- Email: [email protected]
Fitness costs of sulfoxaflor resistance in the cotton aphid, Aphis gossypii Glover
Pesticide Biochemistry and Physiology 158 (2019) 40–46
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Fitness costs of sulfoxaflor resistance in the cotton aphid, Aphis gossypii Glover Kangsheng Ma, Qiuling Tang, Jin Xia, Nannan Lv, Xiwu Gao
T
⁎
Department of Entomology, China Agricultural University, Beijing 100193, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Aphis gossypii Sulfoxaflor Fitness costs Insecticide resistance
Aphis gossypii Glover is an economically important pest of numerous crops throughout the world. Some field populations of A.gossypii in China have developed moderate level of resistance to sulfoxaflor, a newly released sulfoximine insecticide for management of sap-feeding pests. To evaluate the effect of sulfoxaflor resistance on the fitness cost of A. gossypii, the life history traits of sulfoxaflor-resistant strain (SulR) and an isogenic susceptible strain (SS) were compared using the age-stage, two-sex life table approach. The results showed that the resistant strain had a reduction in fitness (relative fitness = 0.917), along with significantly decreases in longevity, fecundity, net reproductive (R0), mean generation time (T) and gross reproductive rate (GRR). Compared to the susceptible strain, SulR strain showing a shorter developmental duration of each nymph instar stage. Moreover, the adult pre-oviposition period (APOP) and total preoviposition period (TPOP) of SulR strain were also significantly shorter than that of the susceptible strain. Investigation of six development and reproduction related genes indicated that EcR, USP and JHBP were overexpressed in the SulR strain, while the mRNA transcript level of Vg was decreased significantly compared to the susceptible strain. These results suggest that there is a fitness cost associated with sulfoxaflor resistance in A. gossypii and the different expression of EcR, USP, JHBP, and Vg may play very important role in this trade-off.
1. Introduction
A. gossypii, Myzus persicae, Nilaparvata lugens, Apolygus lucorum, and Bemisia tabaci (Chen et al., 2016; Zhen et al., 2018; Liao et al., 2018). In recent years, sulfoxaflor was a popular insecticide for A. gossypii control because it was highly efficient, have long-lasting effects and good environmental safety profile. However, our recent field investigation of resistance showed that the field populations of A. gossypii in China had developed low to moderate level of resistance to sulfoxaflor (unpublished). In addition, the field populations of N. lugens had also developed resistance to this insecticide (Liao et al., 2017). These findings suggest that field populations of A. gossypii possess the high resistance risk to sulfoxaflor. Fitness cost is a very important factor influencing the evolution of insecticide resistance, and may affect the rate of resistance increase in insect populations (Abbas et al., 2016; Kliot and Ghanim, 2012). Normally, the development of resistance to an insecticide is accompanied with high energetic cost or significant disadvantage that could diminish the insect's fitness compared with its susceptible counterparts in the population (Kliot and Ghanim, 2012). Fitness costs associated with insecticides resistance have been documented in many insect pests, including Thrips hawaiiensis (Fu et al., 2018), Plutella xylostella (Steinbach et al., 2017), N. lugens (Zhang et al., 2018) and Musca
The cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is a destructive pest on cotton and numerous crops throughout the world. As a sap-feeding insect species, A. gossypii causes economic damage both through direct feeding and indirectly virus transmission and contamination of aphid honeydew (Blackman and Eastop, 1984; Ma et al., 2017). The control of this pest in China has been largely dependent on the application of chemical insecticides (Chen et al., 2017a; Wu and Guo, 2005). Consequently, cotton aphids have evolved resistance to many types of insecticides, including organophosphates, carbamates, pyrethroids, and neonicotinoids (Chen et al., 2017a; Sun et al., 2005; Wang et al., 2002; Zheng et al., 1989; Chen et al., 2017b). Sulfoxaflor is the first commercially available sulfoximine insecticide discovered by Dow AgroSciences (Zhu et al., 2011; Babcock et al., 2011), and is used primarily for the control of sap-feeding insect pests (Babcock et al., 2011; Sparks et al., 2012). Sulfoxaflor was reported to exhibit highly efficacy against many sap-feeding pests and lack insecticidal cross-resistance to neonicotinoids (Zhu et al., 2011; Babcock et al., 2011; Wang et al., 2017). In China, it has been registered for the control of many serious sap-feeding pests since 2013, including
⁎
Corresponding author. E-mail address: [email protected] (X. Gao).
https://doi.org/10.1016/j.pestbp.2019.04.009 Received 6 February 2019; Received in revised form 7 April 2019; Accepted 17 April 2019 Available online 19 April 2019 0048-3575/ © 2019 Elsevier Inc. All rights reserved.
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
domestica (Abbas et al., 2016). In M. persicae, a sulfoxaflor resistant strain had been reported had a fitness cost of 0.83 compared to the susceptible strain (Wang et al., 2018). In the laboratory, we established a sulfoxaflor resistant strain of A. gossypii through continuous selection with sulfoxaflor, the cross-resistance, synergism of three synergists and the resistance mechanism were studied preliminarily. However, the fitness costs associated with this insecticide were not investigated previously. Identifying fitness costs and dominance of fitness costs associated with resistance to any insecticide could be useful for designing an integrated pest management (IPM) program to limit the spread of the resistant population (Abbas et al., 2016). Therefore, in the current study, the life table parameters were employed for investigating whether the fitness costs were associated with the sulfoxaflor resistance in A. gossypii. In addition, the transcriptional levels of six development and reproduction related genes were determined to investigate the underlying mechanism. The results of the present study should be useful in designing appropriate resistance management strategies for A. gossypii.
Table 2 Primers used in the qRT-PCR analysis.
2.1. Insects Two isogenic laboratory strains were used in this study. The susceptible strain (SS), as anholocyclic clone, was derived from a single female in the original field samples collected in 2016 from cotton fields in the Shawan County of Xinjiang Uygur Autonomous Region, China, where sulfoxaflor had not been applied. The sulfoxaflor resistant strain (SulR) was established from the Shawan population by continual selection by the gradually increased concentration of sulfoxaflor based on the LC50 values from the bioassay of their parent generations for total 27 generations in the laboratory (Table 1). About 5000 adults were screened with leaf-dipping method in each generation and the mortality was maintained at 60–80%. Both susceptible and resistant strains were reared on the cotton seedlings, Gossypium hirsutum (L.), in controlled conditions of 20–23 °C, 60% relative humidity, and a photoperiod of 16: 8 h (light: dark).
2.3. Toxicity bioassays The toxicity of the sulfoxaflor to A. gossypii was determined using a leaf-dipping method (Moores et al., 1996) with slight modifications (Chen et al., 2017b). Stocks of insecticide were prepared in acetone and adjusted to final concentrations by serial dilution with distilled water containing 0.05% (v/v) Triton X-100 for the bioassays. Cotton leaves
2.5. Quantitative RT-PCR
Table 1 Toxicity of sulfoxaflor in susceptible (SS) and resistance (SulR) strains of Aphis gossypii. Slope ± SE
LC50 (95% CL) (mg L−1)b
χ
df
SS SulR
1.826 ± 0.204 1.242 ± 0.145
0.642 (0.435–0.862) 235.231 (162.849–408.219)
21.854 15.067
16 15
GAAGCCTGGTATGGTTGTCGT GGGTGGGTTGTTCTTTGTG GGGAGTCATGGTTGGTATGG TCCATATCGTCCCAGTTGGT CACAGCACAACAACAATTCGTCC CCGCATACCAGGCACAGTTCTTC GGATAGAACTGAACTTGGCTGC CGTAATGAAGGGAGCCGAAG ACCACTGCACACTCGGATAA CGGCTTGCATGAACCAGTAG GCTCGGTTGGCCTATTGAAG GCTTGATCCTCGCCAAATCC ATGTGGACCAGGCGATGTAA AGAACAGTCATTGGCATTTTC CTTATGTTGCACGGATGGCC ATCGCCACCTTGAACGTAGA
Life tables were constructed separately for the susceptible and resistant strains. For each strain, about 300 apterous adult aphids were placed on fresh cotton plants for 24 h. Then, the newborn nymphs (≤ 24 h old) were placed onto the 20 mm diameter leaf discs, which were placed upside down on agar beds (1.5 mL of 2% agar) in wells of 12well cell-culture plates and covered with Chinese art paper to prevent escape. About 100 nymphs from the susceptible and resistant strains were randomly selected, cultured, and observed individually. The population parameters, including development time, fecundity, mortality, and longevity were monitored daily. During the reproductive period, the newborn nymphs produced by females were counted and removed daily until the death of all adult aphids. New cotton leaf discs were replaced every 4 days until the death of the adult. Finally, an age-stage, two-sex life table was constructed from the data obtained in these experiments.
Sulfoxaflor (97.9%) was obtained from Dow AgroSciences (Indianapolis, USA). Triton X-100 was obtained from Sigma-Aldrich Co. (Saint Louis, USA). All other chemicals and solvents used were analytical grade reagents.
Strains
EF1α-F EF1α-R β-ACT-F β-ACT-R EcR-F EcR-R USP-F USP-R Vg-F Vg-R JHBP-F JHBP-R JHAMT-F JHAMT-R JHEH-F JHEH-R
2.4. Fitness comparisons
2.2. Insecticide and reagents
2
Primer sequences (5′-3′)
were cut into 20 mm diameter discs with a sharpened steel punch. The leaf discs were dipped in the desired concentration of insecticide or in 0.05% (v/v) Triton X-100 water for 15 s as a control. The treated leaf discs were placed on the disposable PE gloves and allowed to air dry, and then placed upside down onto the agar beds in 12-well cell culture plates. Apterous adult aphids were carefully transferred onto the discs and covered with Chinese art paper to prevent escape. Bioassays were maintained in the laboratory at 20–23 °C with a photoperiod of 16: 8 h (light: dark). The treatment for each concentration was performed with three replicates, and at least 30 aphids were used for each replicate. The mortality was assessed at 48 h after treatment. The LC50 values were calculated by the probit analysis using POLO Plus 2.0 statistical software (LeOra Software Inc., Berkeley, CA). The resistance ratios (RR) were calculated at the LC50 level by dividing the LC50 of the resistant strain by the LC50 of the susceptible strain.
2. Materials and methods
a
Primer name
Total RNA was isolated form the apterous adult aphids using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. First-strand cDNA was synthesized from 1.0 μg of total RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was performed on an Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Foster city, CA, USA) using SYBR® Premix Ex Taq™ (Tli RNaseH Plus) (Takara Biotechnology, Dalian, China). The reactions were performed in a 20 μL volume of a mixture containing 1 μL cDNA template, 10 μL SYBR Green mix, 0.4 μL of ROX Reference Dye II, 0.4 μL of each primer and 7.8 μL of nuclease-free water. The
Resistance ratio (RR) c
366.40
a
Standard error. Confidence limits. c RR (resistance ratio) = LC50 of the resistant strain/LC50 of the susceptible strain. b
41
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Table 3 Duration of the development, reproduction, survival rate and life table parameters ( ± SE) for the susceptible and resistant strains of A. gossypii. Biological parameters
First instar nymph (d) Second instar nymph (d) Third instar nymph (d) Forth instar nymph (d) Pre-adult (d) Adult (d) APOP (d) TPOP (d) Oviposition days Female total longevity (d) Mean total longevity (d) Total preadult survival Fecundity (offspring/individual) a b ⁎
Susceptible strain (SS)
Resistant strain (SulR) a
N
Mean ± SE
108 106 106 106 106 106 106 106 106 106 108 108 106
2.94 ± 0.07 1.85 ± 0.05 1.63 ± 0.05 1.87 ± 0.05 8.29 ± 0.10 31.92 ± 1.00 1.04 ± 0.08 9.33 ± 0.09 20.02 ± 0.56 40.21 ± 0.97 39.55 ± 1.06 0.98 ± 0.01 40.39 ± 1.12
95% CI
b
P
a
N
Mean ± SE
106 106 106 105 105 105 105 105 105 105 108 108 105
2.38 ± 0.06 1.62 ± 0.05 1.44 ± 0.05 1.50 ± 0.05 6.94 ± 0.07 30.07 ± 0.95 0.46 ± 0.06 7.40 ± 0.08 19.78 ± 0.59 37.01 ± 0.95 36.08 ± 1.07 0.97 ± 0.02 37.38 ± 1.22
(0.38, 0.75)⁎ (0.08, 0.37)⁎ (0.05, 0.32)⁎ (0.22, 0.51)⁎ (1.11, 1.59)⁎ (−0.83, 4.53) (0.38, 0.78)⁎ (1.69, 2.17)⁎ (−1.35,1.82) (0.55, 5.85)⁎ (0.53, 6.40)⁎ (−0.03, 0.05) (0.22, 6.23) ⁎
0 0.002 0.007 0 0 0.177 0 0 0.77 0.018 0.021 0.816 0.047
Standard errors (SE) were estimated by using the bootstrap technique with 100,000 re-samplings. Difference between strains were compared with paired bootstrap test. If the CI includes 0, there is no difference at 5% level. Significant differences between SulR and SS strains at P = 0.05 level.
Table 4 The means and standard errors of population parameters of different strains of A. gossypii. Population parametersa
−1
r (d ) λ (d−1) R0 (offspring/individual) T (d) GRR (offspring/individual) Rfd a b c d ⁎
Mean ± SEb Susceptible strain (SS)
Resistant strain (SulR)
0.216 ± 0.002 1.242 ± 0.003 39.639 ± 1.210 17.010 ± 0.145 44.190 ± 0.778 /
0.254 ± 0.003 1.289 ± 0.004 36.343 ± 1.321 14.156 ± 0.159 41.640 ± 1.047 0.917
95% CIc
P
(0.03, (0.04, (0.21, (2.43, (0.01, /
0.000 0.000 0.045 0.000 0.05 /
0.05)⁎ 0.06)⁎ 6.80) ⁎ 3.27)⁎ 5.10)⁎
r, intrinsic rate of increase; λ, finite rate of increase; R0, net reproductive rate; T, mean generation time; GRR, gross reproduction rate. Standard errors between two strains were estimated by using the bootstrap technique with 100,000 resamplings. Difference between strains were compared with paired bootstrap test. If the CI includes 0, there is no difference at 5% level. Rf = R0 of the resistant strain (SulR)/ R0 of the susceptible strain (SS). Significant differences between SulR and SS strains at P = 0.05 level.
100,000 random resampling and difference of population parameters between control and plant allelochemical treatment groups were compared by using the paired bootstrap test based on the confidence intervals of differences implemented in TWOSEX-MSChart (Chi, 2018; Huang and Chi, 2013; Huang et al., 2018). All graphics were constructed using SigmaPlot 12.0 (Systat Software Inc., San Jose, CA, USA). Relative fitness (Rf) was estimated as follows: a Rf > 1 suggests that the net reproductive rate of resistant strain is enhanced, whereas a Rf < 1 suggests that the resistant strain has a fitness defect (Li et al., 2000; Groters et al., 1994): Rf = R0 of resistant strain/ R0 of susceptible strain. For qRT-PCR, the significance of difference was determined by an unpaired t-test using the GraphPad InStat 3.0 software (GraphPad Software, San Diego, CA, USA).
primers used in this study were listed in Table 2. The thermocycling program was as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. After amplification, one dissociation step cycle of 95 °C for 15 s, 60 °C for 1 min and 95 °C for 30 s, and 60 °C for 15 s was performed to ensure the specificity of the amplified product. The experiment was conducted with three technical replications and three independent biological replicates. The housekeeping genes elongation factor 1 alpha (EF1α) and beta actin (β-ACT) were used as internal reference genes for A. gossypii (Ma et al., 2016). The relative gene expression was calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001). 2.6. Data analysis The life table data for all A. gossypii individuals were analyzed according to the age-stage, two-sex life table theory (Chi, 1988; Chi and Liu, 1985). The population parameters, including the intrinsic rate of increase (r), finite rate of increase (λ), net reproductive rate (R0), the mean generation time (T), age-stage specific survival rates (sxj, where x is age and j is stage), age-specific survival rate (lx), age-specific fecundity (mx), adult pre-oviposition period (APOP), total preoviposition period (TPOP), oviposition days (Od) (i.e., the number of days that adult produced offspring), age-specific maternity (lxmx), age-stage specific life expectancy (exj), reproductive value (vxj), were calculated according to Chi and Liu (Chi and Liu, 1985) and Chi (Chi, 1988) by using the computer program TWOSEX-MSChart (Chi, 2018). The variances and standard errors of the population parameters were estimated using the bootstrap procedure (Efron and Tibshirani, 1993) with
3. Results 3.1. Effect of sulfoxaflor resistance on the life history traits of A. gossypii Means of life-history traits, including development time, longevity, oviposition days and fecundity of susceptible (SS)and resistant strains (SulR) are presented in Table 3. The developmental duration of each nymph stages of SulR strain was shorter than that of the SS strain (P < 0.05). The pre-adult duration time, adult pre-oviposition period (APOP), total preoviposition period (TPOP), female total longevity and mean total longevity of SulR strain were also significantly shorter than that of the SS strain (P < 0.05). The fecundity of SulR strain was significantly lower than that of the SS strain (P < 0.05). However, the 42
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 1. Age-stage-specific survival rates (sxj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
female adult longevity and the oviposition days of SulR strain were not significantly different from the SS strain (P > 0.05). The population parameters of SS and SulR strains were evaluated with bootstrap technique based on life table (Table 4). When compared to the susceptible strain, the intrinsic rate of increase (r) and finite rate of increase (λ) of resistant strain were significantly increased (P < 0.001). However, the net reproductive (R0), mean generation time (T) and gross reproductive rate (GRR) of the resistant strain were lower than those of the susceptible strain (P < 0.05). The overall fitness of the resistant strain of A. gossypii was 0.917 compared to the susceptible strain (Table 4). The obvious overlaps between different stages of the age-stage survival rate (sxj) occurred because of the stage differentiation among individuals (Fig. 1). The pattern of sxj curves of SS and SulR strains showed slight differences, with a higher survival rate of pre-adult (nymph stages) and with a lower survival rate of adult females in SulR strain (Fig. 1). By ignoring the stage differentiation, the age-specific survival rate (lx) is a simplified version of age-stage survival rate (sxj). Comparing the patterns of the lx curves of SS and SulR strains, a lower survival rate was observed in adult of the SulR strain, especially at ages of 29–51 days (Fig. 2). The age-specific fecundity (mx) and age-specific maternity (lxmx) showed a similar highest fecundity peak at age of 15 days in both SS and SulR strains (Fig. 2). In addition, the slight differences of mx and lxmx between SS and SulR strain were noticed, at the first 15 days, the values of mx and lxmx of SulR strain were higher than that of the SS strain, whereas after the fecundity peak this trend has reversed, the susceptible individuals exhibited a higher fecundity than those
Fig. 2. Age-specific survival rate (lx), age-specific fecundity (mx) and age-specific maternity (lxmx) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
sulfoxaflor resistant individuals (Fig. 2). Comparing the patterns of age-stage life expectancy (exj) and reproductive value (vxj) of SS and SulR strains, a tendency towards lower values of exj and vxj were observed in the SulR strain (Fig. 3 and Fig. 4).
3.2. Transcriptional levels of development and reproduction related genes in the susceptible and resistant strains The mRNA expression level of six development and reproduction related genes (ecdysone receptor (EcR), ultraspiracle protein (USP), juvenile hormone-binding protein (JHBP), juvenile hormone epoxide 43
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 3. Age-stage life expectancy (exj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
Fig. 4. Age-stage reproductive value (vxj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
hydrolase (JHEH), juvenile hormone acid O-methyltransferase (JHAMT) and Vitellogenin (Vg)) in SS and SulR strains was analyzed using quantitative real-time PCR (qRT-PCR) for exploring the potential association of this genes with the fitness costs in resistance of sulfoxaflor in A. gossypii. The mRNA expression of the EcR, USP and JHBP were significantly increased in the SulR strain compared with the SS strain (by 1.28, 1.38, and 1.23-fold, respectively) (Fig. 5) (P < 0.05). There was no significant difference of the expression levels of JHAMT and JHEH between the susceptible and resistant strains (Fig. 5) (P > 0.05). The transcriptional level of Vg was significantly decreased in the sulfoxaflor resistant strain compared to the susceptible strain (Fig. 5) (P < 0.05).
development durations of nymph/larvae stages can be significantly prolonged in the insecticide resistant strain compared with the susceptible strain (Zhang et al., 2018; Cui et al., 2018). Our results demonstrated that the developmental duration of each nymph stages and the pre-adult duration time of the sulfoxaflor resistant strain were shorter than that of the susceptible strain (Table 3). The similar phenomena were observed in other insect populations that exhibited very high insecticides resistance, including A. gossypii (Wu and Liu, 1994) and M. persicae (Wang et al., 2018). Interestingly, the resistant M. persicae strain that exhibits a shorter development time of nymph stage is also a sulfoxaflor resistance strain (Wang et al., 2018), this imply that the development of sulfoxaflor resistance could facilitate the nymph development in aphids. In this study, we observed that total preadult survival and the oviposition days were not significantly different between SS and SulR strains, whereas the fecundity of SulR was significantly lower than the susceptible strain (Table 3). This suggests that the increased sulfoxaflor resistance at the cost of the reduced fecundity. Similarly, the total longevity of A. gossypii was significantly decreased in the resistant strain, resulting in a decrease of the relative fitness cost (Table 3). This is consistent with most of the reports that the development of resistance to insecticides is accompanied with significantly disadvantage, such as shorten of the total longevity and reduce of fecundity (Kliot and Ghanim, 2012; Zhang et al., 2018). Fitness costs were studied extensively in the last two decades, and many fitness costs cases were reported in many insect species that developed high resistance to insecticides (Kliot and Ghanim, 2012; Zhang et al., 2018; Wang and Wu, 2014; Yu et al., 2018; Tabbabi and
4. Discussion Spraying insecticides is remaining the most important tool in controlling of cotton aphids in China. However, the development of insecticide resistance of A.gossypii greatly affects the effective control of this pest. The development of insecticide resistance is commonly accompanied with some fitness costs, which have great effect on the evolution of resistance. Therefore, investigation of the fitness costs of a resistant strain is very important for designing an integrated pest management program to limit the spread of the resistant population (Abbas et al., 2016). Two laboratory strains derived from the same field population were used in this study, due to the similar genetic background of populations could accurately assess the resistance-associated fitness costs (Wang and Wu, 2014). Although many reports demonstrated that the 44
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 5. Relative mRNA expression level of six development and reproduction related genes in the sulfoxaflor susceptible and resistant strains. Data presented as the mean ± SD for three independent replicates. The lowercase letters (a, b) in the figure indicates significant differences as determined by Student's t-test (P < 0.05).
resistance in A. gossypii, the overexpression of EcR, USP, JHBP, as well as the downregulation of Vg mRNA expression might play very important role in this trade-off. These results will be useful for understanding the resistance of sulfoxaflor and designing appropriate resistance management strategies of A. gossypii.
Daaboub, 2018; Li et al., 2017; Germano and Picollo, 2015; Gassmann et al., 2009). However, the molecular mechanism is not well understood. Hence, in the current study, to investigate the potential molecular mechanism of the shorten development duration and decrease of the longevity and fecundity in the resistant strain, we determined the expression levels of six development and reproduction related genes. 20-hydroxyecdysone (20E) signaling and juvenile hormone (JH) signaling are very important pathways in insects, and the cross-talk of these pathways regulates growth and metabolism of insects (Li et al., 2018; Hill et al., 2013; Spindler et al., 2009). Our results indicated that the expression levels of JHAMT and JHEH were not significantly changed between SS and SulR strain. However, the mRNA transcript levels of EcR, USP and JHBP were significantly overexpressed in sulfoxaflor resistant strain (Fig. 5). Given that EcR and USP are two essential molting hormone receptors involved in growth and development of insects (Yan et al., 2016). This finding suggests that sulfoxaflor may modulate molting hormone pathway in A. gossypii, and this could explanation the shorten duration of nymph stages in the SulR strain to some extent. Similarly, the overexpression of EcR and USP were also observed in a thiamethoxam resistant strain of A. gossypii that just developed a 13.79-fold resistance to thiamethoxam (Wu et al., 2018). Vitellogenin (Vg) is a very important reproduction-related protein, which is traditionally considered to be an adequate parameter for evaluating female fertility in insects (Zhao et al., 2018; Li et al., 2010). For example, the decreased expression of Vg was found have negative impacts on the fecundity of Chilo suppressalis (Huang et al., 2016) and the downregulation of Vg by sulfoxaflor has a negative effect on the fecundity of A. lucorum (Zhen et al., 2018). Our result demonstrated that the mRNA expression level of Vg was significantly reduced in the SulR strain compared with the susceptible strain (Fig. 5). Combining with the fact that the fecundity of the SulR strain was significantly lower than that of the susceptible strain (Table 3), suggesting that the downregulation of Vg in sulfoxaflor resistant strain might significantly influence the fecundity of A. gossypii. In conclusion, there is a fitness costs associated with sulfoxaflor
Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 31330064, 31801760) and China Postdoctoral Science Foundation (No. 2018 M630229). References Abbas, N., Shah, R.M., Shad, S.A., Azher, F., 2016. Dominant fitness costs of resistance to fipronil in Musca domestica Linnaeus (Diptera: Muscidae). Vet. Parasitol. 226, 78–82. Babcock, J.M., Gerwick, C.B., Huang, J.X., Loso, M.R., Nakamura, G., Nolting, S.P., Rogers, R.B., Sparks, T.C., Thomas, J., Watson, G.B., Zhu, Y., 2011. Biological characterization of sulfoxaflor, a novel insecticide. Pest Manag. Sci. 67, 328–334. Blackman, R.L., Eastop, V.F., 1984. Aphids on the world's Crops: An Identification Guide. John Wiley and Sons, NY. Chen, X.W., Ma, K.S., Li, F., Liang, P.Z., Liu, Y., Guo, T.F., Song, D.L., Desneux, N., Gao, X.W., 2016. Sublethal and transgenerational effects of sulfoxaflor on the biological traits of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae). Ecotoxicology 25, 1841–1848. Chen, X.W., Tie, M.Y., Chen, A.Q., Ma, K.S., Li, F., Liang, P.Z., Liu, Y., Song, D.L., Gao, X.W., 2017a. Pyrethroid resistance associated with M918 L mutation and detoxifying metabolism in Aphis gossypii from Bt cotton growing regions of China. Pest Manag. Sci. 73, 2353–2359. Chen, X.W., Li, F., Chen, A.Q., Ma, K.S., Liang, P.Z., Liu, Y., Song, D.L., Gao, X.W., 2017b. Both point mutations and low expression levels of the nicotinic acetylcholine receptor beta1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China. Pestic. Biochem. Physiol. 141, 1–8. Chi, H., 1988. Life-table analysis incorporating both sexes and variable development rates among individuals. Environ. Entomol. 17, 26–34. Chi, H., 2018. TWOSEX-MS Chart: A Computer Program for the Age-Stage, Two-Sex Life Table Analysis. http://140.120.197.173/Ecology/, Accessed date: 25 September 2018. Chi, H., Liu, H., 1985. Two new methods for the study of insect population ecology. Bull. Inst. Zool Academia Sinica 24, 225–240. Cui, L., Wang, Q., Qi, H., Wang, Q., Yuan, H., Rui, C., 2018. Resistance selection of indoxacarb in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae): cross-resistance,
45
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al. biochemical mechanisms and associated fitness costs. Pest Manag. Sci. 74, 2636–2644. Efron, B., Tibshirani, R.J., 1993. An introduction to the bootstrap. J. Great Lakes Res. 20, 1–6. Fu, B., Li, Q., Qiu, H., Tang, L., Zeng, D., Liu, K., Gao, Y., 2018. Resistance development, stability, cross-resistance potential, biological fitness and biochemical mechanisms of spinetoram resistance in Thrips hawaiiensis (Thysanoptera: Thripidae). Pest Manag. Sci. 74, 1564–1574. Gassmann, A.J., Carriere, Y., Tabashnik, B.E., 2009. Fitness costs of insect resistance to Bacillus thuringiensis. Annu. Rev. Entomol. 54, 147–163. Germano, M.D., Picollo, M.I., 2015. Reproductive and developmental costs of deltamethrin resistance in the Chagas disease vector Triatoma infestans. J. Vector Ecol. 40, 59–65. Groters, F.R., Tabashnik, B.E., Finson, N., Johnson, M.W., 1994. Fitness costs of resistance to Bacillus thuringiensis in the diamondback moth (Plutella xylostella). Evolution 48, 197–201. Hill, R.J., Billas, I.M., Bonneton, F., Graham, L.D., Lawrence, M.C., 2013. Ecdysone receptors: from the Ashburner model to structural biology. Annu. Rev. Entomol. 58, 251–271. Huang, Y.B., Chi, H., 2013. Life tables of Bactrocera cucurbitae (Diptera: Tephritidae): with an invalidation of the jackknife technique. J. Appl. Entomol. 137, 327–339. Huang, L., Lu, M., Han, G., Du, Y., Wang, J., 2016. Sublethal effects of chlorantraniliprole on development, reproduction and vitellogenin gene (CsVg) expression in the rice stem borer, Chilo suppressalis. Pest Manag. Sci. 72, 2280–2286. Huang, H.W., Chi, H., Smith, C.L., 2018. Linking demography and consumption of Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae) fed on Solanum photeinocarpum (Solanales: Solanaceae): with a new method to project the uncertainty of population growth and consumption. J. Econ. Entomol. 111, 1–9. Kliot, A., Ghanim, M., 2012. Fitness costs associated with insecticide resistance. Pest Manag. Sci. 68, 1431–1437. Li, T.W., Gao, X.W., Zheng, B.Z., Liang, P., 2000. Study on genetics of avermectins resistance and population fitness in Plutella xylostella. Acta Entomol. Sin. 43, 255–263. Li, J., Huang, J., Cai, W., Zhao, Z., Peng, W., Wu, J., 2010. The vitellogenin of the bumblebee, Bombus hypocrita: studies on structural analysis of the cDNA and expression of the mRNA. J. Comp. Physiol. B. 180, 161–170. Li, X., Wan, Y., Yuan, G., Hussain, S., Xu, B., Xie, W., Wang, S., Zhang, Y., Wu, Q., 2017. Fitness trade-off associated with spinosad resistance in Frankliniella occidentalis (Thysanoptera: Thripidae). J. Econ. Entomol. 110, 1755–1763. Li, K., Jia, Q.Q., Li, S., 2018. Juvenile hormone signaling - a mini review. Insect Sci. 00, 1–7. https://doi.org/10.1111/1744-7917.12614. Liao, X., Mao, K., Ali, E., Zhang, X., Wan, H., Li, J., 2017. Temporal variability and resistance correlation of sulfoxaflor susceptibility among Nilaparvata lugens. Crop Prot. 102, 141–146. Liao, X., Jin, R., Zhang, X., Ali, E., Mao, K., Xu, P., Li, J., Wan, H., 2018. Characterization of sulfoxaflor resistance in the brown planthopper, Nilaparvata lugens (Stal). Pest Manag. Sci. https://doi.org/10.1002/ps.5282. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Ma, K.S., Li, F., Liang, P.Z., Chen, X.W., Liu, Y., Gao, X.W., 2016. Identification and validation of reference genes for the normalization of gene expression data in qRT-PCR analysis in Aphis gossypii (Hemiptera: Aphididae). J. Insect Sci. 16, 1–9. Ma, K.S., Li, F., Liu, Y., Liang, P.Z., Chen, X.W., Gao, X.W., 2017. Identification of microRNAs and their response to the stress of plant allelochemicals in Aphis gossypii (Hemiptera: Aphididae). BMC Mol. Biol. 18, 5. Moores, G.D., Gao, X.W., Denholm, I., Devonshire, A.L., 1996. Characterisation of insensitive acetylcholinesterase in insecticide-resistant cotton aphids, Aphis gossypii
Glover (Homoptera: Aphididae). Pestic. Biochem. Physiol. 56, 102–110. Sparks, T.C., DeBoer, G.J., Wang, N.X., Hasler, J.M., Loso, M.R., Watson, G.B., 2012. Differential metabolism of sulfoximine and neonicotinoid insecticides by Drosophila melanogaster monooxygenase CYP6G1. Pestic. Biochem. Physiol. 103, 159–165. Spindler, K.D., Honl, C., Tremmel, C., Braun, S., Ruff, H., Spindler-Barth, M., 2009. Ecdysteroid hormone action. Cell. Mol. Life Sci. 66, 3837–3850. Steinbach, D., Moritz, G., Nauen, R., 2017. Fitness costs and life table parameters of highly insecticide-resistant strains of Plutella xylostella (L.) (Lepidoptera: Plutellidae) at different temperatures. Pest Manag. Sci. 73, 1789–1797. Sun, L.J., Zhou, X.G., Zhang, J., Gao, X.W., 2005. Polymorphisms in a carboxylesterase gene between organophosphate-resistant and -susceptible Aphis gossypii (Homoptera: Aphididae). J. Econ. Entomol. 98, 1325–1332. Tabbabi, A., Daaboub, J., 2018. Fitness cost in field Anopheles labranchiae populations associated with resistance to the insecticide deltamethrin. Rev. Bras. Entomol. 62, 107–111. Wang, R., Wu, Y., 2014. Dominant fitness costs of abamectin resistance in Plutella xylostella. Pest Manag. Sci. 70, 1872–1876. Wang, K.Y., Liu, T.X., Yu, C.H., Jiang, X.Y., Yi, M.Q., 2002. Resistance of Aphis gossypii (Homoptera: Aphididae) to fenvalerate and imidacloprid and activities of detoxification enzymes on cotton and cucumber. J. Econ. Entomol. 95, 407–413. Wang, W., Wang, S., Han, G., Du, Y., Wang, J., 2017. Lack of cross-resistance between neonicotinoids and sulfoxaflor in field strains of Q-biotype of whitefly, Bemisia tabaci, from eastern China. Pestic. Biochem. Physiol. 136, 46–51. Wang, Z.H., Gong, Y.J., Chen, J.C., Su, X.C., Cao, L.J., Hoffmann, A.A., Wei, S.J., 2018. Laboratory selection for resistance to sulfoxaflor and fitness costs in the green peach aphid Myzus persicae. J. Asia Pac. Entomol. 21, 408–412. Wu, K.M., Guo, Y.Y., 2005. The evolution of cotton pest management practices in China. Annu. Rev. Entomol. 50, 31–52. Wu, K.M., Liu, Q.X., 1994. Some biological characteristics of cotton aphid strain resistant to fenvalerate. Acta Entomol. Sin. 37, 137–144. Wu, Y., Xu, H., Pan, Y., Gao, X., Xi, J., Zhang, J., Shang, Q., 2018. Expression profile changes of cytochrome P450 genes between thiamethoxam susceptible and resistant strains of Aphis gossypii Glover. Pestic. Biochem. Physiol. 149, 1–7. Yan, T., Chen, H., Sun, Y., Yu, X., Xia, L., 2016. RNA interference of the ecdysone receptor genes EcR and USP in grain aphid (Sitobion avenae F.) affects its survival and fecundity upon feeding on wheat plants. Int. J. Mol. Sci. 17, 2098. Yu, N., Tian, J., Zhang, Y., Li, Z., Liu, Z., 2018. Imidacloprid-susceptible Nilaparvata lugens individuals exceeded resistant individuals in a mixture population with density pressure. Pest Manag. Sci. 74, 234–239. Zhang, X.L., Mao, K.K., Liao, X., He, B.Y., Jin, R.H., Tang, T., Wan, H., Li, J.H., 2018. Fitness cost of nitenpyram resistance in the brown planthopper Nilaparvata lugens. J. Pest Sci. 91, 1145–1151. Zhao, J., Sun, Y., Xiao, L., Tan, Y., Jiang, Y., Bai, L., 2018. Vitellogenin and vitellogenin receptor gene expression profiles in Spodoptera exigua are related to host plant suitability. Pest Manag. Sci. 74, 950–958. Zhen, C.A., Miao, L., Gao, X.W., 2018. Sublethal effects of sulfoxaflor on biological characteristics and vitellogenin gene (AlVg) expression in the mirid bug, Apolygus lucorum (Meyer-Dür). Pestic. Biochem. Physiol. 144, 57–63. Zheng, B.Z., Gao, X.W., Wang, Z.G., Liang, T.T., Cao, B.J., Gao, H., 1989. Resistant mechanism of organophosphorous and carbamate insecticides in Aphis gossypii Glov. Acta Phytophylacica Sinica 16, 131–138. Zhu, Y., Loso, M.R., Watson, G.B., Sparks, T.C., Rogers, R.B., Huang, J.X., Gerwick, B.C., Babcock, J.M., Kelley, D., Hegde, V.B., Nugent, B.M., Renga, J.M., Denholm, I., Gorman, K., DeBoer, G.J., Hasler, J., Meade, T., Thomas, J.D., 2011. Discovery and characterization of sulfoxaflor, a novel insecticide targeting sap-feeding pests. J. Agric. Food Chem. 59, 2950–2957.
46
Contents lists available at ScienceDirect
Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/pest
Fitness costs of sulfoxaflor resistance in the cotton aphid, Aphis gossypii Glover Kangsheng Ma, Qiuling Tang, Jin Xia, Nannan Lv, Xiwu Gao
T
⁎
Department of Entomology, China Agricultural University, Beijing 100193, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Aphis gossypii Sulfoxaflor Fitness costs Insecticide resistance
Aphis gossypii Glover is an economically important pest of numerous crops throughout the world. Some field populations of A.gossypii in China have developed moderate level of resistance to sulfoxaflor, a newly released sulfoximine insecticide for management of sap-feeding pests. To evaluate the effect of sulfoxaflor resistance on the fitness cost of A. gossypii, the life history traits of sulfoxaflor-resistant strain (SulR) and an isogenic susceptible strain (SS) were compared using the age-stage, two-sex life table approach. The results showed that the resistant strain had a reduction in fitness (relative fitness = 0.917), along with significantly decreases in longevity, fecundity, net reproductive (R0), mean generation time (T) and gross reproductive rate (GRR). Compared to the susceptible strain, SulR strain showing a shorter developmental duration of each nymph instar stage. Moreover, the adult pre-oviposition period (APOP) and total preoviposition period (TPOP) of SulR strain were also significantly shorter than that of the susceptible strain. Investigation of six development and reproduction related genes indicated that EcR, USP and JHBP were overexpressed in the SulR strain, while the mRNA transcript level of Vg was decreased significantly compared to the susceptible strain. These results suggest that there is a fitness cost associated with sulfoxaflor resistance in A. gossypii and the different expression of EcR, USP, JHBP, and Vg may play very important role in this trade-off.
1. Introduction
A. gossypii, Myzus persicae, Nilaparvata lugens, Apolygus lucorum, and Bemisia tabaci (Chen et al., 2016; Zhen et al., 2018; Liao et al., 2018). In recent years, sulfoxaflor was a popular insecticide for A. gossypii control because it was highly efficient, have long-lasting effects and good environmental safety profile. However, our recent field investigation of resistance showed that the field populations of A. gossypii in China had developed low to moderate level of resistance to sulfoxaflor (unpublished). In addition, the field populations of N. lugens had also developed resistance to this insecticide (Liao et al., 2017). These findings suggest that field populations of A. gossypii possess the high resistance risk to sulfoxaflor. Fitness cost is a very important factor influencing the evolution of insecticide resistance, and may affect the rate of resistance increase in insect populations (Abbas et al., 2016; Kliot and Ghanim, 2012). Normally, the development of resistance to an insecticide is accompanied with high energetic cost or significant disadvantage that could diminish the insect's fitness compared with its susceptible counterparts in the population (Kliot and Ghanim, 2012). Fitness costs associated with insecticides resistance have been documented in many insect pests, including Thrips hawaiiensis (Fu et al., 2018), Plutella xylostella (Steinbach et al., 2017), N. lugens (Zhang et al., 2018) and Musca
The cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is a destructive pest on cotton and numerous crops throughout the world. As a sap-feeding insect species, A. gossypii causes economic damage both through direct feeding and indirectly virus transmission and contamination of aphid honeydew (Blackman and Eastop, 1984; Ma et al., 2017). The control of this pest in China has been largely dependent on the application of chemical insecticides (Chen et al., 2017a; Wu and Guo, 2005). Consequently, cotton aphids have evolved resistance to many types of insecticides, including organophosphates, carbamates, pyrethroids, and neonicotinoids (Chen et al., 2017a; Sun et al., 2005; Wang et al., 2002; Zheng et al., 1989; Chen et al., 2017b). Sulfoxaflor is the first commercially available sulfoximine insecticide discovered by Dow AgroSciences (Zhu et al., 2011; Babcock et al., 2011), and is used primarily for the control of sap-feeding insect pests (Babcock et al., 2011; Sparks et al., 2012). Sulfoxaflor was reported to exhibit highly efficacy against many sap-feeding pests and lack insecticidal cross-resistance to neonicotinoids (Zhu et al., 2011; Babcock et al., 2011; Wang et al., 2017). In China, it has been registered for the control of many serious sap-feeding pests since 2013, including
⁎
Corresponding author. E-mail address: [email protected] (X. Gao).
https://doi.org/10.1016/j.pestbp.2019.04.009 Received 6 February 2019; Received in revised form 7 April 2019; Accepted 17 April 2019 Available online 19 April 2019 0048-3575/ © 2019 Elsevier Inc. All rights reserved.
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
domestica (Abbas et al., 2016). In M. persicae, a sulfoxaflor resistant strain had been reported had a fitness cost of 0.83 compared to the susceptible strain (Wang et al., 2018). In the laboratory, we established a sulfoxaflor resistant strain of A. gossypii through continuous selection with sulfoxaflor, the cross-resistance, synergism of three synergists and the resistance mechanism were studied preliminarily. However, the fitness costs associated with this insecticide were not investigated previously. Identifying fitness costs and dominance of fitness costs associated with resistance to any insecticide could be useful for designing an integrated pest management (IPM) program to limit the spread of the resistant population (Abbas et al., 2016). Therefore, in the current study, the life table parameters were employed for investigating whether the fitness costs were associated with the sulfoxaflor resistance in A. gossypii. In addition, the transcriptional levels of six development and reproduction related genes were determined to investigate the underlying mechanism. The results of the present study should be useful in designing appropriate resistance management strategies for A. gossypii.
Table 2 Primers used in the qRT-PCR analysis.
2.1. Insects Two isogenic laboratory strains were used in this study. The susceptible strain (SS), as anholocyclic clone, was derived from a single female in the original field samples collected in 2016 from cotton fields in the Shawan County of Xinjiang Uygur Autonomous Region, China, where sulfoxaflor had not been applied. The sulfoxaflor resistant strain (SulR) was established from the Shawan population by continual selection by the gradually increased concentration of sulfoxaflor based on the LC50 values from the bioassay of their parent generations for total 27 generations in the laboratory (Table 1). About 5000 adults were screened with leaf-dipping method in each generation and the mortality was maintained at 60–80%. Both susceptible and resistant strains were reared on the cotton seedlings, Gossypium hirsutum (L.), in controlled conditions of 20–23 °C, 60% relative humidity, and a photoperiod of 16: 8 h (light: dark).
2.3. Toxicity bioassays The toxicity of the sulfoxaflor to A. gossypii was determined using a leaf-dipping method (Moores et al., 1996) with slight modifications (Chen et al., 2017b). Stocks of insecticide were prepared in acetone and adjusted to final concentrations by serial dilution with distilled water containing 0.05% (v/v) Triton X-100 for the bioassays. Cotton leaves
2.5. Quantitative RT-PCR
Table 1 Toxicity of sulfoxaflor in susceptible (SS) and resistance (SulR) strains of Aphis gossypii. Slope ± SE
LC50 (95% CL) (mg L−1)b
χ
df
SS SulR
1.826 ± 0.204 1.242 ± 0.145
0.642 (0.435–0.862) 235.231 (162.849–408.219)
21.854 15.067
16 15
GAAGCCTGGTATGGTTGTCGT GGGTGGGTTGTTCTTTGTG GGGAGTCATGGTTGGTATGG TCCATATCGTCCCAGTTGGT CACAGCACAACAACAATTCGTCC CCGCATACCAGGCACAGTTCTTC GGATAGAACTGAACTTGGCTGC CGTAATGAAGGGAGCCGAAG ACCACTGCACACTCGGATAA CGGCTTGCATGAACCAGTAG GCTCGGTTGGCCTATTGAAG GCTTGATCCTCGCCAAATCC ATGTGGACCAGGCGATGTAA AGAACAGTCATTGGCATTTTC CTTATGTTGCACGGATGGCC ATCGCCACCTTGAACGTAGA
Life tables were constructed separately for the susceptible and resistant strains. For each strain, about 300 apterous adult aphids were placed on fresh cotton plants for 24 h. Then, the newborn nymphs (≤ 24 h old) were placed onto the 20 mm diameter leaf discs, which were placed upside down on agar beds (1.5 mL of 2% agar) in wells of 12well cell-culture plates and covered with Chinese art paper to prevent escape. About 100 nymphs from the susceptible and resistant strains were randomly selected, cultured, and observed individually. The population parameters, including development time, fecundity, mortality, and longevity were monitored daily. During the reproductive period, the newborn nymphs produced by females were counted and removed daily until the death of all adult aphids. New cotton leaf discs were replaced every 4 days until the death of the adult. Finally, an age-stage, two-sex life table was constructed from the data obtained in these experiments.
Sulfoxaflor (97.9%) was obtained from Dow AgroSciences (Indianapolis, USA). Triton X-100 was obtained from Sigma-Aldrich Co. (Saint Louis, USA). All other chemicals and solvents used were analytical grade reagents.
Strains
EF1α-F EF1α-R β-ACT-F β-ACT-R EcR-F EcR-R USP-F USP-R Vg-F Vg-R JHBP-F JHBP-R JHAMT-F JHAMT-R JHEH-F JHEH-R
2.4. Fitness comparisons
2.2. Insecticide and reagents
2
Primer sequences (5′-3′)
were cut into 20 mm diameter discs with a sharpened steel punch. The leaf discs were dipped in the desired concentration of insecticide or in 0.05% (v/v) Triton X-100 water for 15 s as a control. The treated leaf discs were placed on the disposable PE gloves and allowed to air dry, and then placed upside down onto the agar beds in 12-well cell culture plates. Apterous adult aphids were carefully transferred onto the discs and covered with Chinese art paper to prevent escape. Bioassays were maintained in the laboratory at 20–23 °C with a photoperiod of 16: 8 h (light: dark). The treatment for each concentration was performed with three replicates, and at least 30 aphids were used for each replicate. The mortality was assessed at 48 h after treatment. The LC50 values were calculated by the probit analysis using POLO Plus 2.0 statistical software (LeOra Software Inc., Berkeley, CA). The resistance ratios (RR) were calculated at the LC50 level by dividing the LC50 of the resistant strain by the LC50 of the susceptible strain.
2. Materials and methods
a
Primer name
Total RNA was isolated form the apterous adult aphids using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. First-strand cDNA was synthesized from 1.0 μg of total RNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was performed on an Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, Foster city, CA, USA) using SYBR® Premix Ex Taq™ (Tli RNaseH Plus) (Takara Biotechnology, Dalian, China). The reactions were performed in a 20 μL volume of a mixture containing 1 μL cDNA template, 10 μL SYBR Green mix, 0.4 μL of ROX Reference Dye II, 0.4 μL of each primer and 7.8 μL of nuclease-free water. The
Resistance ratio (RR) c
366.40
a
Standard error. Confidence limits. c RR (resistance ratio) = LC50 of the resistant strain/LC50 of the susceptible strain. b
41
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Table 3 Duration of the development, reproduction, survival rate and life table parameters ( ± SE) for the susceptible and resistant strains of A. gossypii. Biological parameters
First instar nymph (d) Second instar nymph (d) Third instar nymph (d) Forth instar nymph (d) Pre-adult (d) Adult (d) APOP (d) TPOP (d) Oviposition days Female total longevity (d) Mean total longevity (d) Total preadult survival Fecundity (offspring/individual) a b ⁎
Susceptible strain (SS)
Resistant strain (SulR) a
N
Mean ± SE
108 106 106 106 106 106 106 106 106 106 108 108 106
2.94 ± 0.07 1.85 ± 0.05 1.63 ± 0.05 1.87 ± 0.05 8.29 ± 0.10 31.92 ± 1.00 1.04 ± 0.08 9.33 ± 0.09 20.02 ± 0.56 40.21 ± 0.97 39.55 ± 1.06 0.98 ± 0.01 40.39 ± 1.12
95% CI
b
P
a
N
Mean ± SE
106 106 106 105 105 105 105 105 105 105 108 108 105
2.38 ± 0.06 1.62 ± 0.05 1.44 ± 0.05 1.50 ± 0.05 6.94 ± 0.07 30.07 ± 0.95 0.46 ± 0.06 7.40 ± 0.08 19.78 ± 0.59 37.01 ± 0.95 36.08 ± 1.07 0.97 ± 0.02 37.38 ± 1.22
(0.38, 0.75)⁎ (0.08, 0.37)⁎ (0.05, 0.32)⁎ (0.22, 0.51)⁎ (1.11, 1.59)⁎ (−0.83, 4.53) (0.38, 0.78)⁎ (1.69, 2.17)⁎ (−1.35,1.82) (0.55, 5.85)⁎ (0.53, 6.40)⁎ (−0.03, 0.05) (0.22, 6.23) ⁎
0 0.002 0.007 0 0 0.177 0 0 0.77 0.018 0.021 0.816 0.047
Standard errors (SE) were estimated by using the bootstrap technique with 100,000 re-samplings. Difference between strains were compared with paired bootstrap test. If the CI includes 0, there is no difference at 5% level. Significant differences between SulR and SS strains at P = 0.05 level.
Table 4 The means and standard errors of population parameters of different strains of A. gossypii. Population parametersa
−1
r (d ) λ (d−1) R0 (offspring/individual) T (d) GRR (offspring/individual) Rfd a b c d ⁎
Mean ± SEb Susceptible strain (SS)
Resistant strain (SulR)
0.216 ± 0.002 1.242 ± 0.003 39.639 ± 1.210 17.010 ± 0.145 44.190 ± 0.778 /
0.254 ± 0.003 1.289 ± 0.004 36.343 ± 1.321 14.156 ± 0.159 41.640 ± 1.047 0.917
95% CIc
P
(0.03, (0.04, (0.21, (2.43, (0.01, /
0.000 0.000 0.045 0.000 0.05 /
0.05)⁎ 0.06)⁎ 6.80) ⁎ 3.27)⁎ 5.10)⁎
r, intrinsic rate of increase; λ, finite rate of increase; R0, net reproductive rate; T, mean generation time; GRR, gross reproduction rate. Standard errors between two strains were estimated by using the bootstrap technique with 100,000 resamplings. Difference between strains were compared with paired bootstrap test. If the CI includes 0, there is no difference at 5% level. Rf = R0 of the resistant strain (SulR)/ R0 of the susceptible strain (SS). Significant differences between SulR and SS strains at P = 0.05 level.
100,000 random resampling and difference of population parameters between control and plant allelochemical treatment groups were compared by using the paired bootstrap test based on the confidence intervals of differences implemented in TWOSEX-MSChart (Chi, 2018; Huang and Chi, 2013; Huang et al., 2018). All graphics were constructed using SigmaPlot 12.0 (Systat Software Inc., San Jose, CA, USA). Relative fitness (Rf) was estimated as follows: a Rf > 1 suggests that the net reproductive rate of resistant strain is enhanced, whereas a Rf < 1 suggests that the resistant strain has a fitness defect (Li et al., 2000; Groters et al., 1994): Rf = R0 of resistant strain/ R0 of susceptible strain. For qRT-PCR, the significance of difference was determined by an unpaired t-test using the GraphPad InStat 3.0 software (GraphPad Software, San Diego, CA, USA).
primers used in this study were listed in Table 2. The thermocycling program was as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. After amplification, one dissociation step cycle of 95 °C for 15 s, 60 °C for 1 min and 95 °C for 30 s, and 60 °C for 15 s was performed to ensure the specificity of the amplified product. The experiment was conducted with three technical replications and three independent biological replicates. The housekeeping genes elongation factor 1 alpha (EF1α) and beta actin (β-ACT) were used as internal reference genes for A. gossypii (Ma et al., 2016). The relative gene expression was calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001). 2.6. Data analysis The life table data for all A. gossypii individuals were analyzed according to the age-stage, two-sex life table theory (Chi, 1988; Chi and Liu, 1985). The population parameters, including the intrinsic rate of increase (r), finite rate of increase (λ), net reproductive rate (R0), the mean generation time (T), age-stage specific survival rates (sxj, where x is age and j is stage), age-specific survival rate (lx), age-specific fecundity (mx), adult pre-oviposition period (APOP), total preoviposition period (TPOP), oviposition days (Od) (i.e., the number of days that adult produced offspring), age-specific maternity (lxmx), age-stage specific life expectancy (exj), reproductive value (vxj), were calculated according to Chi and Liu (Chi and Liu, 1985) and Chi (Chi, 1988) by using the computer program TWOSEX-MSChart (Chi, 2018). The variances and standard errors of the population parameters were estimated using the bootstrap procedure (Efron and Tibshirani, 1993) with
3. Results 3.1. Effect of sulfoxaflor resistance on the life history traits of A. gossypii Means of life-history traits, including development time, longevity, oviposition days and fecundity of susceptible (SS)and resistant strains (SulR) are presented in Table 3. The developmental duration of each nymph stages of SulR strain was shorter than that of the SS strain (P < 0.05). The pre-adult duration time, adult pre-oviposition period (APOP), total preoviposition period (TPOP), female total longevity and mean total longevity of SulR strain were also significantly shorter than that of the SS strain (P < 0.05). The fecundity of SulR strain was significantly lower than that of the SS strain (P < 0.05). However, the 42
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 1. Age-stage-specific survival rates (sxj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
female adult longevity and the oviposition days of SulR strain were not significantly different from the SS strain (P > 0.05). The population parameters of SS and SulR strains were evaluated with bootstrap technique based on life table (Table 4). When compared to the susceptible strain, the intrinsic rate of increase (r) and finite rate of increase (λ) of resistant strain were significantly increased (P < 0.001). However, the net reproductive (R0), mean generation time (T) and gross reproductive rate (GRR) of the resistant strain were lower than those of the susceptible strain (P < 0.05). The overall fitness of the resistant strain of A. gossypii was 0.917 compared to the susceptible strain (Table 4). The obvious overlaps between different stages of the age-stage survival rate (sxj) occurred because of the stage differentiation among individuals (Fig. 1). The pattern of sxj curves of SS and SulR strains showed slight differences, with a higher survival rate of pre-adult (nymph stages) and with a lower survival rate of adult females in SulR strain (Fig. 1). By ignoring the stage differentiation, the age-specific survival rate (lx) is a simplified version of age-stage survival rate (sxj). Comparing the patterns of the lx curves of SS and SulR strains, a lower survival rate was observed in adult of the SulR strain, especially at ages of 29–51 days (Fig. 2). The age-specific fecundity (mx) and age-specific maternity (lxmx) showed a similar highest fecundity peak at age of 15 days in both SS and SulR strains (Fig. 2). In addition, the slight differences of mx and lxmx between SS and SulR strain were noticed, at the first 15 days, the values of mx and lxmx of SulR strain were higher than that of the SS strain, whereas after the fecundity peak this trend has reversed, the susceptible individuals exhibited a higher fecundity than those
Fig. 2. Age-specific survival rate (lx), age-specific fecundity (mx) and age-specific maternity (lxmx) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
sulfoxaflor resistant individuals (Fig. 2). Comparing the patterns of age-stage life expectancy (exj) and reproductive value (vxj) of SS and SulR strains, a tendency towards lower values of exj and vxj were observed in the SulR strain (Fig. 3 and Fig. 4).
3.2. Transcriptional levels of development and reproduction related genes in the susceptible and resistant strains The mRNA expression level of six development and reproduction related genes (ecdysone receptor (EcR), ultraspiracle protein (USP), juvenile hormone-binding protein (JHBP), juvenile hormone epoxide 43
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 3. Age-stage life expectancy (exj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
Fig. 4. Age-stage reproductive value (vxj) in the sulfoxaflor resistant (SulR) and susceptible strains (SS) of A. gossypii.
hydrolase (JHEH), juvenile hormone acid O-methyltransferase (JHAMT) and Vitellogenin (Vg)) in SS and SulR strains was analyzed using quantitative real-time PCR (qRT-PCR) for exploring the potential association of this genes with the fitness costs in resistance of sulfoxaflor in A. gossypii. The mRNA expression of the EcR, USP and JHBP were significantly increased in the SulR strain compared with the SS strain (by 1.28, 1.38, and 1.23-fold, respectively) (Fig. 5) (P < 0.05). There was no significant difference of the expression levels of JHAMT and JHEH between the susceptible and resistant strains (Fig. 5) (P > 0.05). The transcriptional level of Vg was significantly decreased in the sulfoxaflor resistant strain compared to the susceptible strain (Fig. 5) (P < 0.05).
development durations of nymph/larvae stages can be significantly prolonged in the insecticide resistant strain compared with the susceptible strain (Zhang et al., 2018; Cui et al., 2018). Our results demonstrated that the developmental duration of each nymph stages and the pre-adult duration time of the sulfoxaflor resistant strain were shorter than that of the susceptible strain (Table 3). The similar phenomena were observed in other insect populations that exhibited very high insecticides resistance, including A. gossypii (Wu and Liu, 1994) and M. persicae (Wang et al., 2018). Interestingly, the resistant M. persicae strain that exhibits a shorter development time of nymph stage is also a sulfoxaflor resistance strain (Wang et al., 2018), this imply that the development of sulfoxaflor resistance could facilitate the nymph development in aphids. In this study, we observed that total preadult survival and the oviposition days were not significantly different between SS and SulR strains, whereas the fecundity of SulR was significantly lower than the susceptible strain (Table 3). This suggests that the increased sulfoxaflor resistance at the cost of the reduced fecundity. Similarly, the total longevity of A. gossypii was significantly decreased in the resistant strain, resulting in a decrease of the relative fitness cost (Table 3). This is consistent with most of the reports that the development of resistance to insecticides is accompanied with significantly disadvantage, such as shorten of the total longevity and reduce of fecundity (Kliot and Ghanim, 2012; Zhang et al., 2018). Fitness costs were studied extensively in the last two decades, and many fitness costs cases were reported in many insect species that developed high resistance to insecticides (Kliot and Ghanim, 2012; Zhang et al., 2018; Wang and Wu, 2014; Yu et al., 2018; Tabbabi and
4. Discussion Spraying insecticides is remaining the most important tool in controlling of cotton aphids in China. However, the development of insecticide resistance of A.gossypii greatly affects the effective control of this pest. The development of insecticide resistance is commonly accompanied with some fitness costs, which have great effect on the evolution of resistance. Therefore, investigation of the fitness costs of a resistant strain is very important for designing an integrated pest management program to limit the spread of the resistant population (Abbas et al., 2016). Two laboratory strains derived from the same field population were used in this study, due to the similar genetic background of populations could accurately assess the resistance-associated fitness costs (Wang and Wu, 2014). Although many reports demonstrated that the 44
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al.
Fig. 5. Relative mRNA expression level of six development and reproduction related genes in the sulfoxaflor susceptible and resistant strains. Data presented as the mean ± SD for three independent replicates. The lowercase letters (a, b) in the figure indicates significant differences as determined by Student's t-test (P < 0.05).
resistance in A. gossypii, the overexpression of EcR, USP, JHBP, as well as the downregulation of Vg mRNA expression might play very important role in this trade-off. These results will be useful for understanding the resistance of sulfoxaflor and designing appropriate resistance management strategies of A. gossypii.
Daaboub, 2018; Li et al., 2017; Germano and Picollo, 2015; Gassmann et al., 2009). However, the molecular mechanism is not well understood. Hence, in the current study, to investigate the potential molecular mechanism of the shorten development duration and decrease of the longevity and fecundity in the resistant strain, we determined the expression levels of six development and reproduction related genes. 20-hydroxyecdysone (20E) signaling and juvenile hormone (JH) signaling are very important pathways in insects, and the cross-talk of these pathways regulates growth and metabolism of insects (Li et al., 2018; Hill et al., 2013; Spindler et al., 2009). Our results indicated that the expression levels of JHAMT and JHEH were not significantly changed between SS and SulR strain. However, the mRNA transcript levels of EcR, USP and JHBP were significantly overexpressed in sulfoxaflor resistant strain (Fig. 5). Given that EcR and USP are two essential molting hormone receptors involved in growth and development of insects (Yan et al., 2016). This finding suggests that sulfoxaflor may modulate molting hormone pathway in A. gossypii, and this could explanation the shorten duration of nymph stages in the SulR strain to some extent. Similarly, the overexpression of EcR and USP were also observed in a thiamethoxam resistant strain of A. gossypii that just developed a 13.79-fold resistance to thiamethoxam (Wu et al., 2018). Vitellogenin (Vg) is a very important reproduction-related protein, which is traditionally considered to be an adequate parameter for evaluating female fertility in insects (Zhao et al., 2018; Li et al., 2010). For example, the decreased expression of Vg was found have negative impacts on the fecundity of Chilo suppressalis (Huang et al., 2016) and the downregulation of Vg by sulfoxaflor has a negative effect on the fecundity of A. lucorum (Zhen et al., 2018). Our result demonstrated that the mRNA expression level of Vg was significantly reduced in the SulR strain compared with the susceptible strain (Fig. 5). Combining with the fact that the fecundity of the SulR strain was significantly lower than that of the susceptible strain (Table 3), suggesting that the downregulation of Vg in sulfoxaflor resistant strain might significantly influence the fecundity of A. gossypii. In conclusion, there is a fitness costs associated with sulfoxaflor
Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 31330064, 31801760) and China Postdoctoral Science Foundation (No. 2018 M630229). References Abbas, N., Shah, R.M., Shad, S.A., Azher, F., 2016. Dominant fitness costs of resistance to fipronil in Musca domestica Linnaeus (Diptera: Muscidae). Vet. Parasitol. 226, 78–82. Babcock, J.M., Gerwick, C.B., Huang, J.X., Loso, M.R., Nakamura, G., Nolting, S.P., Rogers, R.B., Sparks, T.C., Thomas, J., Watson, G.B., Zhu, Y., 2011. Biological characterization of sulfoxaflor, a novel insecticide. Pest Manag. Sci. 67, 328–334. Blackman, R.L., Eastop, V.F., 1984. Aphids on the world's Crops: An Identification Guide. John Wiley and Sons, NY. Chen, X.W., Ma, K.S., Li, F., Liang, P.Z., Liu, Y., Guo, T.F., Song, D.L., Desneux, N., Gao, X.W., 2016. Sublethal and transgenerational effects of sulfoxaflor on the biological traits of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae). Ecotoxicology 25, 1841–1848. Chen, X.W., Tie, M.Y., Chen, A.Q., Ma, K.S., Li, F., Liang, P.Z., Liu, Y., Song, D.L., Gao, X.W., 2017a. Pyrethroid resistance associated with M918 L mutation and detoxifying metabolism in Aphis gossypii from Bt cotton growing regions of China. Pest Manag. Sci. 73, 2353–2359. Chen, X.W., Li, F., Chen, A.Q., Ma, K.S., Liang, P.Z., Liu, Y., Song, D.L., Gao, X.W., 2017b. Both point mutations and low expression levels of the nicotinic acetylcholine receptor beta1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China. Pestic. Biochem. Physiol. 141, 1–8. Chi, H., 1988. Life-table analysis incorporating both sexes and variable development rates among individuals. Environ. Entomol. 17, 26–34. Chi, H., 2018. TWOSEX-MS Chart: A Computer Program for the Age-Stage, Two-Sex Life Table Analysis. http://140.120.197.173/Ecology/, Accessed date: 25 September 2018. Chi, H., Liu, H., 1985. Two new methods for the study of insect population ecology. Bull. Inst. Zool Academia Sinica 24, 225–240. Cui, L., Wang, Q., Qi, H., Wang, Q., Yuan, H., Rui, C., 2018. Resistance selection of indoxacarb in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae): cross-resistance,
45
Pesticide Biochemistry and Physiology 158 (2019) 40–46
K. Ma, et al. biochemical mechanisms and associated fitness costs. Pest Manag. Sci. 74, 2636–2644. Efron, B., Tibshirani, R.J., 1993. An introduction to the bootstrap. J. Great Lakes Res. 20, 1–6. Fu, B., Li, Q., Qiu, H., Tang, L., Zeng, D., Liu, K., Gao, Y., 2018. Resistance development, stability, cross-resistance potential, biological fitness and biochemical mechanisms of spinetoram resistance in Thrips hawaiiensis (Thysanoptera: Thripidae). Pest Manag. Sci. 74, 1564–1574. Gassmann, A.J., Carriere, Y., Tabashnik, B.E., 2009. Fitness costs of insect resistance to Bacillus thuringiensis. Annu. Rev. Entomol. 54, 147–163. Germano, M.D., Picollo, M.I., 2015. Reproductive and developmental costs of deltamethrin resistance in the Chagas disease vector Triatoma infestans. J. Vector Ecol. 40, 59–65. Groters, F.R., Tabashnik, B.E., Finson, N., Johnson, M.W., 1994. Fitness costs of resistance to Bacillus thuringiensis in the diamondback moth (Plutella xylostella). Evolution 48, 197–201. Hill, R.J., Billas, I.M., Bonneton, F., Graham, L.D., Lawrence, M.C., 2013. Ecdysone receptors: from the Ashburner model to structural biology. Annu. Rev. Entomol. 58, 251–271. Huang, Y.B., Chi, H., 2013. Life tables of Bactrocera cucurbitae (Diptera: Tephritidae): with an invalidation of the jackknife technique. J. Appl. Entomol. 137, 327–339. Huang, L., Lu, M., Han, G., Du, Y., Wang, J., 2016. Sublethal effects of chlorantraniliprole on development, reproduction and vitellogenin gene (CsVg) expression in the rice stem borer, Chilo suppressalis. Pest Manag. Sci. 72, 2280–2286. Huang, H.W., Chi, H., Smith, C.L., 2018. Linking demography and consumption of Henosepilachna vigintioctopunctata (Coleoptera: Coccinellidae) fed on Solanum photeinocarpum (Solanales: Solanaceae): with a new method to project the uncertainty of population growth and consumption. J. Econ. Entomol. 111, 1–9. Kliot, A., Ghanim, M., 2012. Fitness costs associated with insecticide resistance. Pest Manag. Sci. 68, 1431–1437. Li, T.W., Gao, X.W., Zheng, B.Z., Liang, P., 2000. Study on genetics of avermectins resistance and population fitness in Plutella xylostella. Acta Entomol. Sin. 43, 255–263. Li, J., Huang, J., Cai, W., Zhao, Z., Peng, W., Wu, J., 2010. The vitellogenin of the bumblebee, Bombus hypocrita: studies on structural analysis of the cDNA and expression of the mRNA. J. Comp. Physiol. B. 180, 161–170. Li, X., Wan, Y., Yuan, G., Hussain, S., Xu, B., Xie, W., Wang, S., Zhang, Y., Wu, Q., 2017. Fitness trade-off associated with spinosad resistance in Frankliniella occidentalis (Thysanoptera: Thripidae). J. Econ. Entomol. 110, 1755–1763. Li, K., Jia, Q.Q., Li, S., 2018. Juvenile hormone signaling - a mini review. Insect Sci. 00, 1–7. https://doi.org/10.1111/1744-7917.12614. Liao, X., Mao, K., Ali, E., Zhang, X., Wan, H., Li, J., 2017. Temporal variability and resistance correlation of sulfoxaflor susceptibility among Nilaparvata lugens. Crop Prot. 102, 141–146. Liao, X., Jin, R., Zhang, X., Ali, E., Mao, K., Xu, P., Li, J., Wan, H., 2018. Characterization of sulfoxaflor resistance in the brown planthopper, Nilaparvata lugens (Stal). Pest Manag. Sci. https://doi.org/10.1002/ps.5282. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. Ma, K.S., Li, F., Liang, P.Z., Chen, X.W., Liu, Y., Gao, X.W., 2016. Identification and validation of reference genes for the normalization of gene expression data in qRT-PCR analysis in Aphis gossypii (Hemiptera: Aphididae). J. Insect Sci. 16, 1–9. Ma, K.S., Li, F., Liu, Y., Liang, P.Z., Chen, X.W., Gao, X.W., 2017. Identification of microRNAs and their response to the stress of plant allelochemicals in Aphis gossypii (Hemiptera: Aphididae). BMC Mol. Biol. 18, 5. Moores, G.D., Gao, X.W., Denholm, I., Devonshire, A.L., 1996. Characterisation of insensitive acetylcholinesterase in insecticide-resistant cotton aphids, Aphis gossypii
Glover (Homoptera: Aphididae). Pestic. Biochem. Physiol. 56, 102–110. Sparks, T.C., DeBoer, G.J., Wang, N.X., Hasler, J.M., Loso, M.R., Watson, G.B., 2012. Differential metabolism of sulfoximine and neonicotinoid insecticides by Drosophila melanogaster monooxygenase CYP6G1. Pestic. Biochem. Physiol. 103, 159–165. Spindler, K.D., Honl, C., Tremmel, C., Braun, S., Ruff, H., Spindler-Barth, M., 2009. Ecdysteroid hormone action. Cell. Mol. Life Sci. 66, 3837–3850. Steinbach, D., Moritz, G., Nauen, R., 2017. Fitness costs and life table parameters of highly insecticide-resistant strains of Plutella xylostella (L.) (Lepidoptera: Plutellidae) at different temperatures. Pest Manag. Sci. 73, 1789–1797. Sun, L.J., Zhou, X.G., Zhang, J., Gao, X.W., 2005. Polymorphisms in a carboxylesterase gene between organophosphate-resistant and -susceptible Aphis gossypii (Homoptera: Aphididae). J. Econ. Entomol. 98, 1325–1332. Tabbabi, A., Daaboub, J., 2018. Fitness cost in field Anopheles labranchiae populations associated with resistance to the insecticide deltamethrin. Rev. Bras. Entomol. 62, 107–111. Wang, R., Wu, Y., 2014. Dominant fitness costs of abamectin resistance in Plutella xylostella. Pest Manag. Sci. 70, 1872–1876. Wang, K.Y., Liu, T.X., Yu, C.H., Jiang, X.Y., Yi, M.Q., 2002. Resistance of Aphis gossypii (Homoptera: Aphididae) to fenvalerate and imidacloprid and activities of detoxification enzymes on cotton and cucumber. J. Econ. Entomol. 95, 407–413. Wang, W., Wang, S., Han, G., Du, Y., Wang, J., 2017. Lack of cross-resistance between neonicotinoids and sulfoxaflor in field strains of Q-biotype of whitefly, Bemisia tabaci, from eastern China. Pestic. Biochem. Physiol. 136, 46–51. Wang, Z.H., Gong, Y.J., Chen, J.C., Su, X.C., Cao, L.J., Hoffmann, A.A., Wei, S.J., 2018. Laboratory selection for resistance to sulfoxaflor and fitness costs in the green peach aphid Myzus persicae. J. Asia Pac. Entomol. 21, 408–412. Wu, K.M., Guo, Y.Y., 2005. The evolution of cotton pest management practices in China. Annu. Rev. Entomol. 50, 31–52. Wu, K.M., Liu, Q.X., 1994. Some biological characteristics of cotton aphid strain resistant to fenvalerate. Acta Entomol. Sin. 37, 137–144. Wu, Y., Xu, H., Pan, Y., Gao, X., Xi, J., Zhang, J., Shang, Q., 2018. Expression profile changes of cytochrome P450 genes between thiamethoxam susceptible and resistant strains of Aphis gossypii Glover. Pestic. Biochem. Physiol. 149, 1–7. Yan, T., Chen, H., Sun, Y., Yu, X., Xia, L., 2016. RNA interference of the ecdysone receptor genes EcR and USP in grain aphid (Sitobion avenae F.) affects its survival and fecundity upon feeding on wheat plants. Int. J. Mol. Sci. 17, 2098. Yu, N., Tian, J., Zhang, Y., Li, Z., Liu, Z., 2018. Imidacloprid-susceptible Nilaparvata lugens individuals exceeded resistant individuals in a mixture population with density pressure. Pest Manag. Sci. 74, 234–239. Zhang, X.L., Mao, K.K., Liao, X., He, B.Y., Jin, R.H., Tang, T., Wan, H., Li, J.H., 2018. Fitness cost of nitenpyram resistance in the brown planthopper Nilaparvata lugens. J. Pest Sci. 91, 1145–1151. Zhao, J., Sun, Y., Xiao, L., Tan, Y., Jiang, Y., Bai, L., 2018. Vitellogenin and vitellogenin receptor gene expression profiles in Spodoptera exigua are related to host plant suitability. Pest Manag. Sci. 74, 950–958. Zhen, C.A., Miao, L., Gao, X.W., 2018. Sublethal effects of sulfoxaflor on biological characteristics and vitellogenin gene (AlVg) expression in the mirid bug, Apolygus lucorum (Meyer-Dür). Pestic. Biochem. Physiol. 144, 57–63. Zheng, B.Z., Gao, X.W., Wang, Z.G., Liang, T.T., Cao, B.J., Gao, H., 1989. Resistant mechanism of organophosphorous and carbamate insecticides in Aphis gossypii Glov. Acta Phytophylacica Sinica 16, 131–138. Zhu, Y., Loso, M.R., Watson, G.B., Sparks, T.C., Rogers, R.B., Huang, J.X., Gerwick, B.C., Babcock, J.M., Kelley, D., Hegde, V.B., Nugent, B.M., Renga, J.M., Denholm, I., Gorman, K., DeBoer, G.J., Hasler, J., Meade, T., Thomas, J.D., 2011. Discovery and characterization of sulfoxaflor, a novel insecticide targeting sap-feeding pests. J. Agric. Food Chem. 59, 2950–2957.
46