- Email: [email protected]
Flow cytometric sorting of non-human primate sperm nuclei
Theriogenology 63 (2005) 246–259
Flow cytometric sorting of non-human primate sperm nuclei Justine K. O’Briena,*, Tomas Stojanovb, Scott J. Heffernanc, Fiona K. Hollinsheada, Larry Vogelnestd, W.M. Chis Maxwella, Gareth Evansa a
Faculty of Veterinary Science, Centre for Advanced Technologies in Animal Genetics and Reproduction, University of Sydney, NSW 2006, Australia b Sydney IVF, NSW 2000, Australia c Department of Renal Medicine, Royal Prince Alfred Hospital, NSW 2006, Australia d Taronga Zoo, Zoological Parks Board of NSW, NSW 2088, Australia Received 9 March 2004; accepted 21 April 2004
Abstract Pre-determination of the sex of offspring has implications for management and conservation of captive wildlife species, particularly those with single sex-dominated social structures. Our goal is to adapt flow cytometry technology to sort spermatozoa of non-human primate species for use with assisted reproductive technologies. The objectives of this study were to: (i) determine the difference in DNA content between X- and Y-bearing spermatozoa (ii) sort sperm nuclei into Xand Y-enriched samples; and (iii) assess the accuracy of sorting. Spermatozoa were collected from two common marmosets (Callithrix jacchus), seven hamadryas baboons (Papio hamadryas) and two common chimpanzees (Pan troglodytes). Human spermatozoa from one male were used as a control. Sperm nuclei were stained (Hoechst 33342), incubated and analyzed using a high-speed cell sorter. Flow cytometric reanalysis of sorted samples (sort reanalysis, 10,000 events/sample) and fluorescence in situ hybridization (FISH; 500 sperm nuclei/sample) were used to evaluate accuracy of sorting. Based on fluorescence intensity of X- and Y-bearing sperm nuclei, the difference in DNA content between X and Y populations was 4.09 0.03, 4.20 0.03, 3.30 0.01, and 2.97 0.05%, for marmoset, baboon, chimpanzee and human, respectively. Sort reanalysis and FISH results were similar; combined data revealed high levels of purity for X- and Y-enriched samples (94 0.9 and 93 0.8%, 94 0.7 and 94 0.5%, 91 0.9 and 97 0.6%, 94 0.6 and 94 0.9%, for marmoset, baboon, chimpanzee and human,
* Corresponding author. Tel.: þ61 2 9351 5830; fax: þ61 2 9351 3957. E-mail address: [email protected] (J.K. O’Brien).
0093-691X/$ – see front matter # 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2004.04.013
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
247
respectively). These data indicate the potential for high-purity sorting of spermatozoa from nonhuman primates. # 2004 Elsevier Inc. All rights reserved. Keywords: Sperm sorting; Sperm sexing; Sex pre-determination; Flow cytometry; Primates
1. Introduction In conjunction with assisted reproductive technology, sex pre-selection of offspring through the use of sexed spermatozoa [1] has great potential as a captive population management strategy for wildlife species, particularly those with single-sex dominated social structures [2]. Birth of normal offspring using spermatozoa sorted by flow cytometry has been achieved in numerous domestic species [3–5], humans [6–8] and in one wildlife species, the elk (Cervus elaphus nelsoni, [9]). Although sperm sorting methods have been developed for one primate, the human [8,10], there exists great variation in gamete physiology among primates, and species-specific protocols for sperm staining, sorting and preservation will be required. Reanalysis of sorted samples (sort reanalysis [11]) using the flow cytometer is the standard method for evaluation of accuracy of sorting and can be performed in a short interval (30 min) and at low additional cost. However, sort reanalysis results may not be consistently accurate for species where the DNA content difference between X and Y chromosome-bearing spermatozoa is <3.0% [11]. Sort reanalysis results can be validated by single sperm analysis using fluorescence in situ hybridization (FISH, [11]) or the polymerase chain reaction (PCR, [12]) using probes/primers specific to the X and/or Y chromosome(s). These techniques have been used in humans to assess accuracy of sorting [8,10] and in a western lowland gorilla (Gorilla gorilla gorilla) to determine fetal sex [13]. The feasibility of using FISH probes labeling specific loci on human chromosomes for identification of chromosomes in spermatozoa of other primates has not been investigated. The goal of this research was to establish basic flow cytometry parameters and methodologies for sorting sperm nuclei in several non-human primate species. Specific objectives were to: (i) determine the difference in DNA content between X- and Y-bearing sperm nuclei (ii) sort sperm nuclei into X- and Y-enriched samples; and (iii) assess the accuracy of sorting using sort reanalysis and FISH.
2. Materials and methods Procedures described herein were approved by The University of Sydney’s Animal Ethics Committee. 2.1. Study design Four primate species representing new world monkeys (common marmoset, Callithrix jacchus, n ¼ 2), old world monkeys (hamadryas baboon, Papio hamadryas, n ¼ 7), great
248
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
apes (common chimpanzee, Pan troglodytes, n ¼ 2) and the human (Homo sapiens, n ¼ 1) were examined. All analyses were performed using sperm nuclei rather than whole spermatozoa. This homogenous preparation enabled more accurate determination of DNA content of X- and Y-bearing spermatozoa by minimizing interference of sperm nuclei alignment by the midpiece and tail. 2.2. Reagents and media All chemicals were of analytical grade. Unless otherwise stated, all media components were purchased from Sigma–Aldrich (Sigma, St. Louis, MO, USA), and were prepared with embryo grade water (ThermoTrace, Noble Park, Victoria, Australia). The majority of disposable plastic ware was purchased from Becton Dickinson (Franklin Lakes, NJ, USA). 2.3. Collection of spermatozoa Marmoset epididymal spermatozoa were collected postmortem from two males (aged 2 and 4 years). Hamadryas baboon spermatozoa were collected from seven males (aged 7 years) by electroejaculation (EEJ). Chimpanzee spermatozoa were collected from two males (aged 8 and 13 years) by EEJ or postmortem. Human spermatozoa were collected from one male by masturbation. Epididymal spermatozoa from the chimpanzee and marmosets were obtained within 4 h postmortem. The testes and epididymides were dissected from the animals and held at 21 8C during sperm collection. Vas deferens and cauda epididymides were dissected from surrounding connective tissue and blood vessels. Epididymal tubules were pierced repeatedly by fine forceps and the sperm suspension was extruded using forceps. For all species, spermatozoa were collected in a HEPES-buffered TALP medium (HEPESTALP) containing 0.3%, w/v BSA (Sigma A-9647) and the final sperm sample was filtered using 5 mL tubes with cell-strainer caps (35 mm, Falcon 2235). For samples collected by EEJ, males were anaesthetised with either ketamine (baboon; 5–8 mg/kg, Ketamil, Ilium, Troy Laboratories, Smithfield, NSW, Australia) or tiletamine and zolazepam (chimpanzee; 4.3 mg/kg, Zoletil1, Virbac Australia Pty Ltd., Peakhurst, NSW, Australia) and EEJ performed using a 220 V ac electroejaculator and a lubricated rectal probe (baboon: 24 cm 1.5 cm; chimpanzee: 25 cm 2.5 cm) containing electrodes positioned at 30, 90 and 1508 (baboon, 4 cm 0.4 cm; chimpanzee: 5 cm 0.5 cm; PT Electronics, Boring, OR, USA). Two or three sets of stimulations were performed, with each set comprising 20–40 stimulations. During the stimulatory cycle, voltage (2–12 V) was increased in a step-wise manner to elicit ejaculation. 2.4. Preparation of sperm nuclei samples Sperm suspensions (1–2 mL) were sonicated using a Branson Sonifier 250 (Branson Ultasonics, Danbury, CT, USA) at 60% power until >95% of midpieces and tails had been removed (approximately 10–20 s). Following sonication, samples were centrifuged at 1200 g for 30 min on a Percoll gradient (2 mL 90%; 1 mL 67.5%; 1 mL 45%; D.L. Garner, unpublished) and the pellet resuspended in HEPES-TALP or a medium containing
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
249
300.0 mM Tris (hydroxymethyl)aminomethane, 27.8 mM fructose, 94.7 mM citrate (monohydrate), 87.9 IU/mL penicillin-G and 35.3 IU/mL streptomycin sulfate (TFC medium; modified from [14]) supplemented with 0.3%, w/v BSA (Sigma A-9647). Osmolality was 300 10 mosm/kg and pH was 7.2 0.2 for HEPES-TALP and TFC media. Final cell concentration was adjusted to 20 106 sperm nuclei/mL and samples were then stained with 17.8 mM H33342, incubated at 34 8C for 1 h and filtered (35 mm). Stained sperm nuclei samples were stored protected from light at 4 8C prior to analysis (up to 3 months). 2.5. Flow cytometric sorting A high-speed cell sorter (MoFlo SX1, DakoCytomation, Fort Collins, CO, USA) modified for sperm sorting [15,16] operating at 50 psi was used to analyse and separate sperm nuclei. Sheath fluid was TFC medium. H33342 was excited by UV light (351, 364 nm multi-line) from an argon ion laser running at 200 mW. Sperm nuclei were sorted into 10 mL centrifuge tubes (pre-soaked overnight with TFC with 0.1%, w/v BSA) containing 1 mL of TFC medium with 0.3%, w/v BSA. High purity sorting was performed by placing sort gates on the oriented population (sperm nuclei with their flat surface oriented towards the laser beam) to achieve purities of >90% X- or Y-bearing sperm nuclei. 2.6. Determination of difference in DNA content Fluorescence intensity of X- and Y-bearing sperm nuclei populations was measured using the MoFlo SX1 (12,000 events per male; three replicates per male). Difference in DNA content (percentage separation of the fluorescent peaks representing the two populations) was then calculated using the formula: XY Difference ¼ 100 0:5ðX þ YÞ where X ¼ X-bearing sperm nuclei mean fluorescence and Y ¼ Y-bearing sperm nuclei mean fluorescence [17]. 2.7. Assessment of sperm sorting accuracy Reanalysis of sorted samples (sort reanalysis) and FISH were used to evaluate accuracy of sorting. For sort reanalysis, an aliquot of the sorted sample containing 5 106 sperm nuclei was re-stained with 36 mM H33342, incubated for 20 min, sonicated then analyzed (50–100 sperm nuclei/s) using the MoFlo SX1 (10,000 events analyzed per sample). The proportions of X- and Y-bearing spermatozoa were determined by a mathematical model [11]. For FISH, an aliquot containing at least 5 104 sperm nuclei was fixed (methanol:acetic acid; 3:1, v/v) on pre-cleaned glass slides (pre-soaked in methanol for at least 12 h). Sperm DNA was decondensed (50 mM dithiothreitol at 39 8C for 15 min), rinsed in water, dehydrated through an ethanol series (70, 90 and 100%, v/v), air-dried and stored at 4 8C (for up to 2 months) then in situ hybridized with either MultiVision PGT probe
250
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
(consisting of five probes labeling specific loci on human chromosomes 13, 18, 21, X and Y; Vysis Inc., Downers Grove, IL, USA [18]) (human, chimpanzee) or a probe mixture (baboon, marmoset) consisting of a chromosome 21 specific probe (Vysis Inc.) and a probe recognizing a centromeric Y chromosome repeat (Y chromosome-specific probe, prepared by our laboratory). The probe mixture was overlaid with a glass coverslip and edges were sealed with rubber cement. Hybridization comprised treatment of sperm nuclei at 78 8C for 3 min (DNA denaturation), followed by 30 8C for 24 h. The rubber cement and coverslip were then removed and slides were washed in 50% formamide in 2 SSC (0.3 mM NaCl, 30 mM sodium citrate; 42 8C for 10 min), then 2 SSC (42 8C for 10 min) and 2 SSC containing 0.01%, w/v NP40 (non-ionic detergent, Boehringer, Mannheim, Germany; 42 8C for 5 min). Three microlitres of antifade solution (Vysis) were placed over the hybridized region, overlaid with a glass coverslip and sealed with finger nail varnish. Five hundred sperm nuclei per sample were examined using an Olympus BX60 System Microscope (magnification, 2000) equipped with single-band pass filters for spectrum blue, aqua, yellow, green, red (Vysis Inc.). Micrographs were taken using Cytovision 2.81 Build 7 software. 2.8. Preparation of the marmoset and baboon Y chromosome-specific probe Marmoset or baboon DNA was extracted using DNA extraction kit (Roche, Mannheim, Germany) according to manufacturer’s instructions. Ten nanograms of DNA was used for PCR in a final PCR reaction volume of 50 mL containing 1.6 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl (pH 8.3), 0.2 mM dNTP, 1.5 U AmpliTaq DNA polymerase or 1.5 U AmpliTaq gold DNA polymerase (all reagents supplied by Applied Biosystems, Foster City, CA, USA) and 0.4 mM each of a specific primer pair. The thermal cycling was conducted in an Eppendorf thermal reactor. Primers were designed against human chromosome Y alphoid satellite DNA (dyz3-F tctgagacacttctttgtgg, dyz3-R gtgacgatatttccttttcc); 0.5 mg of yielded PCR product DNA was labeled using a hexanucleotide mix (Roche) with modification. A 20 mL reaction was set up containing 0.5 mg of PCR product and a 2.5 hexanucleotide mix (final concentration), 2 mL of dNTP mix (0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.5 mM dTTP in molecular grade water), 0.25 mL of 1 mM tetremethy-rhodamine-5-dUTP (Roche) or 0.4 mL of 1 mM fluorescein-12-dUTP (Roche) and 2 mL of 2 units/mL Klenow enzyme (Roche). The reaction was incubated overnight at 37 8C and stopped by heating at 92 8C for 10 min. Unincorporated nucleotides were removed by ethanol precipitation. This was achieved by adding 1/10 volume of 3 M sodium acetate and 2.5 vol. of 100% ethanol, incubating at 70 8C for 30 min and then centrifuging for 15 min at 10,000 g. The pellet was then washed with 70% ethanol and allowed to air dry. Labeled and precipitated DNA was then diluted in 10 mL of hybridization mix (50% formamide, 6 SSC, 0.5% SDS, 5 Denhardt’s, Sigma). The probe’s Y chromosome specificity was confirmed by hybridization against human metaphase spread chromosomes (Fig. 1). 2.9. Statistical analysis The proportions of X- and Y-labeled sperm nuclei after FISH of control (unsorted) samples were compared to a 50:50 distribution using the Chi-square test. Statistical
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
251
Fig. 1. Y chromosome-specific marmoset probe (labeled with rhodamine) hybridized to a human metaphase chromosome spread prepared from white blood cells. Original magnification 2000.
differences in the proportions of X- and Y-sperm nuclei from sort reanalysis and FISH procedures were determined by the Chi-square test. For all analyses, P < 0.05 was considered significant.
3. Results The mean percentage difference in DNA content between X and Y-bearing spermatozoa was higher for monkey species (marmoset and baboon) compared to the chimpanzee and human (Table 1). Table 1 Percentage difference (mean S.E.M.) in DNA content between X and Y chromosome-bearing sperm nuclei as determined by flow cytometric analysis of Hoechst 33342-stained samples Sperm nuclei sample (number of males)
Difference (%) in DNA content between X and Y chromosome-bearing sperm nuclei
Marmoset (n ¼ 2) Baboon (n ¼ 7) Chimpanzee (n ¼ 2) Human (n ¼ 1)
4.09 4.20 3.30 2.97
0.03 0.03 0.01 0.05
252
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Sperm nuclei samples from all species could be resolved into two populations representing X- and Y-bearing spermatozoa, and the co-efficient of variation (CV) of X- and Ysperm populations selected for sorting ranged from 1.6 to 2.1%. Good resolution of X- and Y-sperm nuclei populations was achieved for marmoset and baboon samples (Fig. 2a and b). Although X and Y populations were observed for chimpanzee and human samples (Fig. 2c and d), resolution (as indicated by the depth of the split on the histogram output) was poorer than that achieved for the two monkey species. An example of the dotplot and histogram outputs obtained during the reanalysis of X- and Y-enriched sperm nuclei is presented for the baboon (Fig. 3; for all species the CVof the reanalyzed population ranged from 0.92 to 1.0%). The percentages of correctly-oriented sperm nuclei for marmoset, baboon, chimpanzee and human samples were 80 5, 75 5, 60 5 and 60%, respectively. Sorting rates were high for samples from marmosets and baboons (3040 760 and 3966 580 sperm head/s, respectively) and moderate for the chimpanzee and human (1450 120 and 1355 sperm nuclei/s, respectively). Of the five human chromosome-specific probes used successfully with human sperm DNA (Fig. 4), hybridization signals in chimpanzee sperm DNA were observed for chromosomes 18, 21 and X (Fig. 5). When hybridized with human chromosome-specific probes, marmoset and baboon sperm nuclei displayed signals only for chromosome 21. Therefore, an in-house probe mixture was created using marmoset and baboon DNA. Hybridization of marmoset and baboon sperm nuclei with the in-house probe resulted in signals for chromosome Y and 21 (Fig. 6). Hybridization efficiency was high for all probes (97.3 3.1%). Sort reanalysis and FISH results were similar and combined data for all species revealed high levels of purity for X- and Y-enriched samples (Table 2). Percentages of X- and Ylabeled sperm nuclei after FISH of control (unsorted) samples were not different from a 50:50 distribution.
4. Discussion Pre-determination of sex by artificial insemination or in vitro fertilization with sexed spermatozoa represents an alternative population management strategy that could be Table 2 Comparison (mean S.E.M.) of sort reanalysis and FISH techniques for evaluation of sorting accuracy of Xenriched (X-sort) and Y-enriched (Y-sort) samples Sperm nuclei sample (number of males)
Sort reanalysis
FISH
X-sort (%X)
Y-sort (%Y)
X-sort (%X)
Y-sort (%Y)
Control (unsorted) (%X:%Y)
Baboon (n ¼ 7) Marmoset (n ¼ 2) Chimpanzee (n ¼ 2) Human (n ¼ 1)
94 0.7 92 0.5 92 1.0 94
94 0.5 95 1.0 91 1.5 94
94 0.4 93 1.0 97 1.0 92
93 0.5 94 1.5 96 1.0 94
51 0.3:49 0.3 53 1.0:47 1.0 53 1.0:47 1.0 51:49
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
253
Fig. 2. Flow cytometric dotplot and histogram outputs showing fluorescent signals generated by marmoset (a) baboon (b) chimpanzee (c) and human (d) X and Y chromosome-bearing sperm nuclei. Fluorescent signals from correctly-oriented sperm nuclei shown in region 1 (R1) of the dotplot output are displayed in the histogram output.
254
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Fig. 2. (Continued ).
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
255
Fig. 3. Flow cytometric dotplot and histogram outputs from the sort reanalysis procedure showing fluorescent signals generated by baboon X and Y chromosome-bearing sperm nuclei from (a) X-sperm (X ¼ 93%) and (b) Y-sperm (Y ¼ 95%) enriched samples. Fluorescent signals from correctly-oriented sperm nuclei shown in region 1 (R1) of the dotplot output were analyzed for purity (displayed in the histogram output).
256
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Fig. 4. Decondensed X and Y chromosome-bearing human sperm nuclei hybridized with Multivision PGT probes specific for chromosomes X (violet blue) Y (yellow) 13 (red) 18 (aqua) and 21 (green). Original magnification 2000.
incorporated into captive breeding programs for species with single-sex dominated social structures. In conjunction with appropriate genetic management, this combined approach could allow wildlife managers to optimize reproductive performance within a breeding population and meet management requirements of these species. The results of this study provide information on basic parameters for the sorting of non-human primate spermatozoa and represent the first step in establishing sperm sexing technology for non-human primate species. To validate sort reanalysis results, fluorescence in situ hybridization technology developed in humans was applied directly to the chimpanzee and modified for application to spermatozoa from marmosets and baboons. Sort reanalysis and FISH results were similar
Fig. 5. Decondensed X and Y chromosome-bearing chimpanzee sperm nuclei hybridized with Multivision PGT probes specific for chromosomes X (violet blue, arrow) 13 (red) and 21 (green). Original magnification 2000.
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
257
Fig. 6. Decondensed X and Y chromosome-bearing baboon (a) and marmoset (b) sperm nuclei hybridized with Multivision PGT centromeric probe specific for chromosome 21 (orange) and with an in-house probe recognizing a centromeric Y chromosome repeat (violet blue, arrow). Original magnification 2000.
for all non-human and human spermatozoa examined, despite a low difference in DNA content between X and Y spermatozoa in the latter (2.9%). Good resolution of X and Y sperm populations was obtained for all species, so it was not surprising that sort reanalysis and FISH results were similar. The MultiVision PGT five probe mix contains human DNA sequences homologous to locus-specific regions on chromosomes 13 and 21 and centromeric regions on chromosomes 18, X and Y. Although approximately 95% of the chimpanzee genome is identical to that of humans [19], no probe hybridization signals were seen for chromosomes 13 and Y. The failure of hybridization of the chromosome 13 locus-specific probe was not further investigated since the probe signal was considered extraneous to our requirements and the remaining autosomal probes (chromosomes 18 and 21) could serve as a positive hybridization control in the subsequent assay. The lack of hybridization with the centromeric Y chromosome probe was not expected, given the high homology of alphoid DNA in man and
258
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
monkeys [20], although a similar failure of this Y chromosome probe to hybridize on gorilla prenatal samples was reported previously [13]. The X and Y chromosome probes also failed to hybridize with the marmoset and baboon samples, but the positive signal for the chromosome 21 locus-specific probe on the decondensed sperm DNA confirmed the suitability of the DNA preparation method for in situ hybridization. Thereafter, a Y chromosome-specific probe was successfully prepared by amplifying alphoid DNA from marmoset and baboon DNA. Sequence similarity of the region among primate species enabled the primers to be designed using known human homologue DNA sequences. The use of a DNA template from the targeted species gave us the ability to develop probes specific to the monkey species investigated in this study. Among the primate species examined in this study, flow cytometric analysis revealed a large variation in the difference in DNA content between X and Y spermatozoa (from 2.9% (human) to 4.2% (baboon)). The difference in DNA content between X and Y spermatozoa is dependent on the relative sizes of the X and Y chromosome and the total DNA content per spermatozoon, as determined by chromosome number, size and morphology. Variation in the difference in DNA content between X and Y spermatozoa is expected among primate species, since there is great diversity in diploid chromosome number, chromosome size and morphology [21]. For whole spermatozoa, the rate of sorting is mainly dependent on sperm orientation, difference in DNA content between X and Y spermatozoa, and the proportion of viable spermatozoa. Our results using sperm nuclei demonstrated that higher sorting rates were obtained with the marmoset and baboon compared to the chimpanzee and human. These species had a higher proportion of correctly-oriented spermatozoa and a greater difference in DNA content between X and Y spermatozoa than the chimpanzee and human. This suggests higher sorting rates would be achieved with intact spermatozoa from the marmoset and baboon compared with the chimpanzee, but the ultimate sorting rate would also be dependent on the number of viable spermatozoa available for sorting. Validated methodologies are now available for high-purity sorting of X- and Y-bearing sperm nuclei samples in non-human primate species. These data indicate the potential for high purity sorting of spermatozoa from non-human primates. Providing that adequate resolution of X and Y sperm populations can be achieved, these results imply that the accuracy of sorting whole spermatozoa from the primate species in this study may be assessed by using sort reanalysis alone. Research into the quality of sorted spermatozoa following species-specific staining and sorting protocols is now required to enable the successful application of sperm sorting technology in non-human primates.
Acknowledgements This research was supported by XY Inc. (Fort Collins, CO, USA), Zoological Parks Board of NSW and Australian Research Council. The authors thank XY, Inc.’s K.M. Evans and the University of Sydney’s L. He and R. Wadley for assistance with sorting, and A. Birrell, (Royal Prince Alfred Hospital), R. Bathgate, B.M. Eriksson, J.R. Potas, P.R. Martin, S.G. Solomon (University of Sydney) and staff at the Life Sciences Division,
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
259
Veterinary Quarantine Centre, and African Division (Taronga Zoo) for assistance with collection of spermatozoa. References [1] Johnson LA, Flook JP, Hawk HW. Sex pre-selection in rabbits: live births from X- and Y-sperm separated by DNA and cell sorting. Biol Reprod 1989;41:199–203. [2] O’Brien JK, Crichton EG, Evans KM, Schenk JL, Stojanov T, Evans G, et al. Sex ratio modification using sperm sorting and assisted reproductive technology—a population management strategy. In: Proceedings of the second international symposium of assisted reproductive technologies for the conservation and genetic management of wildlife. Omaha: Nebraska; 28–29 September 2002, pp. 224–31. [3] Johnson LA. Sexing mammalian sperm for production of offspring: the state-of-the-art. Anim Reprod Sci 2000;60–61:93–107. [4] Garner DL. Sex-sorting mammalian sperm: concept to application in animals. J Androl 2001;22:519–26. [5] Seidel Jr GE, Garner DL. Current status of sexing mammalian spermatozoa. Reproduction 2002;124:733–43. [6] Levinson G, Keyvanfar K, Wu JC, Fugger EF, Fields RA, Harton GL, et al. DNA-based X-enriched sperm separation as an adjunct to preimplantation genetic testing for the prevention of X-linked disease. Hum Reprod 1995;10:979–82. [7] Fugger EF, Black SH, Keyvanfar K, Schulman JD. Births of normal daughters after MicroSort sperm separation and intrauterine insemination, in vitro fertilization, or intracytoplasmic sperm injection. Hum Reprod 1998;13:2267–70. [8] Fugger EF. Clinical experience with flow cytometric separation of human X- and Y-chromosome bearing sperm. Theriogenology 1999;52:1435–40. [9] Schenk JL, DeGrofft DL. Insemination of cow elk with sexed frozen semen. Theriogenology 2003;59:514, abstract. [10] Johnson LA, Welch GR, Keyvanfar K, Dorfmann A, Fugger EF, Schulman JD. Gender preselection in humans? Flow cytometric separation of X and Y spermatozoa for the prevention of X-linked diseases. Hum Reprod 1993;8:1733–9. [11] Welch GR, Johnson LA. Sex preselection: laboratory validation of the sperm sex ratio of flow sorted Xand Y-sperm by sort re-analysis for DNA. Theriogenology 1999;52:1343–52. [12] Welch GR, Waldbieser GC, Wall RJ, Johnson LA. Flow cytometric sperm sorting and PCR to confirm separation of X- and Y-chromosome-bearing bovine sperm. Anim Biotechnol 1997;6:131–9. [13] Ramsay PA, Boardman W, MacDonald B, Roberts C, Fraser IS. Chorionic villus sampling for sex determination in a western lowland gorilla (Gorilla gorilla gorilla). J Zoo Wildlife Med 2000;31:532–8. [14] Evans G, Maxwell WMC. Salamon’s artificial insemination of sheep and goats. Sydney: Butterworths; 1987. [15] Rens W, Welch GR, Johnson LA. A novel nozzle for more efficient sperm orientation to improve sorting efficiency of X and Y chromosome-bearing sperm. Cytometry 1998;33:476–81. [16] Johnson LA, Welch GR. Sex preselection: high speed flow cytometric sorting of X and Y sperm for maximum efficiency. Theriogenology 1999;52:1323–41. [17] Garner DL, Gledhill BL, Pinkel D, Lake S, Stephenson D, Van Dilla MA, et al. Quantification of the Xand Y-chromosome-bearing spermatozoa of domestic animals by flow cytometry. Biol Reprod 1983;28:312–21. [18] Van Dyk Q, Lanzendorf S, Kolm P, Hodgen GD, Mahony MC. Incidence of aneuploid spermatozoa from subfertile men: selected with motility versus hemizona-bound. Hum Reprod 2000;15:1529–36. [19] Britten RJ. Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. Proc Natl Acad Sci USA 2002;99:13633–5. [20] Musich PR, Brown FL, Maio JJ. Highly repetitive component alpha and related alphoid DNAs in man and monkeys. Chromosoma 1980;80:331–48. [21] Chiarelli AB. Comparative cytogenetics in primates and its relevance for human cytogenetics. In: Chiarelli AB, editor. Comparative genetics in monkeys, apes and man. London/New York: Academic Press; 1971. pp. 273–308.
Flow cytometric sorting of non-human primate sperm nuclei Justine K. O’Briena,*, Tomas Stojanovb, Scott J. Heffernanc, Fiona K. Hollinsheada, Larry Vogelnestd, W.M. Chis Maxwella, Gareth Evansa a
Faculty of Veterinary Science, Centre for Advanced Technologies in Animal Genetics and Reproduction, University of Sydney, NSW 2006, Australia b Sydney IVF, NSW 2000, Australia c Department of Renal Medicine, Royal Prince Alfred Hospital, NSW 2006, Australia d Taronga Zoo, Zoological Parks Board of NSW, NSW 2088, Australia Received 9 March 2004; accepted 21 April 2004
Abstract Pre-determination of the sex of offspring has implications for management and conservation of captive wildlife species, particularly those with single sex-dominated social structures. Our goal is to adapt flow cytometry technology to sort spermatozoa of non-human primate species for use with assisted reproductive technologies. The objectives of this study were to: (i) determine the difference in DNA content between X- and Y-bearing spermatozoa (ii) sort sperm nuclei into Xand Y-enriched samples; and (iii) assess the accuracy of sorting. Spermatozoa were collected from two common marmosets (Callithrix jacchus), seven hamadryas baboons (Papio hamadryas) and two common chimpanzees (Pan troglodytes). Human spermatozoa from one male were used as a control. Sperm nuclei were stained (Hoechst 33342), incubated and analyzed using a high-speed cell sorter. Flow cytometric reanalysis of sorted samples (sort reanalysis, 10,000 events/sample) and fluorescence in situ hybridization (FISH; 500 sperm nuclei/sample) were used to evaluate accuracy of sorting. Based on fluorescence intensity of X- and Y-bearing sperm nuclei, the difference in DNA content between X and Y populations was 4.09 0.03, 4.20 0.03, 3.30 0.01, and 2.97 0.05%, for marmoset, baboon, chimpanzee and human, respectively. Sort reanalysis and FISH results were similar; combined data revealed high levels of purity for X- and Y-enriched samples (94 0.9 and 93 0.8%, 94 0.7 and 94 0.5%, 91 0.9 and 97 0.6%, 94 0.6 and 94 0.9%, for marmoset, baboon, chimpanzee and human,
* Corresponding author. Tel.: þ61 2 9351 5830; fax: þ61 2 9351 3957. E-mail address: [email protected] (J.K. O’Brien).
0093-691X/$ – see front matter # 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2004.04.013
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
247
respectively). These data indicate the potential for high-purity sorting of spermatozoa from nonhuman primates. # 2004 Elsevier Inc. All rights reserved. Keywords: Sperm sorting; Sperm sexing; Sex pre-determination; Flow cytometry; Primates
1. Introduction In conjunction with assisted reproductive technology, sex pre-selection of offspring through the use of sexed spermatozoa [1] has great potential as a captive population management strategy for wildlife species, particularly those with single-sex dominated social structures [2]. Birth of normal offspring using spermatozoa sorted by flow cytometry has been achieved in numerous domestic species [3–5], humans [6–8] and in one wildlife species, the elk (Cervus elaphus nelsoni, [9]). Although sperm sorting methods have been developed for one primate, the human [8,10], there exists great variation in gamete physiology among primates, and species-specific protocols for sperm staining, sorting and preservation will be required. Reanalysis of sorted samples (sort reanalysis [11]) using the flow cytometer is the standard method for evaluation of accuracy of sorting and can be performed in a short interval (30 min) and at low additional cost. However, sort reanalysis results may not be consistently accurate for species where the DNA content difference between X and Y chromosome-bearing spermatozoa is <3.0% [11]. Sort reanalysis results can be validated by single sperm analysis using fluorescence in situ hybridization (FISH, [11]) or the polymerase chain reaction (PCR, [12]) using probes/primers specific to the X and/or Y chromosome(s). These techniques have been used in humans to assess accuracy of sorting [8,10] and in a western lowland gorilla (Gorilla gorilla gorilla) to determine fetal sex [13]. The feasibility of using FISH probes labeling specific loci on human chromosomes for identification of chromosomes in spermatozoa of other primates has not been investigated. The goal of this research was to establish basic flow cytometry parameters and methodologies for sorting sperm nuclei in several non-human primate species. Specific objectives were to: (i) determine the difference in DNA content between X- and Y-bearing sperm nuclei (ii) sort sperm nuclei into X- and Y-enriched samples; and (iii) assess the accuracy of sorting using sort reanalysis and FISH.
2. Materials and methods Procedures described herein were approved by The University of Sydney’s Animal Ethics Committee. 2.1. Study design Four primate species representing new world monkeys (common marmoset, Callithrix jacchus, n ¼ 2), old world monkeys (hamadryas baboon, Papio hamadryas, n ¼ 7), great
248
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
apes (common chimpanzee, Pan troglodytes, n ¼ 2) and the human (Homo sapiens, n ¼ 1) were examined. All analyses were performed using sperm nuclei rather than whole spermatozoa. This homogenous preparation enabled more accurate determination of DNA content of X- and Y-bearing spermatozoa by minimizing interference of sperm nuclei alignment by the midpiece and tail. 2.2. Reagents and media All chemicals were of analytical grade. Unless otherwise stated, all media components were purchased from Sigma–Aldrich (Sigma, St. Louis, MO, USA), and were prepared with embryo grade water (ThermoTrace, Noble Park, Victoria, Australia). The majority of disposable plastic ware was purchased from Becton Dickinson (Franklin Lakes, NJ, USA). 2.3. Collection of spermatozoa Marmoset epididymal spermatozoa were collected postmortem from two males (aged 2 and 4 years). Hamadryas baboon spermatozoa were collected from seven males (aged 7 years) by electroejaculation (EEJ). Chimpanzee spermatozoa were collected from two males (aged 8 and 13 years) by EEJ or postmortem. Human spermatozoa were collected from one male by masturbation. Epididymal spermatozoa from the chimpanzee and marmosets were obtained within 4 h postmortem. The testes and epididymides were dissected from the animals and held at 21 8C during sperm collection. Vas deferens and cauda epididymides were dissected from surrounding connective tissue and blood vessels. Epididymal tubules were pierced repeatedly by fine forceps and the sperm suspension was extruded using forceps. For all species, spermatozoa were collected in a HEPES-buffered TALP medium (HEPESTALP) containing 0.3%, w/v BSA (Sigma A-9647) and the final sperm sample was filtered using 5 mL tubes with cell-strainer caps (35 mm, Falcon 2235). For samples collected by EEJ, males were anaesthetised with either ketamine (baboon; 5–8 mg/kg, Ketamil, Ilium, Troy Laboratories, Smithfield, NSW, Australia) or tiletamine and zolazepam (chimpanzee; 4.3 mg/kg, Zoletil1, Virbac Australia Pty Ltd., Peakhurst, NSW, Australia) and EEJ performed using a 220 V ac electroejaculator and a lubricated rectal probe (baboon: 24 cm 1.5 cm; chimpanzee: 25 cm 2.5 cm) containing electrodes positioned at 30, 90 and 1508 (baboon, 4 cm 0.4 cm; chimpanzee: 5 cm 0.5 cm; PT Electronics, Boring, OR, USA). Two or three sets of stimulations were performed, with each set comprising 20–40 stimulations. During the stimulatory cycle, voltage (2–12 V) was increased in a step-wise manner to elicit ejaculation. 2.4. Preparation of sperm nuclei samples Sperm suspensions (1–2 mL) were sonicated using a Branson Sonifier 250 (Branson Ultasonics, Danbury, CT, USA) at 60% power until >95% of midpieces and tails had been removed (approximately 10–20 s). Following sonication, samples were centrifuged at 1200 g for 30 min on a Percoll gradient (2 mL 90%; 1 mL 67.5%; 1 mL 45%; D.L. Garner, unpublished) and the pellet resuspended in HEPES-TALP or a medium containing
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
249
300.0 mM Tris (hydroxymethyl)aminomethane, 27.8 mM fructose, 94.7 mM citrate (monohydrate), 87.9 IU/mL penicillin-G and 35.3 IU/mL streptomycin sulfate (TFC medium; modified from [14]) supplemented with 0.3%, w/v BSA (Sigma A-9647). Osmolality was 300 10 mosm/kg and pH was 7.2 0.2 for HEPES-TALP and TFC media. Final cell concentration was adjusted to 20 106 sperm nuclei/mL and samples were then stained with 17.8 mM H33342, incubated at 34 8C for 1 h and filtered (35 mm). Stained sperm nuclei samples were stored protected from light at 4 8C prior to analysis (up to 3 months). 2.5. Flow cytometric sorting A high-speed cell sorter (MoFlo SX1, DakoCytomation, Fort Collins, CO, USA) modified for sperm sorting [15,16] operating at 50 psi was used to analyse and separate sperm nuclei. Sheath fluid was TFC medium. H33342 was excited by UV light (351, 364 nm multi-line) from an argon ion laser running at 200 mW. Sperm nuclei were sorted into 10 mL centrifuge tubes (pre-soaked overnight with TFC with 0.1%, w/v BSA) containing 1 mL of TFC medium with 0.3%, w/v BSA. High purity sorting was performed by placing sort gates on the oriented population (sperm nuclei with their flat surface oriented towards the laser beam) to achieve purities of >90% X- or Y-bearing sperm nuclei. 2.6. Determination of difference in DNA content Fluorescence intensity of X- and Y-bearing sperm nuclei populations was measured using the MoFlo SX1 (12,000 events per male; three replicates per male). Difference in DNA content (percentage separation of the fluorescent peaks representing the two populations) was then calculated using the formula: XY Difference ¼ 100 0:5ðX þ YÞ where X ¼ X-bearing sperm nuclei mean fluorescence and Y ¼ Y-bearing sperm nuclei mean fluorescence [17]. 2.7. Assessment of sperm sorting accuracy Reanalysis of sorted samples (sort reanalysis) and FISH were used to evaluate accuracy of sorting. For sort reanalysis, an aliquot of the sorted sample containing 5 106 sperm nuclei was re-stained with 36 mM H33342, incubated for 20 min, sonicated then analyzed (50–100 sperm nuclei/s) using the MoFlo SX1 (10,000 events analyzed per sample). The proportions of X- and Y-bearing spermatozoa were determined by a mathematical model [11]. For FISH, an aliquot containing at least 5 104 sperm nuclei was fixed (methanol:acetic acid; 3:1, v/v) on pre-cleaned glass slides (pre-soaked in methanol for at least 12 h). Sperm DNA was decondensed (50 mM dithiothreitol at 39 8C for 15 min), rinsed in water, dehydrated through an ethanol series (70, 90 and 100%, v/v), air-dried and stored at 4 8C (for up to 2 months) then in situ hybridized with either MultiVision PGT probe
250
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
(consisting of five probes labeling specific loci on human chromosomes 13, 18, 21, X and Y; Vysis Inc., Downers Grove, IL, USA [18]) (human, chimpanzee) or a probe mixture (baboon, marmoset) consisting of a chromosome 21 specific probe (Vysis Inc.) and a probe recognizing a centromeric Y chromosome repeat (Y chromosome-specific probe, prepared by our laboratory). The probe mixture was overlaid with a glass coverslip and edges were sealed with rubber cement. Hybridization comprised treatment of sperm nuclei at 78 8C for 3 min (DNA denaturation), followed by 30 8C for 24 h. The rubber cement and coverslip were then removed and slides were washed in 50% formamide in 2 SSC (0.3 mM NaCl, 30 mM sodium citrate; 42 8C for 10 min), then 2 SSC (42 8C for 10 min) and 2 SSC containing 0.01%, w/v NP40 (non-ionic detergent, Boehringer, Mannheim, Germany; 42 8C for 5 min). Three microlitres of antifade solution (Vysis) were placed over the hybridized region, overlaid with a glass coverslip and sealed with finger nail varnish. Five hundred sperm nuclei per sample were examined using an Olympus BX60 System Microscope (magnification, 2000) equipped with single-band pass filters for spectrum blue, aqua, yellow, green, red (Vysis Inc.). Micrographs were taken using Cytovision 2.81 Build 7 software. 2.8. Preparation of the marmoset and baboon Y chromosome-specific probe Marmoset or baboon DNA was extracted using DNA extraction kit (Roche, Mannheim, Germany) according to manufacturer’s instructions. Ten nanograms of DNA was used for PCR in a final PCR reaction volume of 50 mL containing 1.6 mM MgCl2, 50 mM KCl, 10 mM Tris–HCl (pH 8.3), 0.2 mM dNTP, 1.5 U AmpliTaq DNA polymerase or 1.5 U AmpliTaq gold DNA polymerase (all reagents supplied by Applied Biosystems, Foster City, CA, USA) and 0.4 mM each of a specific primer pair. The thermal cycling was conducted in an Eppendorf thermal reactor. Primers were designed against human chromosome Y alphoid satellite DNA (dyz3-F tctgagacacttctttgtgg, dyz3-R gtgacgatatttccttttcc); 0.5 mg of yielded PCR product DNA was labeled using a hexanucleotide mix (Roche) with modification. A 20 mL reaction was set up containing 0.5 mg of PCR product and a 2.5 hexanucleotide mix (final concentration), 2 mL of dNTP mix (0.5 mM dATP, 0.5 mM dCTP, 0.5 mM dGTP, 0.5 mM dTTP in molecular grade water), 0.25 mL of 1 mM tetremethy-rhodamine-5-dUTP (Roche) or 0.4 mL of 1 mM fluorescein-12-dUTP (Roche) and 2 mL of 2 units/mL Klenow enzyme (Roche). The reaction was incubated overnight at 37 8C and stopped by heating at 92 8C for 10 min. Unincorporated nucleotides were removed by ethanol precipitation. This was achieved by adding 1/10 volume of 3 M sodium acetate and 2.5 vol. of 100% ethanol, incubating at 70 8C for 30 min and then centrifuging for 15 min at 10,000 g. The pellet was then washed with 70% ethanol and allowed to air dry. Labeled and precipitated DNA was then diluted in 10 mL of hybridization mix (50% formamide, 6 SSC, 0.5% SDS, 5 Denhardt’s, Sigma). The probe’s Y chromosome specificity was confirmed by hybridization against human metaphase spread chromosomes (Fig. 1). 2.9. Statistical analysis The proportions of X- and Y-labeled sperm nuclei after FISH of control (unsorted) samples were compared to a 50:50 distribution using the Chi-square test. Statistical
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
251
Fig. 1. Y chromosome-specific marmoset probe (labeled with rhodamine) hybridized to a human metaphase chromosome spread prepared from white blood cells. Original magnification 2000.
differences in the proportions of X- and Y-sperm nuclei from sort reanalysis and FISH procedures were determined by the Chi-square test. For all analyses, P < 0.05 was considered significant.
3. Results The mean percentage difference in DNA content between X and Y-bearing spermatozoa was higher for monkey species (marmoset and baboon) compared to the chimpanzee and human (Table 1). Table 1 Percentage difference (mean S.E.M.) in DNA content between X and Y chromosome-bearing sperm nuclei as determined by flow cytometric analysis of Hoechst 33342-stained samples Sperm nuclei sample (number of males)
Difference (%) in DNA content between X and Y chromosome-bearing sperm nuclei
Marmoset (n ¼ 2) Baboon (n ¼ 7) Chimpanzee (n ¼ 2) Human (n ¼ 1)
4.09 4.20 3.30 2.97
0.03 0.03 0.01 0.05
252
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Sperm nuclei samples from all species could be resolved into two populations representing X- and Y-bearing spermatozoa, and the co-efficient of variation (CV) of X- and Ysperm populations selected for sorting ranged from 1.6 to 2.1%. Good resolution of X- and Y-sperm nuclei populations was achieved for marmoset and baboon samples (Fig. 2a and b). Although X and Y populations were observed for chimpanzee and human samples (Fig. 2c and d), resolution (as indicated by the depth of the split on the histogram output) was poorer than that achieved for the two monkey species. An example of the dotplot and histogram outputs obtained during the reanalysis of X- and Y-enriched sperm nuclei is presented for the baboon (Fig. 3; for all species the CVof the reanalyzed population ranged from 0.92 to 1.0%). The percentages of correctly-oriented sperm nuclei for marmoset, baboon, chimpanzee and human samples were 80 5, 75 5, 60 5 and 60%, respectively. Sorting rates were high for samples from marmosets and baboons (3040 760 and 3966 580 sperm head/s, respectively) and moderate for the chimpanzee and human (1450 120 and 1355 sperm nuclei/s, respectively). Of the five human chromosome-specific probes used successfully with human sperm DNA (Fig. 4), hybridization signals in chimpanzee sperm DNA were observed for chromosomes 18, 21 and X (Fig. 5). When hybridized with human chromosome-specific probes, marmoset and baboon sperm nuclei displayed signals only for chromosome 21. Therefore, an in-house probe mixture was created using marmoset and baboon DNA. Hybridization of marmoset and baboon sperm nuclei with the in-house probe resulted in signals for chromosome Y and 21 (Fig. 6). Hybridization efficiency was high for all probes (97.3 3.1%). Sort reanalysis and FISH results were similar and combined data for all species revealed high levels of purity for X- and Y-enriched samples (Table 2). Percentages of X- and Ylabeled sperm nuclei after FISH of control (unsorted) samples were not different from a 50:50 distribution.
4. Discussion Pre-determination of sex by artificial insemination or in vitro fertilization with sexed spermatozoa represents an alternative population management strategy that could be Table 2 Comparison (mean S.E.M.) of sort reanalysis and FISH techniques for evaluation of sorting accuracy of Xenriched (X-sort) and Y-enriched (Y-sort) samples Sperm nuclei sample (number of males)
Sort reanalysis
FISH
X-sort (%X)
Y-sort (%Y)
X-sort (%X)
Y-sort (%Y)
Control (unsorted) (%X:%Y)
Baboon (n ¼ 7) Marmoset (n ¼ 2) Chimpanzee (n ¼ 2) Human (n ¼ 1)
94 0.7 92 0.5 92 1.0 94
94 0.5 95 1.0 91 1.5 94
94 0.4 93 1.0 97 1.0 92
93 0.5 94 1.5 96 1.0 94
51 0.3:49 0.3 53 1.0:47 1.0 53 1.0:47 1.0 51:49
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
253
Fig. 2. Flow cytometric dotplot and histogram outputs showing fluorescent signals generated by marmoset (a) baboon (b) chimpanzee (c) and human (d) X and Y chromosome-bearing sperm nuclei. Fluorescent signals from correctly-oriented sperm nuclei shown in region 1 (R1) of the dotplot output are displayed in the histogram output.
254
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Fig. 2. (Continued ).
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
255
Fig. 3. Flow cytometric dotplot and histogram outputs from the sort reanalysis procedure showing fluorescent signals generated by baboon X and Y chromosome-bearing sperm nuclei from (a) X-sperm (X ¼ 93%) and (b) Y-sperm (Y ¼ 95%) enriched samples. Fluorescent signals from correctly-oriented sperm nuclei shown in region 1 (R1) of the dotplot output were analyzed for purity (displayed in the histogram output).
256
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
Fig. 4. Decondensed X and Y chromosome-bearing human sperm nuclei hybridized with Multivision PGT probes specific for chromosomes X (violet blue) Y (yellow) 13 (red) 18 (aqua) and 21 (green). Original magnification 2000.
incorporated into captive breeding programs for species with single-sex dominated social structures. In conjunction with appropriate genetic management, this combined approach could allow wildlife managers to optimize reproductive performance within a breeding population and meet management requirements of these species. The results of this study provide information on basic parameters for the sorting of non-human primate spermatozoa and represent the first step in establishing sperm sexing technology for non-human primate species. To validate sort reanalysis results, fluorescence in situ hybridization technology developed in humans was applied directly to the chimpanzee and modified for application to spermatozoa from marmosets and baboons. Sort reanalysis and FISH results were similar
Fig. 5. Decondensed X and Y chromosome-bearing chimpanzee sperm nuclei hybridized with Multivision PGT probes specific for chromosomes X (violet blue, arrow) 13 (red) and 21 (green). Original magnification 2000.
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
257
Fig. 6. Decondensed X and Y chromosome-bearing baboon (a) and marmoset (b) sperm nuclei hybridized with Multivision PGT centromeric probe specific for chromosome 21 (orange) and with an in-house probe recognizing a centromeric Y chromosome repeat (violet blue, arrow). Original magnification 2000.
for all non-human and human spermatozoa examined, despite a low difference in DNA content between X and Y spermatozoa in the latter (2.9%). Good resolution of X and Y sperm populations was obtained for all species, so it was not surprising that sort reanalysis and FISH results were similar. The MultiVision PGT five probe mix contains human DNA sequences homologous to locus-specific regions on chromosomes 13 and 21 and centromeric regions on chromosomes 18, X and Y. Although approximately 95% of the chimpanzee genome is identical to that of humans [19], no probe hybridization signals were seen for chromosomes 13 and Y. The failure of hybridization of the chromosome 13 locus-specific probe was not further investigated since the probe signal was considered extraneous to our requirements and the remaining autosomal probes (chromosomes 18 and 21) could serve as a positive hybridization control in the subsequent assay. The lack of hybridization with the centromeric Y chromosome probe was not expected, given the high homology of alphoid DNA in man and
258
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
monkeys [20], although a similar failure of this Y chromosome probe to hybridize on gorilla prenatal samples was reported previously [13]. The X and Y chromosome probes also failed to hybridize with the marmoset and baboon samples, but the positive signal for the chromosome 21 locus-specific probe on the decondensed sperm DNA confirmed the suitability of the DNA preparation method for in situ hybridization. Thereafter, a Y chromosome-specific probe was successfully prepared by amplifying alphoid DNA from marmoset and baboon DNA. Sequence similarity of the region among primate species enabled the primers to be designed using known human homologue DNA sequences. The use of a DNA template from the targeted species gave us the ability to develop probes specific to the monkey species investigated in this study. Among the primate species examined in this study, flow cytometric analysis revealed a large variation in the difference in DNA content between X and Y spermatozoa (from 2.9% (human) to 4.2% (baboon)). The difference in DNA content between X and Y spermatozoa is dependent on the relative sizes of the X and Y chromosome and the total DNA content per spermatozoon, as determined by chromosome number, size and morphology. Variation in the difference in DNA content between X and Y spermatozoa is expected among primate species, since there is great diversity in diploid chromosome number, chromosome size and morphology [21]. For whole spermatozoa, the rate of sorting is mainly dependent on sperm orientation, difference in DNA content between X and Y spermatozoa, and the proportion of viable spermatozoa. Our results using sperm nuclei demonstrated that higher sorting rates were obtained with the marmoset and baboon compared to the chimpanzee and human. These species had a higher proportion of correctly-oriented spermatozoa and a greater difference in DNA content between X and Y spermatozoa than the chimpanzee and human. This suggests higher sorting rates would be achieved with intact spermatozoa from the marmoset and baboon compared with the chimpanzee, but the ultimate sorting rate would also be dependent on the number of viable spermatozoa available for sorting. Validated methodologies are now available for high-purity sorting of X- and Y-bearing sperm nuclei samples in non-human primate species. These data indicate the potential for high purity sorting of spermatozoa from non-human primates. Providing that adequate resolution of X and Y sperm populations can be achieved, these results imply that the accuracy of sorting whole spermatozoa from the primate species in this study may be assessed by using sort reanalysis alone. Research into the quality of sorted spermatozoa following species-specific staining and sorting protocols is now required to enable the successful application of sperm sorting technology in non-human primates.
Acknowledgements This research was supported by XY Inc. (Fort Collins, CO, USA), Zoological Parks Board of NSW and Australian Research Council. The authors thank XY, Inc.’s K.M. Evans and the University of Sydney’s L. He and R. Wadley for assistance with sorting, and A. Birrell, (Royal Prince Alfred Hospital), R. Bathgate, B.M. Eriksson, J.R. Potas, P.R. Martin, S.G. Solomon (University of Sydney) and staff at the Life Sciences Division,
J.K. O’Brien et al. / Theriogenology 63 (2005) 246–259
259
Veterinary Quarantine Centre, and African Division (Taronga Zoo) for assistance with collection of spermatozoa. References [1] Johnson LA, Flook JP, Hawk HW. Sex pre-selection in rabbits: live births from X- and Y-sperm separated by DNA and cell sorting. Biol Reprod 1989;41:199–203. [2] O’Brien JK, Crichton EG, Evans KM, Schenk JL, Stojanov T, Evans G, et al. Sex ratio modification using sperm sorting and assisted reproductive technology—a population management strategy. In: Proceedings of the second international symposium of assisted reproductive technologies for the conservation and genetic management of wildlife. Omaha: Nebraska; 28–29 September 2002, pp. 224–31. [3] Johnson LA. Sexing mammalian sperm for production of offspring: the state-of-the-art. Anim Reprod Sci 2000;60–61:93–107. [4] Garner DL. Sex-sorting mammalian sperm: concept to application in animals. J Androl 2001;22:519–26. [5] Seidel Jr GE, Garner DL. Current status of sexing mammalian spermatozoa. Reproduction 2002;124:733–43. [6] Levinson G, Keyvanfar K, Wu JC, Fugger EF, Fields RA, Harton GL, et al. DNA-based X-enriched sperm separation as an adjunct to preimplantation genetic testing for the prevention of X-linked disease. Hum Reprod 1995;10:979–82. [7] Fugger EF, Black SH, Keyvanfar K, Schulman JD. Births of normal daughters after MicroSort sperm separation and intrauterine insemination, in vitro fertilization, or intracytoplasmic sperm injection. Hum Reprod 1998;13:2267–70. [8] Fugger EF. Clinical experience with flow cytometric separation of human X- and Y-chromosome bearing sperm. Theriogenology 1999;52:1435–40. [9] Schenk JL, DeGrofft DL. Insemination of cow elk with sexed frozen semen. Theriogenology 2003;59:514, abstract. [10] Johnson LA, Welch GR, Keyvanfar K, Dorfmann A, Fugger EF, Schulman JD. Gender preselection in humans? Flow cytometric separation of X and Y spermatozoa for the prevention of X-linked diseases. Hum Reprod 1993;8:1733–9. [11] Welch GR, Johnson LA. Sex preselection: laboratory validation of the sperm sex ratio of flow sorted Xand Y-sperm by sort re-analysis for DNA. Theriogenology 1999;52:1343–52. [12] Welch GR, Waldbieser GC, Wall RJ, Johnson LA. Flow cytometric sperm sorting and PCR to confirm separation of X- and Y-chromosome-bearing bovine sperm. Anim Biotechnol 1997;6:131–9. [13] Ramsay PA, Boardman W, MacDonald B, Roberts C, Fraser IS. Chorionic villus sampling for sex determination in a western lowland gorilla (Gorilla gorilla gorilla). J Zoo Wildlife Med 2000;31:532–8. [14] Evans G, Maxwell WMC. Salamon’s artificial insemination of sheep and goats. Sydney: Butterworths; 1987. [15] Rens W, Welch GR, Johnson LA. A novel nozzle for more efficient sperm orientation to improve sorting efficiency of X and Y chromosome-bearing sperm. Cytometry 1998;33:476–81. [16] Johnson LA, Welch GR. Sex preselection: high speed flow cytometric sorting of X and Y sperm for maximum efficiency. Theriogenology 1999;52:1323–41. [17] Garner DL, Gledhill BL, Pinkel D, Lake S, Stephenson D, Van Dilla MA, et al. Quantification of the Xand Y-chromosome-bearing spermatozoa of domestic animals by flow cytometry. Biol Reprod 1983;28:312–21. [18] Van Dyk Q, Lanzendorf S, Kolm P, Hodgen GD, Mahony MC. Incidence of aneuploid spermatozoa from subfertile men: selected with motility versus hemizona-bound. Hum Reprod 2000;15:1529–36. [19] Britten RJ. Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. Proc Natl Acad Sci USA 2002;99:13633–5. [20] Musich PR, Brown FL, Maio JJ. Highly repetitive component alpha and related alphoid DNAs in man and monkeys. Chromosoma 1980;80:331–48. [21] Chiarelli AB. Comparative cytogenetics in primates and its relevance for human cytogenetics. In: Chiarelli AB, editor. Comparative genetics in monkeys, apes and man. London/New York: Academic Press; 1971. pp. 273–308.