped in elucidating new genetic causes of ID but has also provided detailed information about prognosis, treatment options, and inheritance pattern (Vissers et al., 2015). Miller et al., in 2010 have recommended CMA to be used as a 1st tier for evaluation of ID patients with the diagnostic yield of 14–15% (Miller et al., 2010). The utility of CMA has been studied widely, including 106 Indian patients with ID and dysmorphism with or without multiple congenital anomalies with a diagnostic yield of up to 14.2% (Sharma et al., 2016). Next-generation sequencing (NGS) has strikingly enhanced the gene discovery and has helped identify genetic etiology (Rauch et al., 2012). So far more than 400 genes have been identified for autosomal dominant intellectual disability (ADID) through whole exome sequencing (WES) with a diagnostic yield of 20–60% for de novo variants (Wieczorek, 2018). Likewise, NGS of 136 consanguineous families identified 23 previously implicated ID genes and 50 novel candidate
⁎
genes, confirming the extreme genetic heterogeneity of underlying ID (Najmabadi et al., 2011). Beaulieu et al. (2013) have discovered one such novel gene, THOC6 (OMIM *615403), in 2013 in 4 patients of ID and dysmorphism using WES. Here, we report the first two Indian siblings with Beaulieu Boycott Innes syndrome (BBIS) (OMIM #613680) with three homozygous variants to expand the phenotype of BBIS and review the literature. This report also iterates the importance of reverse phenotyping after obtaining genomic test results. 2. Clinical report The study included two sibs with ID, born to a non-consanguineous Indian couple. 3. Patient 1 Nine-year-old male child (II-1) presented with global development delay and failure to thrive. He was born by cesarean section at 37 weeks because of maternal high blood pressure with a birth weight of 1.75 kg. Developmental milestones were delayed in all domains. Neck holding was achieved at 11 months, and he started walking independently at two years and six months. He pronounced the first bisyllabic sounds at
Corresponding author. Division of Genetics, Department of Paediatrics, AIIMS, New Delhi, 110029, India. E-mail address: [email protected] (N. Gupta).
https://doi.org/10.1016/j.ejmg.2019.103742 Received 4 March 2019; Received in revised form 8 June 2019; Accepted 13 August 2019 1769-7212/ © 2019 Elsevier Masson SAS. All rights reserved.
Please cite this article as: Neerja Gupta, et al., European Journal of Medical Genetics, https://doi.org/10.1016/j.ejmg.2019.103742
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
Fig. 1. 1 (A, B) (II-1) shows facial dysmorphism. Note deep-set eyes, synophrys, low hanging columella, epicanthal folds, and bulbous nose tip. 1(C) Left Sprengel shoulder. 1(D)X-Ray chest shows the right cervical rib (white arrow) and Sprengel shoulder. 1 (E, F) (II-2) with dysmorphic features. Note tall forehead, deep-set eyes, long hanging columella, and thin upper and lower lip. 1(G) Shows calcaneovalgus deformity in feet and overlapping toes.
perinatal period. He was noticed to have delayed milestones due to nonattainment of head control at six months. He started sitting without support at around 18 months, and presently, he could only walk with support. He could speak only monosyllabic words and recognized his parents. On anthropometry, his height, weight and OFC were 79 cm (−5.05 SD), 8.5 kg (−4.45 SD), 43 cm (−4.70 SD) respectively (WHO growth charts). He had similar features as his sib which included high forehead with high anterior hairline, deep-set eyes, short palpebral fissures with up slant, low hanging columella with bulbous nasal tip, thin upper and lower lip and prominent chin (Fig. 1E and 1F). Calcaneo valgus deformity with overlapping of toes (Fig. 1G) and left-sided cryptorchidism were other additional fndings. His SQ was 25 on VSMS scale (Hill et al., 2017). Ultrasound abdomen revealed a single left kidney with right renal agenesis. MRI brain and ECHO were normal. After an informed consent, molecular testing using chromosomal microarray (CMA) followed by whole exome sequencing was performed.
Fig. 2. Shows the pedigree and segregation analysis of the three variants.
three years and at presentation he could speak only 6–7 words and was unable to frame a complete sentence. On examination, his weight was 16 kg (at −4.23 SD), height was 122 cm (at −1.88 SD), and occipitofrontal circumference (OFC) was 45.5 cm (< -3 SD) (WHO growth charts). He had dysmorphic features such as synophrys, deep-set eyes, short palpebral fissures, epicanthic folds, prominent chin and nose with low hanging columella along with plagiocephaly (Fig. 1A and B). He also had left Sprengel shoulder (Fig. 1C) along with restricted movement at the radio-ulnar joint on the same side. Bilateral testes were undescended. His Social Quotient (SQ) on Vineland Social Maturity Scale (Hill et al., 2017) (VSMS) was 30. Rest of the examination was not contributory. X-ray chest and cervical spine confirmed the presence of left Sprengel shoulder in addition to the right cervical rib and 5th cervical hemivertebrae (Fig. 1D). Ultrasound abdomen revealed single malrotated kidney in the pelvis with normal corticomedullary differentiation. Tc99 dimercaptosuccinic acid (DMSA) scans showed normal renal function. Magnetic Resonance Imaging (MRI) brain and echocardiography (ECHO) were unremarkable.
5. Material and methods 5.1. Chromosomal microarray (CMA) HumanCytoSNP-12 Beadchip array (Illumina, San Diego, USA) was used that contain 300 K markers across the genome. The average spatial resolution between probes for the 300 K array was approximately 10 Kb. A copy number change was called when more than ten consecutive probes were involved in a segment. Data were analyzed using Karyostudio software. Genomic positions were based on the UCSC February 2009 human reference sequence (hg19) (NCBI build 37 reference sequence assembly). 5.2. Whole exome sequencing (WES) DNA extracted from blood was used to perform selective capturing of protein-coding genes using whole exome capture kit (Exome research panel, Integrated DNA Technologies, CA, USA). The libraries were sequenced to as 2 × 100 bp paired-end reads on an Illumina HiseqX and aligned to the human reference genome (GRch37/hg19) using BurrowsWheeler algorithm (BWA) (Li and Durbin, 2010). GATK best-practices variant-calling pipeline (McKenna et al., 2010) was used to identify
4. Patient 2 Three years old younger brother (II-2) of patient 1 also had global developmental delay. He was also born by cesarean section at 39 completed weeks, and birth weight was 2 kg and had uneventful 2
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
Fig. 3. (A) Diagrammatic representation of THOC6. (B) Schematic representation of THOC6 gene coding protein THO complex subunit six homolog and mutation spectrum-all reported variants till date and variants found in our studied subjects. (C) Phylogenetic conservation of variants shown by multiple sequence alignment of proteins among different species indicated by a rectangular box. (D) Sanger sequencing validation of the three variants identified in THOC6 gene.
variants which were annotated using variant effect predictor tool (Ensembl). The clinically relevant mutations were annotated using disease databases ClinVar, OMIM, HGMD, and SwissVar. The variants were filtered based on allele frequency in various population databases 1000 Genomes Phase 3, ExAC and our internal database (N = 1500). The effect of non-synonymous and splice sites was assessed using different algorithms such as SIFT, Polyphen-2, LRT, Mutation taster 2, SpanR, human splicing finder, and MutPred. The variants were analyzed using Varminer (in-house analysis tool) and interpreted based on the American College of Medical Genetics (2015) guidelines (Richards et al., 2015).
WES- We generated ~6 Gb of paired-end sequencing data with 5080x average on target depth of coverage. Approximately 92% of the sequenced bases had average base quality ≥ Q30 and ~95% of the reads aligned to the human genome (hg19). The common variants shared by the affected siblings were prioritized. Variants with high minor allele frequency > 1% in various population-based databases (ExAC,1000 Genome) or variants present in the homozygous state in the parental samples were filtered out. Shared homozygous variants observed in the two affected siblings in the LOH regions detected by microarray were selected. The variants were subsequently prioritized based on clinically relevant reported variants in literature, evolutionary conservation, in silico prediction (Liu et al., 2016) and clinical relevance. Following the prioritization of the variants, we detected three reported homozygous variants in THOC6 gene shared by both the affected siblings and were detected in the heterozygous state in the parental samples. The homozygous missense variants were detected at codon 100 (chr16:3076141T > A; p.Trp100Arg; ENST00000326266), at codon 234 (chr16:3077171G > C; p.Val234Leu; ENST00000326266) and at codon 275 (chr16:3077380G > A; p.Gly275Asp; ENST00000326266) in exons 4, 11 and 12 respectively (ClinVar accession number: SCV000920766, SCV000920767, SCV000920768, respectively). These were further validated by Sanger sequencing. Parents were heterozygous for all three variants (Fig. 2). These reference codons were conserved across species (Fig. 3). The minor allele frequency (MAF) of all three variants was 0.02% in 1000 genomes, 0.02% in ExAC, and 0.05% in our internal databases. The in silico predictions of all three missense variants were damaging by LRT and MutationTaster 2. The variant Trp100Arg was predicted to be damaging by SIFT and PolyPhen-2.
5.3. Sanger sequencing The variants in THOC6 gene were sequenced on an ABI 3730 genetic analyzer (Applied Biosystems, CA, USA), following PCR amplification using primers 5′TTCAGGACTTTGGGTGGGAT3′ and 5′GCTCCTTACAG CCCTTCAAA3′ for exon 4 and 5′TGTTTGGCAACTGATTCCGA3′ and 5′ CAGGTTGGTGAAGACATCCA3′ for exon 11 and 12, standardized at an annealing temperature of 60OC. 6. Results CMA analysis of patient 1 showed no copy number variations. Instead a long continuous stretch of copy neutral loss of heterozygosity (cnLOH) spanning around 200 genes on 16p13.3 (3.6 Mb, 2353151–6028451), 20p11.21p11.1 (3.1 Mb, 23028137–26225145) and 20q11.21p11.22 (3.2 Mb, 30221104–33451148) region was observed. Reverse phenotyping and correlation with the genes in the cnLOH on 16p13.3 narrowed the possibility of THOC6 related ID (Beaulieu et al., 2013). 3
4
A3 7 M French 3rd centile -1SD -1.5SD
Family Consanguinity Patient Gender Ethnicity Anthropometry
Development delay
Amos et al (2017) C3 9 M Iranian 3rd centile n/a -2SD
B3 8 F * -2SD +2SD -3SD Moderate ID
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Mutation in THOC6 gene
Authors
N/D
Neuroimaging
PDA, VSD Horse shoe kidney with duplex collecting system Dental malocclusion and caries
Nocturnal enuresis, velopharyngeal insufficiency
Skeletal anomaly
Teeth
Cardiac anomaly Genito urinary
Other Health issues
Associated congenital defects
Dysmorphism
Micrognathia
A4 10 F Italian -2.24SD -3.70SD -5.0SD
A5 11 M European -
B5 12 F European -
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
Mattioli et al (2018)
N/D
Myopia, recurrent UTI, endometriosis
Dental caries
-
-
+ +
4 F Hutterite 10-25th centile 2nd centile Speech delay, learning disability moderate ID + + +
Myopia, recurrent UTI, premature ovarian failure, osteoporosis Normal
Dental caries
-
-
+ +
B + 3 F Hutterite 10-25th centile 2nd centile Speech delay, learning disability moderate ID + + +
Accogli et al (2018)
Homozygous c.136G > A p.Gly46Arg (Missense mutation)
N/D
Nocturnal and daytime enuresis
Dental malocclusion and caries
VSD Absent left kidney
-
+ +
Tall forehead Deep set eyes Short up slant palpebral fissure Long nose Low Hanging columella Epicanthal fold Other features + +
Development delay
A + 1 F Hutterite 5th centile 2nd centile Speech delay, learning disability moderate ID + + +
Family Consanguinity Patient Gender Ethnicity Anthropometry
Height Weight Head circumference
2 F Hutterite 10th centile 2nd centile Speech delay, learning disability moderate ID + + +
Beaulieu et al. (2013)
Authors
Table 1 shows comparison of various phenotypic features of the present study and previous studies
A6 II-1 M Indian -1SD -3SD -2SD Severe ID
This study
Homozygous c.259C > T p.Arg87* (Non sense mutation)
N/D
Atopic dermatitis, over riding toes, imperforate anus
-
+ Pointed chin, mild camptodactyly ASD, VSD, PDA Undescended testes
+ +
+ + +
A1 + 5 M Arabian -2.3SD -2.7SD 10th centile Motor and speech delay
Anazi et al (2016)
(continued on next page)
II-2 M Indian -3SD -3SD -2SD Severe ID
Mild Ventriculomegaly, normal myelination Homozygousc.298T > A, p.Trp100Arg: c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Dental malocclusion and caries Pesplanus, fetal finger pad, Multiple epiphyseal dysplasia, Cyclical vomiting
Single duplex left kidney
+ Mild ptosis, sparse eyebrows
-
+ +
A2 6 F Irish 0.4-2nd centile 9th centile 2nd centile Motor and speech delay
Casey et al (2016)
N. Gupta, et al.
European Journal of Medical Genetics xxx (xxxx) xxxx
5
-
-
Corpus callosum dysgenesis
Compound hetero c.135C > A, p.Tyr45* c.569G > A, p.Gly190Glu (Non sense- missense)
Neuroimaging
Mutation in THOC6 gene Compound hetero c.748A > C, p.Thr250Pro c.259C > T, p.Arg87* (Missensenonsense)
Corpus callosum aplasia, Ventriculomegaly.
Hypothyroidism, strabismus, obsessive compulsive disorder, hearing loss
Homozygous c.611A > C p.Gln204Pro (Missense mutation)
Normal
Hearing loss
Hypoplastic fifth toenail
Dental caries
Dental malocclusion Lardosis
-
-
Vermiandysgenesis, hydrocephalous due to aqueduct stenosis, partial agenesis of septum pallucidum, hippocampal dysgenesis. Compound hetero c.577C > T,p.R193*, c.792_793delCA , p.V264Vfs*48 (Non sense mutation)
Supernumerary teeth, malocclusion Segmentation defect of cervical vertebra, scoliosis, cubitus valgus, Right trigger thumb, b/ lcamptodactyly of 3/4th fingers, right hip dislocation, b/l genu valgum, clinodactyly of 3rd /4th toes Hypergonadotropichypogonadism, myopia, optic disc hypoplasia, recto perineal fistula, imperforate anus
Mitral insufficiency, tachyarrhythmia Left ectopic dysplastic kidney in right hemi pelvis
Homozygous C.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A, p.Gly275Asp (Missense mutation)
Short corpus callosum
Feeding difficulty
-
-
Micropenis
-
Severe ID, speech delay, upper limb stereotypes + + + Retrognathia
Mattioli et al (2018)
Compound hetero c.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A, p.Gly275Asp, c.569G > A, p.Gly190Glu (Missense mutation)
Exostropia, nystagmus, hyperopia, hearing loss,poorfeeding,seizures, pulmonary hypertension Hydrocephalous
B/l overlapping toes
Malocclusion
-
+ + + + Microcephaly,cuppedears,tented upper lip,maxillary hypoplasia, cleft palate, choanal atresia, persistent fetal pads ASD, PDA
Severe motor and speech delay
Homozygous c.298T > A, p.Trp100Arg c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Normal
Myopia
Sprengel shoulder, right cervical rib, 5th cervical hemi vertebra
-
Single malrotated kidney, both testes undescended
-
+ + + + + Synophrys, Prominent square chin, plagiocephaly. Prominent chin
This study
Homozygous c.298T > A, p.Trp100Arg: c.700G > C, p.Val234Leu c.824G > A , p.Gly275Asp (Missense mutation)
Normal
-
Calcaneovalgus deformity foot, over riding toes, 3rd/4thfinger camptodactyly
Left testis undescended, absent right kidney -
-
+ + + + + Thin upper and lower lip. Prominent chin.
M- male, F- female, B/l- bilateral, SD- standard deviation, ASD- atrial septal defect, VSD- ventricular septal defect, PDA- patent ductus arteriosus, UTI- urinary tract infection, N/D- not done * ethnicity not mentioned
Recurrent UTI
Pes valgus
Left testicular atopy
+ + + + + -
+ Low set ears, submucus cleft
+ + + + + -
VSD
Moderate ID and motor stereotypes
No speech, moderate- severe ID
Motor delay, severe speech delay, and ID + + Bifid nasal tip, wide mouth, thin lips, sparse and short eyebrows, bifid uvula, tall and pointed chin
Accogli et al (2018)
Amos et al (2017)
Other Health issues
Associated congenital defects
Dysmorphism
Authors
Table 1 (continued)
N. Gupta, et al.
European Journal of Medical Genetics xxx (xxxx) xxxx
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al.
7. Discussion
mammalian cells (Beaulieu et al., 2013). Later after three years, Anazi (Anazi et al., 2016) et al. identified the homozygous truncating mutation (p.Arg87*) in a Saudi patient with ID and overlapping clinical features to the Hutterite patients. Amos (Amos et al., 2017) et al. identified four novel (p.Tyr45*, p.Gly190Glu, p.Thr250Pro & p.Gln204Pro) and one previously reported (p.Arg87*) variant in unrelated patients with moderate to severe ID and additional clinical features. Recently Accogli (Accogli et al., 2018) et al. identified two novel compound heterozygous variants, p.R193* and p.V264Vfs*48, in THOC6 in an Italian patient with a severe phenotype including multiple brain and skeletal anomalies and they speculated that severe phenotype might be due to stop and frameshift mutations that resulted in THOC6 loss-of-function. Till date, seven missense and five non-sense variants in homozygous and compound heterozygous states have been reported in THOC6 in various domains (Fig. 2) with no established clear genotype-phenotype correlation. Of these variants, three common recurrent missense variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) are present in 5 patients in the homozygous/compound heterozygous state, including two patients in the present study. Mattioli (Mattioli et al., 2018) et al. have validated the pathogenicity of these three variants in THOC6 protein mislocalization and altered interaction with THOC1 and THOC5 in 2018. The group also mentioned about the highest frequency of these three variants in the European population (UK10K data 0.001 in 3577 individuals). In GnomAD database, these variants are also reported in the heterozygous state at the same MAF in different subpopulations that include South Asia. In the 1000 genomes database, the variants were reported in the European population but not observed in Indian representative population (Gujarati Indian in Houston (GIH) & Indian Telugu from the UK (ITU). This data suggests that these three missense variants are in total linkage disequilibrium in the European population. Interestingly, our patients have the same three variants as previously reported in three BBI individuals with Northern European origin. Genetic evidence indicates that Ancestral North Indians' are genetically closely related to Middle Easterners, Central Asians, and Europeans (Reich et al., 2009). Earlier studies also suggest that disease-related single nucleotide variations (SNVs) previously validated in European populations may be similar to non-European populations, particularly Indians (Pandit et al., 2011). To conclude, this report further expands the phenotypic spectrum of BBI syndrome due to 3 common missense variants. The relative rarity and the non-recognizable phenotype of BBIS poses diagnostic challenges and underscore the importance of NGS in the evaluation of idiopathic intellectual disability.
Beaulieu–Boycott–Innes syndrome (BBIS) is characterized by mild to moderate ID, with subtle dysmorphism, renal and cardiac malformations, and dental malocclusion/caries. Till date, twelve patients have been described (Beaulieu et al., 2013; Amos et al., 2017; Mattioli et al., 2018). We report the first two patients of BBI syndrome from the Indian subcontinent, with the previously reported homozygous pathogenic variants in THOC6 using whole exome sequencing. Table 1 compares the phenotypic features in the present report and the previously described 12 cases. Major features included moderate to severe ID (14/14), short palpebral fissures with upslant (13/14), tall forehead (12/14), long nose (11/14), low hanging columella (9/14), deep-set eyes (8/14), and retrognathia (5/14). Both of our patients had prominent chin instead of retrognathia. Three out of 10 had corpus callosal agenesis on MRI. One patient recently reported in 2018 by Accogli (Accogli et al., 2018) et al. had multiple CNS anomalies including cerebellar hypoplasia, mesencephalosynapsis, vermian dysgenesis, hydrocephalus, partial agenesis of septum pallucidum, and hippocampal dysgenesis. Our patients did not have any brain abnormality. Five out of fourteen patients had structural heart anomalies and one patient had mitral insufficiency and tachyarrhythmia. Dental malocclusion/caries was not present in our patients, although it has been a consistent finding in previously reported patients. In addition, both sibs had undescended testes and renal anomalies, including horseshoe kidney (in II-1) and unilateral renal agenesis (in II-2) which have been previously reported in 4 patients. Accogli (Accogli et al., 2018) et al. has reported multiple skeletal findings such as cervical vertebra, cubitus valgus, right trigger thumb, bilateral camptodactyly of 3rd/4th fingers, bilateral genu valgum, and dislocated right hip. Another Irish patient (Casey et al., 2016) was also reported to have a blended phenotype and had multiple epiphyseal dysplasia in addition to THOC6 related ID. In this report, both sibs had previously unreported variable skeletal features such as presence of left Sprengel shoulder with C5 hemi vertebra and right cervical rib, abnormal 3rd rib with constriction at posterior end and radioulnar dysostosis on left side in elder sib whereas younger sib had only 3rd and 4th finger camptodactyly and calcaneo valgus deformity with overriding of toes in both feet demonstrating intrafamilial variability. The candidate gene, THOC6, has been mapped to 5.1 Mb region at chromosome 16p13.3 (Online Mendelian Inherita, 1540). THOC6 is a subunit of the multimeric protein complex known as THO complex which is an integral part of TRanscription and EXport (TREX), a conserved multisubunit complex involved in mRNA transcription, processing and nuclear export of spliced mRNAs (Bretes et al., 2014). It is essential for embryogenesis, organogenesis, and cellular differentiation throughout life. In humans, the core THO subcomplex consists of following subunits THOC1, THOC2, THOC5-7 (Chi et al., 2013). Mutations in THOC2 have been described to cause X linked syndromic mental retardation (Kumar et al., 2015). Beaulieu et al. also studied the zebrafish thoc6 ortholog during embryonic development and in situ hybridization results confirmed that THOC6 was expressed in the midbrain and eyes and thus, may have a potential role in neuronal development (Beaulieu et al., 2013). THOC6 gene encodes 341 amino acids length protein, which is also known as WD (Tryptophan - Aspartic acid) repeat-containing protein, consisting of seven WD40 repeat domains (Xu and Min, 2011). In the present study, the reported three variants (p.Trp100Arg, p.Val234Leu, p.Gly275Asp) are located in WD2, WD5, and WD6 domains, respectively (Fig. 2). Insilco stability analysis showed these three variants as highly destabilizing in nature (DDG < -0.5k) that may disrupt the function of the protein and cause a drastic phenotypic consequence. Beaulieu et al. first identified novel missense variant (p.Gly46Arg), in WD1 domain of THOC6 protein in the syndromic form of ID patients, which affects the normal protein function and causes protein mislocalization and invitro depletion of THOC6 also induces apoptosis in
Conflicts of interest There is no conflict of interest among authors. Acknowledgment We acknowledge the patients and their family for their participation in the study. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ejmg.2019.103742. References Accogli, A., Scala, M., Calcagno, A., et al., 2018. Novel CNS malformations and skeletal anomalies in a patient with Beaulieu-boycott-Innes syndrome. Am. J. Med. Genet. 176 (12), 2835–2840. https://doi.org/10.1002/ajmg.a.40534. Amos, J.S., Huang, L., Thevenon, J., et al., 2017. Autosomal recessive mutations in THOC6 cause intellectual disability: syndrome delineation requiring forward and reverse phenotyping. Clin. Genet. 91 (1), 92–99. https://doi.org/10.1111/cge.12793.
6
European Journal of Medical Genetics xxx (xxxx) xxxx
N. Gupta, et al. Anazi, S., Alshammari, M., Moneis, D., Abouelhoda, M., Ibrahim, N., Alkuraya, F.S., 2016. Confirming the candidacy of THOC6 in the etiology of intellectual disability. Am. J. Med. Genet. 170A (5), 1367–1369. https://doi.org/10.1002/ajmg.a.37549. Beaulieu, C.L., Huang, L., Innes, A.M., et al., 2013. Intellectual disability associated with a homozygous missense mutation in THOC6. Orphanet J. Rare Dis. 8, 62. https://doi. org/10.1186/1750-1172-8-62. Bretes, H., Rouviere, J.O., Leger, T., et al., 2014. Sumoylation of the THO complex regulates the biogenesis of a subset of mRNPs. Nucleic Acids Res. 42 (8), 5043–5058. https://doi.org/10.1093/nar/gku124. Casey, J., Jenkinson, A., Magee, A., et al., 2016. Beaulieu-Boycott-Innes syndrome: an intellectual disability syndrome with characteristic facies. Clin. Dysmorphol. 25 (4), 146–151. https://doi.org/10.1097/MCD.0000000000000134. Chi, B., Wang, Q., Wu, G., et al., 2013. Aly and THO are required for assembly of the human TREX complex and association of TREX components with the spliced mRNA. Nucleic Acids Res. 41 (2), 1294–1306. https://doi.org/10.1093/nar/gks1188. Hill, T.L., Saulnier, C.A., Cicchetti, D., Gray, S.A.O., Carter, A.S., 2017. Vineland III. In: Encyclopedia of Autism Spectrum Disorders. Springer, pp. 1–4. Kumar, R., Corbett, M.A., van Bon, B.W.M., et al., 2015. THOC2 mutations implicate mRNA-export pathway in X-linked intellectual disability. Am. J. Hum. Genet. 97 (2), 302–310. https://doi.org/10.1016/j.ajhg.2015.05.021. Li, H., Durbin, R., 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26 (5), 589–595. https://doi.org/10.1093/bioinformatics/ btp698. Liu, X., Wu, C., Li, C., Boerwinkle, E., 2016. dbNSFP v3.0: a one-stop database of functional predictions and annotations for human nonsynonymous and splice-site SNVs. Hum. Mutat. 37 (3), 235–241. https://doi.org/10.1002/humu.22932. Mattioli, F., Isidor, B., Abdul-Rahman, O., et al., November 2018. Clinical and functional characterization of recurrent missense variants implicated in THOC6-related intellectual disability. Hum Mol Genet 10.1093/hmg/ddy391. doi:10.1093/hmg/ ddy391. McKenna, A., Hanna, M., Banks, E., et al., 2010. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20 (9), 1297–1303. https://doi.org/10.1101/gr.107524.110. Miller, D.T., Adam, M.P., Aradhya, S., et al., 2010. Consensus statement: chromosomal
microarray is a first-tier clinical diagnostic test for individuals with developmental disabilities or congenital anomalies. Am. J. Hum. Genet. 86 (5), 749–764. https:// doi.org/10.1016/j.ajhg.2010.04.006. Najmabadi, H., Hu, H., Garshasbi, M., et al., 2011. Deep sequencing reveals 50 novel genes for recessive cognitive disorders. Nature 478 (7367), 57–63. https://doi.org/ 10.1038/nature10423. Online mendelian inheritance in man, OMIM®. Johns Hopkins University, Baltimore MMN* 615403: 09/14/2018. WWWU. https://omim.org. Pandit, L., Ban, M., Sawcer, S., et al., 2011. Evaluation of the established non-MHC multiple sclerosis loci in an Indian population. Mult. Scler. 17 (2), 139–143. https:// doi.org/10.1177/1352458510384011. Rauch, A., Wieczorek, D., Graf, E., et al., 2012. Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study. Lancet (London, England) 380 (9854), 1674–1682. https://doi.org/10.1016/ S0140-6736(12)61480-9. Reich, D., Thangaraj, K., Patterson, N., Price, A.L., Singh, L., 2009. Reconstructing Indian population history. Nature 461, 489. https://doi.org/10.1038/nature08365. Richards, S., Aziz, N., Bale, S., et al., 2015. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of medical genetics and genomics and the association for molecular pathology. Genet. Med. 17 (5), 405–424. https://doi.org/10.1038/gim.2015.30. Sharma, P., Gupta, N., Chowdhury, M.R., et al., 2016. Application of chromosomal microarrays in the evaluation of intellectual disability/global developmental delay patients - a study from a tertiary care genetic centre in India. Gene 590 (1), 109–119. https://doi.org/10.1016/j.gene.2016.06.020. Vissers, L.E.L.M., Gilissen, C., Veltman, J.A., 2015. Genetic studies in intellectual disability and related disorders. Nat. Rev. Genet. 17, 9. https://doi.org/10.1038/ nrg3999. WHO growth charts http://www.who.int/childgrowth/en/. Wieczorek, D., 2018. Autosomal dominant intellectual disability. Medizinische Genet Mitteilungsblatt des Berufsverbandes Medizinische Genet eV 30 (3), 318–322. https://doi.org/10.1007/s11825-018-0206-2. Xu, C., Min, J., 2011. Structure and function of WD40 domain proteins. Protein Cell 2 (3), 202–214. https://doi.org/10.1007/s13238-011-1018-1.
7