Five hydrophobin genes in Fusarium verticillioides include two required for microconidial chain formation

Fungal Genetics and Biology 41 (2004) 852–864 www.elsevier.com/locate/yfgbi

Five hydrophobin genes in Fusarium verticillioides include two required for microconidial chain formation Uta Fuchs,a Kirk J. Czymmek,b and James A. Sweigardc,* a

Max-Planck Institute for Terrestrial Microbiology, Karl-von-Frisch-Strasse, D-35043 Marburg, Germany b Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA c DuPont Experimental Station P.O. Box 80402, Wilmington, DE 19880-0402, USA Received 26 December 2003; accepted 27 April 2004 Available online 28 May 2004

Abstract Five hydrophobin genes have been identified in the fungal corn pathogen Fusarium verticillioides. HYD1, HYD2, and HYD3 encode Class I hydrophobins. The predicted structures of Hyd1p and Hyd2p are 80% similar, while Hyd3p has an unusually small number of amino acids between the third and fourth cysteines. HYD4 and HYD5 encode Class II hydrophobins. Mutants with HYD1-5 individually deleted and a hyd1Dhyd2D double mutant were similar to wild-type strains in the amount of disease caused in a corn seedling infection assay and in the number of microconidia produced. Microconidial chains were rare in hyd1D and hyd2D mutants as microconidia were present almost exclusively as false heads. Transformation of hyd1D and hyd2D mutants with HYD1 and HYD2, respectively, restored microconidial chain formation, but transformation with HYD1::AcGFP and HYD2::AcGFP did not complement the mutation. HYD1::AcGFP and HYD2::AcGFP localized to the outside of conidia in false heads and in chains. Ó 2004 Elsevier Inc. All rights reserved. Index Descriptors: Hydrophobin; Fusarium verticillioides; Microconidia

1. Introduction Hydrophobins, a group of small secreted proteins found ubiquitously in the filamentous fungi, are characterized by distinct hydropathy profiles and by the spacing of eight cysteines in the pattern X-C-X-CC-XC-X-C-X-CC-X-C-X. They are often highly expressed at specific points in fungal development (Munoz et al., 1997; Nakari-Setala et al., 1997; Segers et al., 1999; Stringer et al., 1991; Talbot et al., 1993; Wessels, 1992). Hydrophobins assemble into highly stable amphipathic bilayers which cover the surface of hyphae and conidia. For example, Sc3, a well-studied hydrophobin of Schizophyllum commune, was found to self-assemble at air–water interfaces, allowing the fungal hyphae to emerge into the air protected by the hydrophobin layer (W€ osten et al., 1994; Zangi et al., 2002). Additionally, it * Corresponding author. Fax: 1-302-695-4509. E-mail address: [email protected] (J.A. Sweigard).

1087-1845/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2004.04.004

was shown that Sc3 influences the cell wall composition in S. commune (van Wetter et al., 2000b). Hydrophobin assemblages also form rodlet layers on the outside of some fungal conidia (Beever and Dempsey, 1978; BellPedersen et al., 1992; Claverie-Martin et al., 1986; Paris et al., 2003; Talbot et al., 1996; W€ osten et al., 1993). Further functional characterization of hydrophobins has shown that some of them play a role in conidiogenesis (Talbot et al., 1996), spore dispersal (Stringer et al., 1991; Whiteford and Spanu, 2001), the maintenance of air channels in fruiting bodies and lichen thalli (Asgeirsdottir et al., 1998; Lugones et al., 1999; Scherrer et al., 2000; Trembley et al., 2002; van Wetter et al., 2000a) as well as for mycorrhiza formation (Mankel et al., 2002; Tagu et al., 2001). Studies with pathogenic fungi led to the suggestion that hydrophobins may be important in fungal–host interactions. In the human pathogen Aspergillus fumigatus a hydrophobin, RodAp, helps confer resistance to killing by host aveolar macrophages (Paris et al., 2003).

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

The rice blast fungus Magnaporthe grisea was shown to require the hydrophobin gene MPG1 for appressorium formation and function (Talbot et al., 1993). The hydrophobin cerato-ulmin of the Dutch Elm disease pathogen Ophiostoma ulmi contributes to disease development as a parasitic fitness factor (Temple et al., 1997). Hydrophobin mutations in the tomato pathogen Cladosporium fulvum, on the other hand, do not result in an altered ability of the mutant strains to cause disease (Whiteford and Spanu, 2001). Fusarium verticillioides (Sacc.) Nirenberg (syn. F. moniliforme Sheldon) is a systemic pathogen of corn (Zea mays L.). The fungus has a major economic impact on corn production world-wide by causing seedling blight, root and stalk rot as well as ear mold on corn (White, 1999). Of particular concern is the production of the mycotoxin fumonisin which has been linked to several animal toxicoses and to human esophageal cancer in regions where large amounts of contaminated grain are consumed (Bacon and Nelson, 1994; Desjardins et al., 2000; Gelderblom et al., 1988, 2001; Munkvold and Desjardins, 1997). The fungus grows as haploid mycelia and propagates vegetatively via hyphal elongation and production of two kinds of spores, macroconidia and microconidia. Macroconidia arise from macroconidiophores which are branched and unbranched monophialides. The unicellular and uninucleate microconidia arise from long conidial chains and false heads. Like macroconidia, microconidia also arise from branched and unbranched monophialides (Nelson, 1992). Here, we describe the identification and characterization of five hydrophobin genes in F. verticillioides.

Individual deletion of the five hydrophobin genes indicates that none are required for virulence in a corn seedling infection assay but that HYD1 and HYD2 are required for microconidial chain formation.

2. Materials and methods 2.1. Fungal strains, culture conditions, and transformation All strains used in this study are listed in Table 1. Fusarium moniliforme wild-type strains were obtained from the Fusarium Research Center (FRC) culture collection at Penn State University. M-3125 (our designation, Fvd80) was used as a wild-type strain in these studies. M-8114 (Fvd1) was used as a source of RNA for cDNA libraries and DNA for plasmid libraries. Fungal cultures were maintained on YEX agar medium (2 g xylose and 2 g yeast extract/L) and complete medium (10 g glucose/L, 6 g yeast extract/L, and 6 g casamino acids/L). Aspergillus minimal agar medium (K€afer, 1977), which contains glucose (10 g/L) as a carbon source and nitrate (4.3 g/L) as a nitrogen source, was also used for strain maintenance. Aspergillus minimal and a modified Aspergillus minimal (0.5 g glucose/L, 0.5
salts, and 10 g KCl/L) were used for characterization of conidiation. Transformation for generation of ectopic transformants of marker genes (e.g., green fluorescent proteins) was performed by LiOAc transformation of linear DNA into conidia (Bourett et al., 2002). Transformation for generation of gene disruption mutants was performed with circular DNA using protoplasts as described

Table 1 Fungal strains used in this study Name

Description/reference

Fvd1 (M-8114)

Wild-type F. verticillioides strain used for cDNA library and genomic library construction; Fusarium Research Center, Penn State University Wild-type F. verticillioides strain used for all experiments hyd1D mutant constructed by homologous recombination with pSM839 hyd1D::HygR Ectopic integration of of pSM839 hyd1D::HygR hyd2D mutant constructed by homologous recombination with pSM834 (hyd2D::HygR) Ectopic integration of pSM834 (hyd2D::HygR) hyd3D mutant constructed by homologous recombination with pSM859 (hyd3::HygR) ectopic integration of of pSM859 (hyd3::HygR) hyd4D mutant constructed by homologous recombination with pSM836 (hyd4D::HygR) Ectopic integration of of pSM837 (hyd4::HygR) hyd5D mutant constructed by homologous recombination with pSM937, pSM938, respectively, (hyd5::HygR) ectopic integration of of pSM938 (hyd5::HygR) hyd1D hyd2D double mutant constructed by homologous recombination of pSM987 and pSM988, respectively, hyd1D::GenR in Fvd 170 ectopic integration of pSM987 in Fvd 170 Fvd164 transformed with pSM1112 and pSM1113 (HYD1, GenR) Fvd174 transformed with pSM1114 and pSM1115 (HYD2, GenR) Fvd164 transformed with pSM1118 HYD1::AcGFP, GenR Fvd174 transformed with pSM1122 HYD2::AcGFP, GenR Fvd80 transformed with pSM1118 HYD1::AcGFP, GenR Fvd80 transformed with pSM1122 HYD2::AcGFP, GenR

Fvd80 (M-3125) Fvd164, 165 Fvd168 Fvd170, 174 Fvd173 Fvd175, 176 Fvd177 Fvd180, 181 Fvd185 Fvd196, 198 Fvd197 Fvd300, 302 Fvd 301 Fvd356, 358 Fvd365, 368 Fvd389 Fvd395 Fvd397 Fvd400

853

854

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

(Proctor et al., 1999). All transformants were purified by single spore isolation. To distinguish transformants with a double crossover, homologous gene replacement from those with an ectopic integration event, transformants were initially screened directly from the transformation plate by colony PCR with primers pSM47-1 and pSM47-2 which amplify vector sequences (all primers are listed in Table 3). The absence of vector sequence amplification suggested a double recombination event. After single spore isolation, transformants with a putative gene replacement event were rescreened by PCR with primers flanking the recombination points. 2.2. Bioinformatics Genomic DNA sequence has been deposited in GenBank: FvHYD1 (AY155496), FvHYD2 (AY155497), FvHYD3 (AY155498), FvHYD4 (AY155499), FvHYD5 (AY158024). Complete genome sequences of Fusarium graminearum, M. grisea, and N. crassa were searched at the Whitehead Institute fungal genome site (http:// www.genome.wi.mit.edu/annotation/fungi/fgi/). Identification of signal peptides to predict mature secreted hydrophobins was performed using SignalP (http:// www.cbs.dtu.dk/services/SignalP/). Multiple protein sequence alignments were made with ClustalW (http:// www.ebi.ac.uk/servicestmp/clustalw).

Table 2 Plasmids used in this studya pSM47

GenBank, backbone plasmid for genomic clones

pSM334

Contains Cochliobolus heterostrophus glyceraldehyde 3-phosphate dehydrogenase promoter fused to geneticin resistance gene Contains Cochliobolus heterostrophus glyceraldehyde 3-phosphate dehydrogenase promoter fused to hygromycin resistance gene GenR equivalent of pSM565 HYD1 cDNA HYD2 cDNA HYD3 cDNA HYD4 cDNA HYD1 genomic clone from k75 library HYD2 genomic clone from k75 library HYD3 genomic clone from k75 library HYD4 genomic clone from k75 library HYD5 genomic clone HYD1 gene replacement vector; HygR HYD2 gene replacement vector; HygR HYD3 gene replacement vector; HygR HYD4 gene replacement vector; HygR HYD5 gene replacement vector; HygR HYD1 gene replacement vector; GenR HYD1 complementation vector, GenR HYD2 complementation vector, GenR HYD1::AcGFP HYD2::AcGFP

pSM565

pSM568 pSM757 pSM758 pSM759 pSM760 pSM788 pSM790 pSM794 pSM798 PSM847 pSM839 pSM834 pSM859 pSM836, 837 pSM937, 938 pSM987 pSM1112, 1113 pSM1114, 1115 pSM1118 pSM1122 a

All plasmids confer ampicillin resistance in E. coli.

2.3. Plasmid and library construction 2.3.1. cDNA and genomic libraries Hydrophobin genes were identified as expressed sequence tags in sequencing projects at DuPont Crop Genetics, Newark, DE. cDNA libraries were constructed by ligating cDNA with EcoRI/XhoI linkers into pBlueScript II SK+ (Stratagene, La Jolla, CA) and were sequenced from the 50 end. Genomic lambda excision libraries were constructed in k75, a lambda replacement vector which allows cre-lox excision of a plasmid containing genomic inserts. This lambda vector was based on pSM47 (GenBank AY456754) and k Fix II (Stratagene, La Jolla, CA). A 4.6 kb XhoI fragment from Adenovirus-2 (corresponding to nucleotides 19331–23924) was cloned into the XhoI site of pSM47 to produce pSM75. This fragment served as a stuffer fragment for the lambda vector. XhoI-digested k Fix II and SalI-digested pSM75 were ligated, packaged, and plated on Escherichia coli to produce k75. Lambda libraries were generated in k75 with Sau3AI-partially digested genomic DNA using instructions provided by the manufacturer for k Fix II library construction. 2.3.2. Gene replacement vectors Plasmid constructs are listed in Table 2. To make gene replacement vectors, genomic clones containing HYD1-5 were isolated from the k Fix II library by hy-

bridization using cDNA (HYD1-4) or a small (1 kb) fragment of genomic DNA (HYD5) as the probe. Plasmids were excised and the genomic DNA sequence of the hydrophobin genes was determined. Since the excised plasmid contained a yeast origin of replication and a yeast selectable marker (TRP1), genomic plasmids could be modified by gap repair in yeast as described (Bourett et al., 2002). Primers were designed to allow construction of gene replacement vectors in yeast by gap repair whereby the hygromycin resistance gene of pSM565 (GenBank AY142483) replaced the hydrophobin gene. This replacement included about 300 bp of promoter sequence, the hydrophobin coding region, and about 100 bp of the terminator region. (For HYD3, 2 kb upstream of the HYD3 gene was removed.) Gene replacement vectors for HYD2, HYD3, HYD4 were constructed in yeast by gap repair. Yeast was transformed to tryptophan prototrophy with the genomic plasmid linearized within the hydrophobin region and with the amplified hygromycin resistance gene containing homology to the hydrophobin gene. Gene replacement vectors for HYD1 and HYD5 were constructed in yeast by without linearization (‘‘gapping’’) of the genomic plasmid. HYD1 and HYD5 were transformed with circular plasmid and with the amplified hygromycin resistance gene containing homology to the hydrophobin

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

855

Table 3 Primers used in this study Primer pairs

Primer purpose

Primer sequence

HYD1e; HYD1f

Amplification of HygR cassette for construction of HYD1 replacement vector pSM839

HYD1g; HYD1h HYD2e; HYD2f HYD2g; HYD2h HYD3e; HYD3f

Verification of homologous recombination of HYD1 replacement Amplification of HygR cassette for construction of HYD2 replacement vector pSM834 Verification of homologous recombination of HYD2 replacement Amplification of HygR cassette for construction of HYD3 replacement vector pSM859,

GCTTAACTTTCCTGAGAATGTGTCTCCGCGGCTTCG; GACGGTCGCCCAAGAACACGAAGATCATCATGCAACA TGCATG GTAAATGATCCCAGAACC; CAGGCAATGGAACTTGAC

HYD3g; HYD3h HYD4e: HYD4f

HYD5g; HYD5h HYD1Kpn; HYD1Bam HYD2Kpn; HYD2Bam HYD1AcGFP; AcGFPterm

Verification of homologous recombination of HYD3 replacement Amplification of HygR cassette for construction of HYD4 replacement vector pSM836, pSM837 Verification of homologous recombination of HYD4 replacement Amplification of HygR cassette for construction of HYD5 replacement vector pSM937, pSM938 Verification of homologous recombination of HYD5 replacement Amplification of HYD1 for complementation vector pSM1112 and pSM1113 Amplification of HYD2 for complementation vector pSM1114 and pSM1115 Amplification of AcGFP for construction of HYD1::AcGFP in pSM1118

HYD2AcGFP; AcGFPterm

Amplification of AcGFP for construction of HYD2::AcGFP in pSM1122

pSM47-1; pSM47-2 ComproDual1; comterm HygTest2; newhygtest1 607; 899

Edge of pSM47; to verify integration;

Amplification of GenR from pSM568

424-1; 424-2

Amplification of pRS424

HYD4g; HYD4h HYD5e; HYD5f

Geneticin compro For amplifying HygR

gene followed by selection for hygromycin resistance in yeast on SC medium lacking tryptophan (Sherman, 1991) and supplemented with 500 lg hygromycin/ml. To make a hyd1D mutant in a hyd2::HygR strain, a geneticin resistance (GenR) version of hyd1::HygR gene replacement plasmid pSM839 was made. 2.3.3. HYD1 and HYD2 complementation vector and AcGFP fusions To complement the hyd1::HygR and the hyd2::HygR mutants with both wild-type hydrophobin genes and with wild-type hydrophobin genes fused to AcGFP, a GenR plasmid, pSM1037, was constructed as follows. Plasmid pRS424 (Sikorski and Hieter, 1989) was amplified with

GGTGAAGCTACTAGTTATGCAACTCCGCGGCTTCG; GACCTCTAGTTCCAGCAAGTATCATCATGCAACATGCATG CATTCCTTAAGACAGACC; GCAACACCTGAAGATAAAATC GTGATCGCCCCGAGTTCCGCTGCTCCGCGGCTTCG; GGTCATCGAAGTAATACAAACATCATCATGCAACAT GCATG CTAACAGACACAGACCG; CTGTATGTATATTCAACCTC AGAAGCATTCCAAGCTTCAACCTCCGCGGCTTCG; TTGATTTTGCTACCTTAATCATCATGCAACATGCATG GTGGGCGATGCAGAG; GTGGCGAAAGATAACTG GTTTGGATTTTGTATAAATATGGGGATCCGCGGCTTCG; TCCCCAGCACTTGTCATATCATAATCCATCTTTTATTAA AACACTGTAACC CTTAATGATTTATGGGATC; TAATAGAAAAGGAACGA TCCAGTC GCTAGTAGGTACCTAGCAGAATGGAGG; ATGTTTGGATCCCGCGAAATGATATGATTGAGTG ACTAAGGGTACCTAAATCAGGTGATCGCTTG; GTCATGGATCCGATTCTCTGTGCCGGAATAAG GCTCTCAGCAGCCTTATCGCCGCTATGGTGAGCAAG GGCGCCG; GCGGCCGCTCTAGAACTAGTGGATCCGTATTA AGAGTATAGGGGTCAAC GCTATCAGCAACCTTGTTGCCGCTATGGTGAGCAAGG GCGCCG; GCGGCCGCTCTAGAACTAGTGGATCCGTATT AAGAGTATAGGGGTCAAC GGCCAAGAGGGAGGGCATTGG; CCAACCAAGTATTTC GGAGTGCCTG AGGAACCCAATCTTCAAAATGATTGAACAAGATGGA; AATGTTGAGTGGAATGATTCAGAAGAACTCGTCAAG CGGGCAGTTCGGTTTCAGGCA; GCGACGTCTGTCGA GAAGTTTCTGATCG GAGAGGATCCGCGGCTTCGAATCGTGGC; AAAAAGG ATCCTCAGAAGAACTCGTCAAG AAATTTAGATCTCGCGCTTAATGCGCCGCTACAG; AAATTTAGATCTCCGTCATCACCGAAACGCGCGA

primers 424-1 and 424-2 to eliminate the TRP1 gene and to introduce a BglII site. The fragment was digested with BglII and then ligated to make intermediate construct pSM1034. The GenR gene of pSM568 was then amplified by PCR with primers 607 and 899, which introduced terminal BamHI sites. This PCR fragment was digested with BamHI and ligated to BglII-digested pSM1034 to produce pSM1037. HYD1 and HYD2 were amplified with primers HYD1Kpn and HYD1Bam, and, HYD2Kpn and HYD2Bam respectively, and cloned into pCR2 (InVitrogen, Carlsbad, CA). These fragments were removed as BamHI XhoI fragments and cloned into pSM1037 digested with BamHI and XhoI to produce pSM1112 (HYD1) and pSM1115 (HYD2).

856

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

To produce fusions of the fluorescent protein AcGFP (BD Biosciences Clontech, Palo Alto, CA), the AcGFP gene was amplified and fused to the C-terminus of the hydrophobin genes by gap repair into BamHI-digested pSM1112 and pSM1113 (HYD1) as well as pSM1114 and pSM1115 (HYD2) to produce pSM1118 and pSM1122, respectively. 2.4. Nucleic acids methods Genomic DNA and RNA were isolated as described previously (Proctor et al., 1999). DNA gel electrophoresis, ligation, restriction digests, hybridization, and sequencing were performed using standard methods (Ausubel et al., 1993). 2.5. Corn seedling assay Corn seeds (Zea mays, var. Silver Queen; JohnnyÕs Selected Seeds, Albion, ME) were placed in sterile Erlenmeyer flasks, covered with Tween/sterile water (one drop of Tween 20/100 ml) shaken for 3 min at 70 rpm. The water was decanted and the seeds covered with undiluted commercial bleach for 10 min with shaking at 70 rpm. The bleach was decanted and the seeds washed twice with a large volume of water. The seeds, barely covered with water, were incubated for 4 h at 28 °C. After this incubation the water was decanted, the seeds covered with 60 °C water, and placed in a water bath for 4 min at 60 °C. The hot water was decanted and the seeds covered with 10 ml water (room temperature). Fungal inoculum was prepared by harvesting conidia in water from one week old cultures grown on YEX plates. The number of conidia was determined by counting with a hemacytometer. The seeds were inoculated with a conidial spore suspension of 1
108 conidia in 20 ml H2 O. The flasks with seeds and inoculum were capped, sealed with parafilm, and placed at 28 °C for 48 h and then 4 °C for 48 h. The seeds (20/pot) were then directly planted (1 cm deep) in potting mix (Metro Mix 360, Scotts-Sierra Horticultural Products Company, Marysville, OH) in 4 inch square pots and watered well. Each treatment (fungal strain) was tested in four separate pots. The pots were kept in a plastic container at 22 °C at a 16 h light, 8 h dark cycle. After 10 days the plants were cut at the soil line and total fresh weight was determined.

BIO Stereo Microscope (Carl Zeiss, Germany) equipped with a HR 10
(NA 0.45) long focal length lens. Digitized images were collected in black-and-white mode with a Zeiss Axiocam CCD camera. 3.2. Confocal microscopy Agar squares were removed from actively growing colonies and placed in a humidified single-well coverglass chamber (Lab-Tek II chambered #1.5 coverglass, Nalge/Nunc International, Naperville, IL) with the fungal colony surface oriented perpendicular to the coverslip. This allowed the direct visualization of living conidial chains without immersion in water or buffer, thus minimizing any disturbance in conidial growth patterns. Confocal images were acquired on a Zeiss Axiovert 200 equipped with a Zeiss LSM 510 NLO laser scanning microscope (Carl Zeiss, Germany) using a Zeiss 20
Plan-Apochromat (NA 0.75) objective lens. All data were collected using the 488 nm laser line of a 25 mW Argon laser (LASOS, Germany) with a 505LP emission filter for fluorescence and the transmitted-light channel when appropriate. Images were captured as single optical sections (2-D) or a z-series of optical sections (3-D). For renderings, 3-D data sets were displayed as single maximum intensity projections generated using Zeiss LSM software v3.2. 3.3. Cryo scanning electron microscopy Fungal colonies grown on Aspergillus minimal agar medium were excised, mounted onto a sample holder that was coated with a thin layer of Tissue-Tek O.C.T. Compound (Cat # R1180, Agar Scientific), plunged into a liquid nitrogen slush and transferred under vacuum to the Gatan Alto (Gatan, Pleasanton, CA) specimen preparation chamber. Frozen samples were then warmed to )95 °C for 10 min to remove surface water and reveal underlying structure in a frozen hydrated state. Etched samples were transferred to the cryo-stage and viewed uncoated on a Hitachi S-4700 FESEM (Tokyo, Japan) at )120 °C and 0.7 kV (emission current 10 lA) with a working distance of approximately 6– 7 mm. All images were directly captured into a digital format with 128 frame averages.

4. Results 3. Microscopy

4.1. Fusarium verticillioides has at least five hydrophobin genes

3.1. Stereo microscopy Fungal cultures grown on Aspergillus minimal or modified Aspergillus minimal agar medium were imaged using low magnification transmitted light on a Zeiss M2

Sequencing of cDNA libraries identified 4 F. verticillioides hydrophobins. HYD1-3 were discovered in a library made from mycelium grown for 8 days in liquid Aspergillus minimal medium without shaking. Under

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

these conditions the fungus produced submerged hyphae and a mat of mycelium on the surface, which included abundant chains of microconidia. Among 4277 sequences examined, 2.2, 1.5, and 0.02% of all messages were HYD1, HYD2, and HYD3, respectively. HYD4 was found in a library made from ungerminated microconidia freshly harvested from an oatmeal agar plate. Among 2747 sequences HYD4 represented 0.91% of all sequences, while HYD2 was 0.1%. HYD5 was discovered in random genomic sequence (about 38 Mb or 1
genome coverage), but has not been found in expression libraries.

857

The spacing of amino acids between the predicted disulfide bonds suggested that HYD1, HYD2, and HYD3 encode Class I hydrophobins and suggested that HYD4 and HYD5 encode Class II hydrophobins (Fig. 1A) (Wessels, 1994). To find related hydrophobins, we searched GenBank and the complete genomes of F. graminearum, M. grisea, and Neurospora crassa. Hyd1p and Hyd2p were much more closely related to each other than to any known hydrophobin in other organisms; the predicted mature proteins were 69% identical. Hyd1p and Hyd2p were both next most closely related to the Aspergillus nidulans hydrophobin

Fig. 1. Comparison of Hyd1-5p with other hydrophobins. (A) Spacing of predicted amino acids loops between disulfide bonds formed between the eight cysteines of hydrophobins. Consensus spacing for Class I and Class II hydrophobins taken from Wosten (2001). (B–D) Alignment of the predicted mature forms F. verticillioides hydrophobins with other hydrophobins. Alignments performed with ClustalW. Signal peptide length was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). (B) Class I hydrophobins Hyd1p, Hyd2p and rodAp, and Mpg1p. (C) Hyd3p and a predicted F. graminearum hydrophobin. (D) Class II hydrophobins Hyd4p, Hyd5p, a F. graminearum hydrophobin, a N. crassa hydrophobin (NCU), magnaporin (mp), and cerato-ulmin(cu).

858

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

rodAp, being 47 and 43% identical, respectively. Fig. 1B shows an alignment of the predicted mature forms of Hyd1p, Hyd2p, AnRodAp, and Mpg1p from M. grisea. Hyd3p has the hallmarks of a Class I hydrophobin including a signal peptide, the correct pattern of eight cysteines, and the typical single intron after the second cysteine doublet (data not shown), but in database searches it only showed significant homology to a predicted hydrophobin in F. graminearum (Fig. 1C). The amino acid spacing between the third and fourth cysteine in both of these hydrophobins was unique among Class I hydrophobins (Fig. 1A). Whereas this loop was 17–39 amino acids in other Class I hydrophobins (W€ osten, 2001), it was only 5 amino acids in the F. graminearum hydrophobin and only 4 amino acids in Hyd3p. The amino acid spacing between the cysteines was otherwise typical of Class I hydrophobins. An alignment of Hyd4p and Hyd5p with other Class II hydrophobins is shown in Fig. 1D. The predicted mature form of FvHyd5p was 89 and 72% identical to predicted mature hydrophobins in F. graminearum and N. crassa, respectively. Hyd4p was not highly similar to any known Class II hydrophobins, being most closely related to the predicted N. crassa hydrophobin (41% identical). 4.2. Hydrophobin deletion mutants do not have defects in radial growth, conidial numbers, or corn seedling infection Mutations in hydrophobin genes in other fungi have affected growth (W€ osten et al., 1994), conidiation (Talbot

et al., 1993) and pathogenicity (Stringer and Timberlake, 1993; Talbot et al., 1993). We produced null mutations of HYD1-5 (hyd1-5::HygR) by double crossover gene replacement, removing the entire coding region of each gene. We also produced a hyd1::GenR, hyd2::HygR double mutant. Two gene replacement mutants for each gene were compared to an ectopic integration control strain (Table 4). Colony diameter on Aspergillus minimal medium was measured after 6 days of growth. The colony diameter of all strains was similar. The number of conidia produced by the mutant strains was also determined (Table 4). All conidiated profusely, with all strains producing between 7–11
108 conidia per plate. We concluded that HYD1-5 individually and HYD1 and HYD2 together were not important for radial growth on an agar surface, nor important for the number of microconidia produced on solid medium. Fusarium verticillioides causes ear mold and seedling blight of corn. If corn seeds are infected with the fungus, germination rate, and seedling vigor are reduced. We tested the ability of the hydrophobin mutants to affect both seedling germination and vigor by measuring the fresh weight of seedlings grown from infected seeds (Table 4). Compared to uninoculated seeds, all the strains decreased seedling growth. There was no significant difference between control strains and the hydrophobin mutants. We concluded that HYD1-5 individually and HYD1 and HYD2 together were not important for ability of F. verticillioides to cause seedling disease. In several fungi, deletion of hydrophobin genes has resulted in a reduction in mycelial hydrophobicity

Table 4 Effect of mutation in HYD1-5 on colony diameter, conidial production, and seedling infection Strain Uninoculated seeds Fvd168, hyd1D::HygR ectopic integration Fvd164, hyd1D::HygR gene replacement Fvd165, hyd1D::HygR gene replacement Fvd173, hyd2D::HygR ectopic integration Fvd170, hyd2D::HygR gene replacement Fvd174, hyd2D::HygR gene replacement Fvd177, hyd3D::HygR ectopic integration Fvd175, hyd3D::HygR gene replacement Fvd176, hyd3D::HygR gene replacement Fvd185, hyd4D::HygR ectopic integration Fvd180, hyd4D::HygR gene replacement Fvd181, hyd4D::HygR gene replacement Fvd197, hyd5D::HygR ectopic integration Fvd196, hyd5D::HygR gene replacement Fvd198, hyd5D::HygR gene replacement Fvd301 hyd2D::HygR, hyd1::GenR ectopic integration Fvd300 hyd2D::HygR, hyd1::GenR gene replacement Fvd302 hyd2::HygR, hyd1::GenR gene replacement a

Colony diametera

Conidial numberb

7.7 7.6 7.7 7.7 7.5 7.7 7.8 7.8 8.3 7.6 7.8 7.5 7.6 7.6 7.7 7.5 7.7 7.6

8.8  0.44 7.3  1.1 7.9  1.1 9.5  2.1 12  0.7 9.8  0.5 9.9  1 10.5  1.6 13.2  0.9 9.5  1.3 8.3  0.4 8.7  1.5 10  2.8 8.3  1.9 8.1  1.0 8.7  1.2 10.3  1.1 6.6  0.6

Corn seedling infectionc

Corn seedling infectionc

16.3  2.8 5.2  0.95 5.7  1.3 3.2  0.99 4.7  2.6 4.7  1.5 5.3  2.2

11.2  1.0

2.87  0.78 1.85  1.1 0.43  0.15 1.81  1.16 1.15  0.44 3.14  0.86 2.88  0.8 1.82  0.74 0.71  0.44 4.7  0.97 3.8  0.42 4.1  0.36

Colony diameter (cm) on Aspergillus minimal medium 6 days after inoculation. Average number of microconidia (
108 ) harvested from 3 Aspergillus minimal plates 6 days after inoculation. c Fresh weight (g) of Silver Queen corn seedlings harvested 10 days after planting. The two columns represent independent experiments with each four pots per treatment. b

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

causing an ‘‘easily wettable’’ phenotype. In some cases this phenotype could be readily seen as complete dispersal of water droplet into the mycelium or less dramatically as a reduction in contact angle of the water droplet with the mycelium (Bell-Pedersen et al., 1992; Stringer and Timberlake, 1995; Talbot et al., 1993; Whiteford and Spanu, 2001). We tested for the easily wettable phenotype by placing a water droplet on the mycelial surface of cultures grown on Aspergillus minimal. In all cases a droplet of water remained on the culture surface for more than 12 h (data not shown). We did not attempt to measure the contact angle of these drops. We concluded that the culture surface of F. verticillioides was hydrophobic but that this hydrophobicity does not require HYD1-5 individually or HYD1 and HYD2 together. 4.3. hyd1D and hyd2D have a defect in microconidial chain formation Though the number of conidia produced by hyd1D and hyd2D mutants was similar to wild-type, on several different media (complete medium, oatmeal medium) we

859

observed a change in the pattern of microconidia production. The density of fungal growth on these media, however, made observation of microconidia difficult. We, therefore, limited our observations to cultures grown on Aspergillus minimal and a dilute Aspergillus minimal medium with 10 g KCl/L, based on the observation of that medium containing KCl stimulated microconidial chain formation (Fisher et al., 1983). Low magnification, stereomicroscopic examination of wildtype strains showed abundant microconidial chains and few false heads both on Aspergillus minimal medium (data not shown) and on dilute Aspergillus minimal with KCl (Fig. 2A). Growth of F. verticillioides on both these agar medium included surface and subsurface hyphal growth, individual aerial mycelium undecorated by conidia (Fig. 3A), aerial mycelium containing false heads (arrow heads in Fig. 3A) and/or microconidial chains (arrows in Figs. 3A and B), and coalesced aerial mycelium. The formation of microconidia in chains involved the production of microconidia by monophialides via connection of the microconidia at their truncate base into an extended chain-like formation (Fig. 3B). In addition to chains, microconidia remained in false heads

Fig. 2. Stereo light microscope images of hydrophobin mutants grown on dilute Aspergillus minimal medium with KCl. (A) Chains of microconidia in F. verticillioides wild-type control (Fvd173). (B) Microconidial chains are absent in the hyd1D mutant (Fvd164) instead microconidia assemble in false heads (arrows). (C) In hyd2D mutants (Fvd170) few microconidial chains are present (arrows) as well as false heads. (D) Microconidial chains are absent in the hyd1Dhyd2D double mutant. Bars represent: (A) 24 lm, (B) 10 lm, (C) 40 lm, and (D) 10 lm.

860

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

Fig. 3. FESEM images of control strains with ectopic integration events and hydrophobin mutants grown on Aspergillus minimal medium. (A, B) Microconidial chains and false heads (A only) in an ectopic integration control strain (Fvd 168). (C, D) A hyd1D mutant (Fvd 164) showing conidiophores with attached microconidia and false heads (C) and detail of a false head (D). (E) False heads and microconidial chains (arrows) in a hyd2D mutant (Fvd 170); (F) hyd1Dhyd2D double mutant microconidia (Fvd 300) assembled in false heads. Bars represent: (A, E) 50 lm; (B, D) 10 lm; (C) 40 lm; and (F) 100 lm.

which were ball-shaped assemblages of microconidia held together apparently by a mucilage (Fig. 3D). In constrast to wild-type, the hyd1D mutant almost never produced microconidial chains. Instead hyd1D microconidia remained attached to each other after their production from conidiophores, but they assembled as false heads around the conidiophore instead of connecting in a chain-like formation (arrows in Figs. 2B, 3C and D). Compared to the hyd1D mutant, microconidial chains were more frequent in the hyd2D mutants, but the number of chains was greatly reduced and the chains were shorter compared to control strains with ectopic integration of the disruption vector (arrows Fig. 2C, arrows in Fig. 3E). The remainder of the hyd2 mutant microconidia assembled in false heads (Fig. 3E). In hyd1Dhyd2D double mutants microconidial chains were

not observed; only microconidia in false heads were present (Figs. 2D and 3F). To confirm the microconidial chain defect of the hyd1D and hyd2D mutations, single mutant deletion strains were transformed with the corresponding wildtype hydrophobin gene. Reintroduction of HYD1 and HYD2 complemented the microconidial chain defect and restored the wild-type microconidial chain phenotype (data not shown). 4.4. HYD1::AcGFP and HYD2::AcGFP fusions are expressed at points of conidiation We attempted to study hydrophobin gene expression and to localize the hydrophobin protein by fusing the hydrophobin genes to AcGFP, a monomeric form of

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

GFP from the jellyfish Aequorea coerelescens. As a positive control, AcGFP was constitutively expressed in the cytoplasm, which resulted in intense fluorescence in all fungal structures (Fig. 4A). Transformation of hyd1D and hyd2D single mutants with the corresponding HYD1 or HYD2 fusion construct did not restore wild-type levels of microconidial chain formation (data not shown). However, we did observe the expression of the fusion protein and its localization at specific areas in the mycelial cultures. In hyd2D mutants expressing HYD2::AcGFP, fluorescence was present in the basal cell of the monophialides, but was distinctly absent in the terminal cell of monophialides (Figs. 4B and C). The fusion protein was also present in false heads, being particularly bright within the assemblage at points of contact between microconidia (Figs. 4B, C, and E). In rare microconidial chains observed in hyd2D mutants, fluorescence could be seen along the chain (Fig. 4E). When HYD2::AcGFP was expressed in wild-type strain Fvd80, fluorescence was localized to the junction of individual microconidia (Fig. 4D). Fluorescence from the HYD1::AcGFP fusion protein was, in general, less bright than the HYD2 version when it was transformed into a hyd1 mutant or wild-type. Like the HYD2 fusion construct the HYD1::AcGFP fusion protein also accumulated between the microconidia in false heads. Less intense

861

fluorescence was seen along hyphae and short conidial chains (Figs. 4F and H).

5. Discussion Production of long aerial chains of microconidia is a defining characteristic of F. verticillioides (Nelson, 1992). Our data indicated that two hydrophobin genes were required for the structural integrity of these chains: hyd1D and hyd2D mutants produced far fewer chains of microconidia than control strains. It is not known what determines whether microconidial production from a monophialide will result in a chain of microconidia or a false head. Deletion of HYD1 and HYD2 did not result in a corresponding decrease in the number of conidia, only in the form of the structure in which the conidia were held. Since hyd1D and hyd2D mutants produced the same number of conidia as wildtype and since false heads were very abundant in these mutants, we hypothesize that as chains of microconidia start to form in these mutants they collapse into false heads due to the lack of structural integrity provided in part by Hyd1p and Hyd2p. This implies that the monophialides from which chains or false heads emerge are developmentally equivalent and that false heads are failed chains.

Fig. 4. Multi-photon confocal images of hydrophobin mutants transformed with HYD::AcGFP. (A) Wild-type control strain (Fvd316) constitutively expressing AcGFP in the cytoplasm. (B, C) A hyd2D mutant expressing HYD2::AcGFP (Fvd395). Fluorescence is seen at the basal part of conidiophores and at contact points of microconidia in false heads. (D) Wild-type strain expressing HYD2::AcGFP (Fvd400). Fluorescence of the fusion protein is present at junctions of individual microconidia. (E) Fluorescence of the HYD2::AcGFP fusion protein in Fvd395 between microconidia of a microconidial chain and in false heads. (F, G, H, and I) A hyd1D mutant transformed with the HYD1::AcGFP fusion protein (Fvd389) showing fluorescence between microconidia in false heads (F, G) and along hyphae and conidiophores (H, I). (G and I are transmission images of (F) and (H), respectively). Bars: (A, B, C, E, and F) 20 lm; (D, H) 10 lm.

862

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

The results with the HYD1::AcGFP and HYD2::AcGFP fusion proteins must be interpreted with caution since these constructs failed to complement the microconidial chain defect in the hydrophobin single mutants. We do not know if lack of complementation is due to failure of hydrophobin fusion protein to properly form monomers or if hydrophobin fusion protein monomers cannot properly self-assemble or interact with other proteins. Any modification of the C-terminus of Hyd1p or Hyd2p may impair hydrophobin function because fusion constructs with the 8 amino acid FLAG epitope also failed to complement the microconidial chain defect (U. Fuchs, unpublished results). Nevertheless, a role for HYD1 and HYD2 in microconidial chain formation was consistent with the localization of HYD1::AcGFP and HYD2::AcGFP fusion proteins. Fluorescence from the fusion proteins was localized between microconidia in false heads, between microconidia in chains, and where conidiophores were emerging from hyphae. It is tempting to speculate that the more circumscribed localization of the HYD2::AcGFP between microconidia when it was expressed in a wild-type strain was due to association with native Hyd2p in its normal position. Alternatively, we anticipated that expression of the non-functional fusion proteins in a wild-type strain might function as a dominant negative and cause a microconidial chain defect, but chains were normal in these transformants. Both HYD1::AcGFP and HYD2::AcGFP localized to false heads but we did not detect a defect in false heads in hyd1D and hyd2D mutants. Our data associated HYD1, HYD2, and HYD4 (by its presence exclusively in a library prepared from microconidia) with microconidiation in F. verticillioides. Although F. graminearum had a predicted hydrophobin very similar to Hyd5p and had the only known hydrophobin similar to Hyd3p, the genome of this fungus lacked predicted hydrophobins similar to Hyd1p, Hyd2p, and Hyd4p. Interestingly, F. graminearum does not produce microconidia (Gerlach and Nirenberg, 1982). The microconidiation pattern of another Fusarium spp raises an interesting question about HYD1 and HYD2. F. subglutinans (telomorph Gibberella fujikuroi mating population E), a close relative of F. verticillioides (telomorph G. fujikuroi mating population A), produces monoconidia in false heads, but not in chains (Gerlach and Nirenberg, 1982). It would be interesting to determine if orthologs of HYD1 and HYD2 are present in F. subglutinans and to determine if transformation of F. subglutinans with either or both of these genes would cause this fungus to elaborate microconidial chains. F. verticillioides also produces macroconidia, though in all the environmental and media conditions we examined, microconidia were the predominant spore form. We did not examine the effect of the hydrophobin mutations on macroconidiation. Hydrophobins, as the name implies, ‘‘appear to condition the hydrophobic character of external fungal

surfaces’’ (Kershaw and Talbot, 1998). In contrast, false heads and microconidial chains of F. verticillioides were not hydrophobic. These structures easily and completely dispersed in water into individual microconidia; remnants of conidial chains or false heads were not seen after aerial mycelium was gently dipped in water. We have only observed intact microconidial chains by dipping agar plugs in the non-polar solvent hexadecane (J. Sweigard, unpublished data). Moreover, the individual conidia were not hydrophobic; suspensions of microconidia at 1
108 /ml did not show any clumping. Rodlets, often seen on the surface of conidia (Asgeirsdottir et al., 1998; Bell-Pedersen et al., 1992; Paris et al., 2003; Stringer and Timberlake, 1995; Talbot et al., 1996) were not present on the surface of F. verticillioides microconidia (K. Czymmek unpublished data; N. Talbot, unpublished data). It is, therefore, difficult to reconcile the classic role of hydrophobins as assembled, hydrophobic materials with the hydrophilicity of microconidia and easy dispersal of F. verticillioides microconidial chains and false heads. We are intrigued by the possibility that Hyd1p and Hyd2p function in an assembled or unassembled form that requires them to be ‘‘hydrophilins.’’ This is a reasonable hypothesis since the predicted mature forms of Hyd1p and Hyd2p have a 40 amino acid hydrophilic region at the N-terminus. Also, assembled layers of hydrophobins are amphipathic, making hydrophilic surfaces hydrophobic and hydrophobic surfaces hydrophilic (Wessels, 1996). Still unanswered is why F. verticillioides aerial mycelium, as assessed by the ‘‘easily wettable’’ phenotype, is hydrophobic. This hydrophobicity may be due to additional hydrophobins, repellent-like proteins (W€ osten et al., 1996), or other novel hydrophobic molecules on the outside of mycelium. Despite their small size, hydrophobins have a remarkable diversity in amino acid sequence: outside the conserved cysteines amino acid conservation is poor among hydrophobins (Kershaw and Talbot, 1998). This diversity extends to the protein level, where hydrophobins have been classified into two groups based in hydropathy profiles and cysteine spacing (Wessels, 1994). Other variations in hydrophobin protein structure have been found: some occur as single peptide multimers, some assemble into rodlets, some have very extensive glycosylation, some have lectin properties (W€ osten and de Vocht, 2000). The predicted hydrophobin proteins found in F. verticillioides extend this diversity. Though very similar to each other, Hyd1p and Hyd2p were not closely related to known Class I hydrophobins. Likewise, Hyd4p extended the amino acid sequence diversity of Class II hydrophobins. Most strikingly, Hyd3p was a very distinct Class I hydrophobin by having an unusual spacing between the third and fourth cysteines. In contrast, Hyd5p shared very high identity with predicted Class II

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

hydrophobins from F. graminearum, M. grisea (magnaporin), and N. crassa. Our initial motivation to study the hydrophobins of F. verticillioides was to investigate their importance for virulence since hydrophobins are important for other pathogens. In the rice blast fungus M. grisea, mpg1-mutants showed reduced virulence in foliar assay due to impaired appressoria formation (Talbot et al., 1993). Some evidence suggested that cerato-ulmin might be important for virulence by O. ulmi, but this remains controversial (Bowden et al., 1994; Del Sorbo et al., 2000; Stringer and Timberlake, 1993). In A. fumigatus deletion of RODA increased the sensitivity of the fungus to killing by alveolar macrophages (Paris et al., 2003). Cytological investigations of F. verticillioides-corn seedling interaction indicated the fungus penetrated roots directly without elaborating specialized infection structures (Oren et al., 2003). Once inside the root, the fungus continued to ramify through the plant tissue via hyphae and sporulation occurred after extensive root colonization. Since HYD1 and HYD2 function in the aerial microconidiation process, it is not surprising that they remained as virulent as wild-type in the seedling assay. Microconidial chain formation, and hence HYD1 and HYD2, would probably be more relevant in the dispersal of the fungus. It would be interesting to test these mutants in ear mold field experiments that address the epidemiology of the organism. In addition to being required for full virulence in some pathogens, hydrophobins have been associated with different morphological and developmental roles in filamentous fungi. Our observations with hyd1D and hyd2D mutants extend the roles of hydrophobins to include a structural role in microconidial chain formation. Though a wide variety of hydrophobin structures have been found and functional analysis has uncovered many different roles for these proteins, it seems likely that the discovery of additional hydrophobins will extend the range of functions for these molecules even further.

Acknowledgments We thank Anne Carroll for exceptional technical assistance. We are indebted to Keith Duncan, Tim Bourett, and Rick Howard. We thank Pioneer HiBred providing financial support for UF during graduate studies at the University of Delaware.

References Asgeirsdottir, S.A., de Vries, O.M., Wessels, J.G., 1998. Identification of three differentially expressed hydrophobins in Pleurotus ostreatus (oyster mushroom). Microbiology 144 (Pt 11), 2961–2969. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1993. Current Protocols in Molecular Biology. J. Wiley, New York.

863

Bacon, C.W., Nelson, P.E., 1994. Fumonisin production in corn by toxigenic strains of Fusarium moniliforme and Fusarium proliferatum. J. Food Prot. 57, 514–521. Beever, R.E., Dempsey, G.P., 1978. Function of rodlets on the surface of fungal spores. Nature 272, 608–610. Bell-Pedersen, D., Dunlap, J.C., Loros, J.J., 1992. The Neurospora circadian clock-controlled gene, ccg-2, is allelic to eas and encodes a fungal hydrophobin required for formation of the conidial rodlet layer. Genes Dev. 6, 2382–2394. Bourett, T.M., Sweigard, J.A., Czymmek, K.J., Carroll, A., Howard, R.J., 2002. Reef coral fluorescent proteins for visualizing fungal pathogens. Fungal Genet. Biol. 37, 211–220. Bowden, C.G., Hintz, W.E., Jeng, R., Hubbes, M., Horgen, P.A., 1994. Isolation and characterization of the cerato-ulmin toxin gene of the Dutch elm disease pathogen, Ophiostoma ulmi. Curr. Genet. 25, 323–329. Claverie-Martin, F., Diaz-Torres, M.R., Geoghegan, M.J., 1986. Chemical composition and electron microscopy of the rodlet layer of Aspergillus nidulans conidia. Curr. Microbiol. 14, 221–225. Del Sorbo, G., Scala, F., Parrella, G., Lorito, M., Comparini, C., Ruocco, M., Scala, A., 2000. Functional expression of the gene cu, encoding the phytotoxic hydrophobin cerato-ulmin, enables Ophiostoma quercus, a nonpathogen on elm, to cause symptoms of Dutch elm disease. Mol. Plant Microbe. Interact. 13, 43–53. Desjardins, A.E., Manandhar, H.K., Plattner, R.D., Manandhar, G.G., Poling, S.M., Maragos, C.M., 2000. Fusarium species from nepalese rice and production of mycotoxins and gibberellic acid by selected species. Appl. Environ. Microbiol. 66, 1020–1025. Fisher, N.L., Marasas, W.F., Toussoun, T.A., 1983. Taxonomic importance of microconidial chains in Fusarium section Liseola and effects of water potential on their formation. Mycologia 75, 693– 698. Gelderblom, W.C., Seier, J.V., Snijman, P.W., Van Schalkwyk, D.J., Shephard, G.S., Marasas, W.F., 2001. Toxicity of culture material of Fusarium verticillioides strain MRC 826 to nonhuman primates. Environ. Health Perspect. 109 (Suppl. 2), 267–276. Gelderblom, W.C., Jaskiewicz, K., Marasas, W.F., Thiel, P.G., Horak, R.M., Vleggaar, R., Kriek, N.P., 1988. Fumonisins—novel mycotoxins with cancer-promoting activity produced by Fusarium moniliforme. Appl. Environ. Microbiol. 54, 1806–1811. Gerlach, W., Nirenberg, H., 1982. The Genus Fusarium—a Pictorial Atlas. Paul Parey, Berlin und Hamburg. K€afer, E., 1977. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv. Genet. 19, A1–A28. Kershaw, M.J., Talbot, N.J., 1998. Hydrophobins and repellents: proteins with fundamental roles in fungal morphogenesis. Fungal Genet. Biol. 23, 18–33. Lugones, L.G., Wosten, H.A.B., Birkenkamp, K.U., Sjollema, K.A., Zagers, J., Wessels, J.G.H., 1999. Hydrophobins line air channels in fruiting bodies of Schizophyllum commune and Agaricus bisporus. Mycol. Res. 103, 635–640. Mankel, A., Krause, K., Kothe, E., 2002. Identification of a hydrophobin gene that is developmentally regulated in the ectomycorrhizal fungus Tricholoma terreum. Appl. Environ. Microbiol. 68, 1408–1413. Munkvold, G.P., Desjardins, A.E., 1997. Fumonisins in maize. Can we reduce their occurrence? Plant Dis. 81, 556–565. Munoz, G., Nakari-Setala, T., Agosin, E., Penttila, M., 1997. Hydrophobin gene srh1, expressed during sporulation of the biocontrol agent Trichoderma harzianum. Curr. Genet. 32, 225– 230. Nakari-Setala, T., Aro, N., Ilmen, M., Munoz, G., Kalkkinen, N., Penttila, M., 1997. Differential expression of the vegetative and spore-bound hydrophobins of Trichoderma reesei—cloning and characterization of the hfb2 gene. Eur. J. Biochem. 248, 415–423. Nelson, P.E., 1992. Taxonomy and biology of Fusarium moniliforme. Mycopathologia 117, 29–36.

864

U. Fuchs et al. / Fungal Genetics and Biology 41 (2004) 852–864

Oren, L., Ezrati, S., Cohen, D., Sharon, A., 2003. Early events in the Fusarium verticillioides-maize interaction characterized by using a green fluorescent protein-expressing transgenic isolate. Appl. Environ. Microbiol. 69, 1695–1701. Paris, S., Debeaupuis, J.P., Crameri, R., Carey, M., Charles, F., Prevost, M.C., Schmitt, C., Philippe, B., Latge, J.P., 2003. Conidial hydrophobins of Aspergillus fumigatus. Appl. Environ. Microbiol. 69, 1581–1588. Proctor, R.H., Desjardins, A.E., Plattner, R.D., Hohn, T.M., 1999. A polyketide synthase gene required for biosynthesis of fumonisin mycotoxins in Gibberella fujikuroi mating population A. Fungal Genet. Biol. 27, 100–112. Scherrer, S., De Vries, O.M., Dudler, R., Wessels, J.G., Honegger, R., 2000. Interfacial self-assembly of fungal hydrophobins of the lichen-forming ascomycetes Xanthoria parietina and X. ectaneoides. Fungal Genet. Biol. 30, 81–93. Segers, G.C., Hamada, W., Oliver, R.P., Spanu, P.D., 1999. Isolation and characterisation of five different hydrophobin-encoding cDNAs from the fungal tomato pathogen Cladosporium fulvum. Mol. Gen. Genet. 261, 644–652. Sherman, F., 1991. Getting started with yeast. Methods Enzymol. 194, 3–21. Sikorski, R.S., Hieter, P., 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19–27. Stringer, M.A., Timberlake, W.E., 1993. Cerato-ulmin, a toxin involved in Dutch elm disease, is a fungal hydrophobin. Plant Cell 5, 145–146. Stringer, M.A., Timberlake, W.E., 1995. dewA encodes a fungal hydrophobin component of the Aspergillus spore wall. Mol. Microbiol. 16, 33–44. Stringer, M.A., Dean, R.A., Sewall, T.C., Timberlake, W.E., 1991. Rodletless, a new Aspergillus developmental mutant induced by directed gene inactivation. Genes Dev. 5, 1161–1171. Tagu, D., De Bellis, R., Balestrini, R., De Vries, O.M.H., Piccoli, G., Stocchi, V., Bonfante, P., Martin, F., 2001. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucaluptus globulus roots. New Phytol. 149, 127–135. Talbot, N.J., Ebbole, D.J., Hamer, J.E., 1993. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell 5, 1575–1590. Talbot, N.J., Kershaw, M.J., Wakley, G.E., De Vries, O., Wessels, J., Hamer, J.E., 1996. MPG1 encodes a fungal hydrophobin involved

in surface interactions during infection-related development of Magnaporthe grisea. Plant Cell 8, 985–999. Temple, B., Horgen, P.A., Bernier, L., Hintz, W.E., 1997. Ceratoulmin, a hydrophobin secreted by the causal agents of Dutch elm disease, is a parasitic fitness factor. Fungal Genet. Biol. 22, 39–53. Trembley, M.L., Ringli, C., Honegger, R., 2002. Differential expression of hydrophobins define strata in the lichenized basidiocarp of Dictyonema glabratum. New Phytol. 154, 175–184. van Wetter, M.A., Wosten, H.A., Wessels, J.G., 2000a. SC3 and SC4 hydrophobins have distinct roles in formation of aerial structures in dikaryons of Schizophyllum commune. Mol. Microbiol. 36, 201– 210. van Wetter, M.A., Wosten, H.A., Sietsma, J.H., Wessels, J.G., 2000b. Hydrophobin gene expression affects hyphal wall composition in Schizophyllum commune. Fungal Genet. Biol. 31, 99–104. Wessels, J.G.H., 1992. Gene expression during fruiting in Schizophyllum commune. Mycol. Res. 96, 609–620. Wessels, J.G.H., 1994. Developmental regulation of fungal cell wall formation. Annu. Rev. Phytopathol. 32, 413–437. Wessels, J.G.H., 1996. Fungal hydrophobins: proteins that function at an interface. Trends Plant Sci. 1, 9–15. White, D.G., 1999. Compendium of Corn Diseases. APS Press, St. Paul, Minn. Whiteford, J.R., Spanu, P.D., 2001. The hydrophobin HCf-1 of Cladosporium fulvum is required for efficient water-mediated dispersal of conidia. Fungal Genet. Biol. 32, 159–168. W€ osten, H., De Vries, O., Wessels, J., 1993. Interfacial Self-Assembly of a Fungal Hydrophobin into a Hydrophobic Rodlet Layer. Plant Cell 5, 1567–1574. W€ osten, H.A., 2001. Hydrophobins: multipurpose proteins. Annu. Rev. Microbiol. 55, 625–646. W€ osten, H.A., de Vocht, M.L., 2000. Hydrophobins, the fungal coat unravelled. Biochim. Biophys. Acta 1469, 79–86. W€ osten, H.A., Asgeirsdottir, S.A., Krook, J.H., Drenth, J.H., Wessels, J.G., 1994. The fungal hydrophobin Sc3p self-assembles at the surface of aerial hyphae as a protein membrane constituting the hydrophobic rodlet layer. Eur. J. Cell Biol. 63, 122–129. W€ osten, H.A., Bohlmann, R., Eckerskorn, C., Lottspeich, F., B€ olker, M., Kahmann, R., 1996. A novel class of small amphipathic peptides affect aerial hyphal growth and surface hydrophobicity in Ustilago maydis. EMBO J. 15, 4274–4281. Zangi, R., de Vocht, M.L., Robillard, G.T., Mark, A.E., 2002. Molecular dynamics study of the folding of hydrophobin SC3 at a hydrophilic/hydrophobic interface. Biophys. J. 83, 112–124.