- Email: [email protected]
Flufenamic acid inhibits osteoclast formation and bone resorption and act against estrogen-dependent bone loss in mice
International Immunopharmacology xxx (xxxx) xxxx
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Flufenamic acid inhibits osteoclast formation and bone resorption and act against estrogen-dependent bone loss in mice ⁎
Shutao Zhanga,1, Shicheng Huoa,1, Hui Lia, Haozheng Tanga, Bin'en Niea, Xinhua Qua, , ⁎ Bing Yuea, a
Department of Bone and Joint Surgery, Renji Hospital, School of Medicine, Shanghai Jiaotong University, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Flufenamic acid Osteoclast differentiation Osteoporosis MAPK RNA-Seq
Postmenopausal osteoporosis is one of the most common types of osteoporosis resulting from estrogen deficiency in elderly women. Nonsteroidal anti-inflammatory drugs (NSAIDs) are important drugs for pain relief in patients with osteoporosis. In this study, we report for the first time that flufenamic acid, a clinically approved and widely used NSAID, not only has analgesic properties but also shows a significant effect in terms of preventing postmenopausal osteoporosis. Quantitative RT-PCR analysis showed that treatment with flufenamic acid significantly downregulated the genes associated with osteoclast differentiation. Meanwhile, RNA-sequencing and western blot analyses suggested that flufenamic acid could inhibit the bone resorption by suppressing the phosphorylation of MAPK pathways. Moreover, an ovariectomy (OVX)-induced bone-loss mouse model indicated that flufenamic acid might be a potent drug for preventing osteoporotic fractures, as verified by microCT scanning and histological analysis. Therefore, this study proposes an attractive and potent drug with analgesic properties for the prevention of postmenopausal osteoporosis.
1. Introduction Osteoporosis is a metabolic bone disorder that is accompanied by micro-architectural deterioration of bone tissue and low bone mineral density [1]. Postmenopausal osteoporosis is one of the most common types of osteoporosis, resulting from estrogen deficiency in elderly women. The declining estrogen levels at menopause lead to an increased rate of bone turnover; especially the rate of bone resorption is significantly greater than that of bone formation [2–4]. This imbalance in bone remodeling might lead to loss of connectivity in trabecular bone and porosity of cortical bone, with a subsequent increase in bone fragility and susceptibility to fractures [5,6]. Every year, there are 1.5 million cases of osteoporotic fractures in the United States, with an annual direct cost of nearly $18 billion [7,8]. Although the incidence of fractures varies greatly by country, on average, up to 50% of women over the age of 50 are at the risk of such fractures [1]. Therefore, osteoporotic fractures impose a considerable financial burden on health services in the worldwide. Multinucleated osteoclasts originating from bone marrow monocytes/macrophages (BMMs), and it is an indispensable regulator for bone resorption. They dissolve the organic and mineral components of
bone by secreting acids and proteases [9–11]. The differentiation and function of osteoclasts are regulated by various growth factors, hormones, and cytokines, including macrophage colony stimulating factor (M-CSF) and receptor activator of nuclear factor κ-B ligand (RANKL) [12,13]. It has been demonstrated that mitogen-activated protein kinases (MAPK) represent an important pathway for the signaling transmission of extracellular stimuli. In addition, the phosphorylation of MAPK has been shown to regulate osteoclast precursor proliferation, adhesion, and cell-cell fusion, as well as the migration, survival, and bone resorption capacity of mature osteoclasts [14–16]. Furthermore, genes associated with osteoclast differentiation and function, such as tartrate-resistant acid phosphatase (TRAP), nuclear factor-activated T cells c1 (NFATc1), cathepsin K, V-ATPase, and c-Fos, are also significantly elevated after signal transduction cascades [17–19]. Nonsteroidal anti-inflammatory drugs (NSAIDs) are important agents for pain relief in patients with osteoporosis [20]. In the United States, NSAIDs account for around 70 million prescriptions, and 30 billion over-the-counter (OTC) medications are sold annually [21]. As the cyclooxygenase (COX) pathway has an integrated role in the inflammatory processes and biochemical recognition of pain, NSAIDs serve as efficient inhibitors of pain and inflammation [22]. During the
⁎
Corresponding authors. E-mail addresses: [email protected] (X. Qu), [email protected] (B. Yue). 1 Shutao Zhang and Shicheng Huo contributed equally to this work. https://doi.org/10.1016/j.intimp.2019.106014 Received 5 July 2019; Received in revised form 14 October 2019; Accepted 28 October 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.
Please cite this article as: Shutao Zhang, et al., International Immunopharmacology, https://doi.org/10.1016/j.intimp.2019.106014
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
and stained for TRAP. The number of TRAP-positive cells with more than three nuclei was calculated.
past decades, several studies have suggested that NSAIDs usage in postmenopausal women who do not receive estrogen replacement could contribute to an increased bone mineral density [23–25]. This surprising benefit of NSAIDs has attracted much interest in the research community. For example, Celecoxib, a selective COX-2 inhibitor, was shown to drastically inhibit human osteoclast formation and bone resorption in a dose-dependent manner, via modulation of the prostaglandin synthesis enzyme [26]. In addition, indomethacin and parecoxib had also been suggested that it could suppress osteoclast maturation and bone resorption in vitro [27]. However, while these experiments verify the effects of NSAIDs on osteoclasts differentiation in vitro, little research has focused on the protective function of NSAIDs against postmenopausal osteoporosis and the exact mechanism behind it. Therefore, the investigation of these properties is necessary to elucidate the comprehensive functions of NSAIDs. Inspired by the findings above, we investigated whether flufenamic acid (FA), a clinically approved and widely used NSAID, could serve as a promising anti-osteoporosis agent and show protective effects in ovariectomized (OVX) mice. In this study, we report for the first time that flufenamic acid not only has analgesic properties but also helps prevent postmenopausal osteoporosis. A series of in vitro experiments suggest that flufenamic acid could obstruct the maturation and resorption of osteoclasts by inhibiting the activation of MAPK pathways. Moreover, an OVX-induced osteoporosis mouse model demonstrated that flufenamic acid is a potent drug for preventing osteoporotic fractures, as indicated by micro-CT scanning and histological analysis. Therefore, our study proposes a potent and promising agent for the treatment of postmenopausal osteoporosis.
2.3. Cytotoxicity assay Cell Counting Kit-8 assay was used to examine the cytotoxic effects of flufenamic acid, according to the manufacturer’s instructions. In brief, BMMs were seeded in a clear 96-well plate at a density of 1.0 × 104 cells per well in triplicate. Next, BMMs were incubated in the presence of 30 ng/mL M-CSF for 24 h under 37 °C and 5% CO2 to allow attachment of cells to the plates. Different concentrations of flufenamic acid (0, 1.95, 3.91, 7.81, 15.63, 31.25, 62.5, 125, 250, 500 µg/mL) were then added to the medium, which was cultured for 24, 48, and 72 h, respectively. At last, every well was added 10 µL of CCK-8 reagent, and the plates were incubated for an additional 2 h under 37 °C and 5% CO2. The optical density (OD) of these samples was recorded at a wavelength of 450 nm (with 650 nm serving as the reference wavelength) on an absorbance microplate reader (Bio-Tek Instruments, Winooski, VT, USA). Cell viability relative to the control group was calculated using the following formula: (experimental group OD - blank OD) / (control group OD - blank OD). The half maximal inhibitory concentration (IC50) was analyzed using GraphPad Prism 7.0 software (San Diego, CA, USA). 2.4. Cell apoptosis assay Cell apoptosis assay was conducted using the Annexin V-FITC/ propidium iodide (PI) Kit (Sangon Biotech, Shanghai, China), according to the manufacturer’s instructions. Briefly, BMMs were exposed to flufenamic acid for 48 and 72 h, at a concentration of 31.25 µg/mL. The cells were then gently washed thrice with PBS buffer and suspended in binding buffer. Next, 5 µL of Annexin V-FITC was added and incubated for 15 min at 37 °C in the dark. Finally, 10 μL of PI was used to stain the nucleus of the treated BMMs. The sample was examined within 4 h and results were analyzed with FlowJo (BD Biosciences).
2. Materials and methods 2.1. Reagents Fetal bovine serum (FBS), alpha-MEM, and penicillin/streptomycin were obtained from Gibco (Rockville, MD, United States). Recombinant mouse M-CSF and RANKL were obtained from R&D Systems (Minneapolis, MN, United States). Triton X-100, dimethyl sulfoxide (DMSO), and tartrate-resistant acid phosphatase (TRAP) staining kit were purchased from Sigma–Aldrich (St. Louis, MO, United States). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technology (Kumamoto, Japan). Rhodamine-labeled phalloidin was purchased from Cytoskeleton Inc. (Denver, CO, United States). Reverse transcription reagents and TB Green PCR Master Mix were obtained from TaKaRa Bio (Otsu, Japan). Primary and secondary antibodies were purchased from Cell Signaling Technology (Beverly, MA, United States). Flufenamic acid was purchased from Dalian Meilun Biotechnology Co.,Ltd (Dalian, China) and dissolved in DMSO.
2.5. Resorption pit assay BMMs were seeded onto bovine bone discs at a density of 1x104 cells/well in a clear 96-well tissue cultured treated plate. The cell cultivated in a complete ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF and 50 ng/mL RANKL for 4 days. Then flufenamic acid was added into the medium with a series of concentrations, including 0, 7.81, 15.63 and 31.25 µg/ml. After mature osteoclasts formed, the bone discs were sonicated to remove the adherent cells and fixed with 2.5% glutaraldehyde. At last, a scanning electron microscope (Hitachi S4800, Tokyo, Japan) was applied to visualize resorption pits and Image J software (Bethesda, MD, USA) was used to analyze the bone resorption area.
2.2. Mouse bone marrow macrophage (BMM) preparation and osteoclast differentiation
2.6. F-actin ring formation assay 4-week-old SPF female C57BL/6 mice were purchased from Jiesijie Experimental Animal Co., Ltd. (Shanghai, China). Primary bone marrow macrophages (BMMs) were extracted as described previously [28]. In brief, cells were isolated from the femoral bone marrow and cultured in ɑ-MEM supplemented with 10% FBS, 1% penicillin/ streptomycin, and 30 ng/mL M-CSF. Following a 24-hour incubation period, the suspension cells were discarded and the anchorage-dependent cells were grown in a 37 °C, 5% CO2 incubator until 90% confluence was obtained. The BMMs were then seeded into a 96-well plate at a density of 1 × 104 cells/ well and cultured in ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF, and 50 ng/mL RANKL, along with varying dose of flufenamic acid (0, 7.81, 15.63, and 31.25 µg/mL). The culture medium was replaced every other day until multinucleate osteoclasts were formed. Next, PBS buffer was used to wash the cells three times. Then, the osteoclasts were fixed with 4% paraformaldehyde for 15 min,
For the F-actin ring formation assay, flufenamic acid treated osteoclasts were fixed for 15 min with 4% paraformaldehyde and permeabilized for 5 min with 0.1% Triton X-100. They were then washed thrice with PBS buffer and incubated with a 1:500 dilution of the rhodamine -labeled phalloidin for 1 h at 37 °C in the dark. Finally, the nucleus was counterstained with DAPI and the stained cells were visualized using a fluorescence microscope (OLYMPUS, DP70, Tokyo, Japan) 2.7. RNA isolation and quantitative RT-PCR BMMs were seeded at 10 × 104 cells/ well in 24-well tissue cultured treated plates, and cultured in ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF, and 50 ng/mL RANKL. Next, the cells were 2
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
China) for 20 min, and then incubated with primary antibodies at 4 °C for 12 h. Next, the membranes were washed and incubated with the appropriate secondary antibodies. At last, the membranes were visualized using an Immobilon Western chemiluminescent HRP substrate (Millipore, Billerica, MA, USA). Quantitative analysis of the band intensity was carried out using the ImageJ software.
Table 1 Primers used in this study. Target gene
direction
Primer sequence (5′to 3′)
GAPDH
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC CTTCCAATACGTGCAGCAGA TCTTCAGGGCTTTCTCGTTC CGGGTTTCAACGCCGACTA TGGCACTAGAGACGGACAGAT CTGGAGTGCACGATGCCAGCGACA TCCGTGCTCGGCGATGGACCAGA AAGCCTTTGTTTGACGCTGT TTCGATGCCTCTGTGAGATG AAAACCCTTGGGCTGTTCTT AATCATGGACGACTCCTTGG CCGTTGCTTCCAGAAAATAACA TGTGGGATGTGAACTCGGAA
CTSK c-Fos TRAP VATPs-d2 DC-STAMP NFATc1
2.10. OVX-induced osteoporosis model All animal experiments were conducted in accordance with the guidelines and procedures approved by the Animal Care Committee at Renji Hospital, Shanghai Jiaotong University School of Medicine. Briefly, 20 SPF female C57BL/6 mice, with an age of 12 weeks, were randomly divided into four groups: sham (only injection with saline), vehicle (OVX and saline injection), low-dose flufenamic acid (OVX and 15 mg/kg flufenamic acid injection), and high-dose flufenamic acid (OVX and 30 mg/kg flufenamic acid injection). Next, the mice were subjected to either a bilateral ovariectomy (OVX) or a sham operation after generally anesthetized. Then, the incision was closed and mice were allowed to recover for 4 days. Flufenamic acid was injected intraperitoneally with every other day for 4 weeks and mice were weighed weekly. At the end of time, all the mice were sacrificed and their femur was harvested for micro-CT analysis and histological studies.
administered with either different concentrations of flufenamic acid (0, 7.81, 15.63, and 31.25 µg/mL) for 5 days or 31.25 µg/mL flufenamic acid for 1, 3, or 5 days. For total RNA extraction from BMMs, we used the RNeasy Mini kit (Qiagen). The RNA extraction was performed following the manufacturer’s instructions, and 1 μg of total RNA was applied to synthesize cDNA using the Primescript RT Master Kit, according to the manufacturer’s instructions. Primers (obtained from Sangon Biotech) used for quantitative RT–PCR are shown in Table 1. A TB Green Premix Ex Taq™ Kit was used to prepare the PCR reaction mixture, and the PCR amplification was set with the following parameters: initial denaturation at 95 °C (30 s), followed by 40 cycles at 95 °C (5 s), 60 °C (30 s), and 72 °C (45 s). The process of quantitative RTPCR was detected using ABI Prism 7500 (Applied Biosystems, Foster City, CA, USA). Data was analyzed using the comparative CT method, with GAPDH serving as the control. The results were presented as foldchange relative to the control, which was assigned a value of 1.
2.11. Micro-CT scanning A high-resolution micro-CT scanner was used to examine the microstructure changes of mice femur (SkyScan 1172, Kontich, Belgium). The equipment was set with the following parameters: 80 kV, 112 mA, and 9 mm pixel size. For quantitative assessment, bone mineral density (BMD), bone volume/ tissue volume (BV/TV), structure model index (SMI), trabecular separation (Tb.Sp), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were analyzed using the scanner software, following the standardized protocols.
2.8. RNA sequencing transcriptomics
2.12. Histological analysis
The gene expression of BMMs treated with flufenamic acid (31.25 µg/mL) or DMSO (control) was determined using RNA-sequencing. Briefly, cells were collected after 5 days of treatment, and three independently prepared RNA samples from each group were used for RNA-Sequencing. Illumina sequencing was performed by OE biotech Co., Ltd. (Shanghai, China) using the Illumina HiseqTM 2500 (Illumina, Inc.). The data analyses were performed using edgeR software and statistical significance was defined as p values smaller than 0.05.
The fixed femurs were decalcified in 10% EDTA for about 4 weeks and subsequently embedded in paraffin. Next, the samples were subjected to hematoxylin and eosin (H&E) and TRAP staining. Finally, the slices were observed under a high-quality microscope. The number of TRAP + osteoclasts (N.Oc/BS, 1/mm) and the percentage of osteoclast surface per bone surface (OcS/BS, %) were analyzed for each sample. 2.13. Statistical analysis
2.9. Western blotting The data are expressed as means ± SD (standard error of the mean). The results were analyzed using Prism 7 (GraphPad Software Inc, CA, USA). One-way ANOVA and the two-tailed unpaired Student’s t-test were used to compare the groups. P values < 0.05 indicated significant difference.
For examining the signaling pathways affected by flufenamic acid, BMMs were seeded into 6-well plates at a density of 5 × 105 cells/well. After the cells were confluent, they were stimulated with or without flufenamic acid (31.25 µg/mL) for 4 h. Cells were then treated with 50 ng/mL RANKL for 0, 5, 10, 20, or 30 min. To determine the effect of flufenamic acid on NFATc1, BMMs were treated with 30 ng/mL M-CSF, 50 ng/mL RANKL, with or without flufenamic acid (31.25 µg/mL) for 1, 3, or 5 days. Total protein was extracted from cultured cells using radio immunoprecipitation assay (RIPA) lysis buffer (Beyotime Biotechnology, Shanghai, China) containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and protease inhibitor cocktail. Lysates were centrifuged at 4 °C, 12,000 g for 20 min, and the supernatants were collected. Protein concentrations were detected using a bicinchoninic acid protein assay (BCA, Thermo Fisher, MA, USA). Proteins were separated in 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). Following transfer, the membranes were incubated with QuickBlock™ Blocking Buffer (Beyotime Biotechnology, Shanghai,
3. Results 3.1. Flufenamic acid treatment was safe for BMMs To determine whether the inhibitory concentration of flufenamic acid on osteoclast differentiation could lead to cell death or apoptosis, we performed a CCK-8 assay and flow cytometry analysis. As shown in Fig. 1A-B, flufenamic acid treatment did not exhibit any significant inhibition in growth at a concentration of up to 31.25 μg/mL. Even when the treatment duration was extended to 72 h, no significant difference in cell viability was observed relative to the control group. Furthermore, as shown in Fig. 1C, the results of apoptosis assay indicated that flufenamic acid at a concentration of 31.25 μg/mL did not 3
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 1. Flufenamic acid did not inhibit cell viability at concentrations that affect osteoclast differentiation. (A) BMMs treated with different concentration of flufenamic acid for 24, 48 and 72 h and the proliferation were tested by CCK-8 assays. (B) The half maximal inhibitory concentration (IC50) of flufenamic acid at 24, 48 and 72 h was calculated using GraphPad Prism 7.0. (C) Flow cytometry analysis of the apoptosis rate of BMMs treated with flufenamic acid (31.25 μg/mL) for 48 and 72 h.
the surface of bone discs. As shown in Fig. 2C and D, numerous bone resorption pits were detected in the control group, while the resorption area was significantly decreased upon treatment with flufenamic acid, especially at the concentration of 31.25 µg/mL. Furthermore, we used immunofluorescence staining to detect the morphology of F-actin ring. As an integrated and well-polarized F-actin ring is indispensable for osteoclastic bone resorption, the inhibitory effect of flufenamic acid was apparent under the fluorescence microscope. As shown in Fig. 2E, the formation of F-actin ring was drastically reduced compared with the control group, consistent with the results of the scanning electron microscopy. Taken together, these results indicated that flufenamic acid might be a promising compound inhibiting bone resorption, and therefore, could block the osteoclast formation and osteoclastic bone resorption activity in vitro.
increase the proportion of Annexin-V-positive BMMs at both 48 and 72 h of treatment. Therefore, the ability of flufenamic acid to inhibit osteoclast differentiation is not associated with cell apoptosis. Taken together, these results demonstrate that flufenamic acid was safe toward BMMs at the concentration at which it inhibited osteoclast differentiation.
3.2. Flufenamic acid inhibited RANKL-induced osteoclastogenesis and osteoclastic bone resorption As positive TRAP staining is a specific characteristic of mature osteoclasts, we used this assay to determine whether flufenamic acid could efficiently inhibit RANKL-induced osteoclastogenesis at a range of concentrations, including 0, 7.81, 15.63 and 31.25 µg/ml. As shown in Fig. 2A-B, the differentiation of BMMs was significantly impeded in the treatment group, even with the presence of M-CSF and RANKL. Meanwhile, the number of multinucleate osteoclasts declined in a dose-dependent manner in contrast to the control group. As bone resorption is the vital function of osteoclasts, we used devitalized bovine bone discs to explore the mature osteoclast resorption capacity. Flufenamic acid was added in a series of concentration to the culture medium, to block the formation of multinucleate osteoclasts on
3.3. Flufenamic acid obstructed osteoclast differentiation at the transcriptome level The differentially expressed genes of BMMs were analyzed statistically to examine the possible mechanism underlying the inhibitory effect of flufenamic acid. After quantile normalization of the FPKM values followed by Student’s t-test at p = 0.05 and the selection of 4
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 2. Flufenamic acid inhibited RANKL-induced osteoclastogenesis, bone resorption and F-actin ring formation. (A) BMMs were cultured with different concentrations of flufenamic acid, M-CSF, and RANKL for 5 days. Then TRAP staining was applied to observe TRAP- positive multinuclear cells. (B) The number of TRAP positive multinuclear cells were calculated and presented graphically. (C, D) BMMs were seeded on to bone slices and treated with various concentrations of flufenamic acid. Bone resorption pits were examined using Scanning electron microscope (SEM) and the areas of resorption pit were measured using Image J. Data are expressed as means ± SD, (*** p < 0.001.) n = 5. (E) BMMs were cultured with M-CSF and RANKL and stimulated with different concentrations of flufenamic acid. Then BMMs were fixed with paraformaldehyde and stained with DAPI (nuclei) and rhodamine-phalloidin (F-actin).
related to the osteoclast differentiation, underwent significant inhibition. Therefore, we hypothesized that flufenamic acid inhibits the phosphorylation of MAPK to further obstruct the osteoclast maturation.
differentially expressed genes with at least a two-fold change in their expression, we identified 1254 differentially expressed genes (438 upregulated and 816 downregulated) with significant changes before and after the drug treatment. The distribution of differentially expressed gene for both treated and untreated BMMs can be seen in the heatmap and MA plot (Fig. 3A-B). KEGG pathway enrichment analysis is another key method to infer the mechanism of action of flufenamic acid towards BMMs. As shown in Fig. 3C, the pathway associated with signal transduction was downregulated the most, compared with the other genes. Particularly, the mitogen-activated protein kinase (MAPK), an important element
3.4. Flufenamic acid reduced the expression of osteoclast-related genes After the stimulation of RANKL, specific genes associated with the osteoclast activation and differentiation, such as CTSK, DC-STAMP, cFos, VATPs-d2, NFATc1 and TRAP are upregulated. Hence, we utilized real-time RT-PCR to further verify the results of RNA-sequencing. As depicted in Fig. 4A and B, treatment with flufenamic acid caused a 5
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 3. Transcriptome changes in BMMs treated with flufenamic acid or DMSO (control). (A) Cluster analysis of differentially expressed genes. Red indicates a highly expressed gene, and blue indicates a low expressed gene. Each group contains three independent samples. (B) The distribution of differentially expressed genes was exhibited in the MA map. (C) Differentially expressed genes enriched in the KEGG pathway. Upregulated and downregulated differentially expressed genes were shown at KEGG Level 2.
3.6. Flufenamic acid prevented OVX-induced osteoporosis
significant decrease of osteoclast-related gene expression in a time- and dose-dependent manner which was consistent with the RNA-sequencing. Hence, these results demonstrated that flufenamic acid could weaken the osteoclast bone resorption capacity by downregulating the RANKL-induced genes expression.
To investigate the influence of flufenamic acid treatment on estrogen-deficiency-induced osteoporosis, OVX-induced mouse bone loss model was used. As shown in Supplementary Fig. 1, all mice showed a stable weight gain during the 4 weeks of observation, indicating that therapeutic dose of flufenamic acid did not have obvious adverse effects in vivo. After 4 weeks of intraperitoneal injection, mice femurs were isolated and micro-CT was applied to examine the bone loss in the distal femur (Fig. 6A). Compared with the sham group, there was a significant decrease of trabecular bone in vehicle group. As shown in Fig. 6B, we found a reduction in BMD, BV/TV, Tb.Th, and Tb.N, whereas Tb.Sp and SMI were increased. However, there was a significant reversal in these trends upon treatment with flufenamic acid. In the therapeutic group, the values of BMD, BV/TV, Tb.Th, and Tb.N had a significant increase. Furthermore, Hematoxylin and Eosin (H&E) staining demonstrated that flufenamic acid had a beneficial effect on the bone mass (Fig. 6C-D). As indicated by TRAP staining, the number of multinucleated osteoclasts at the growth plates and the percentage of osteoclast surface per bone surface (Oc.S/BS%) had declined significantly in the treatment group compared with the vehicle group. Taken together, these results showed that flufenamic acid efficiently attenuated OVX-induced bone loss through the inhibition of osteoclast formation in vivo.
3.5. Flufenamic acid suppressed the activation of MAPK and NFATc1 To verify the hypothesis that flufenamic acid inhibits osteoclast differentiation and bone resorption by obstructing the phosphorylation of MAPK, we used western blotting to examine the phosphorylation of extracellular signal-regulated kinase (ERK), p38, and Jun kinase (JNK). As shown in Fig. 5A and B, the levels of phosphorylation of ERK and p38 were significantly lower in the flufenamic acid group in contrast to the control sample. However, there was no significant change in the phosphorylation of JNK. In addition, we assessed the expression of NFATc1, which is a vital transcription factor associated with osteoclast differentiation. As shown in Fig. 5C and D, the expression of NFATc1 increased obviously after stimulation of RANKL for 1 day, 3 days, and 5 days. However, the robust expression of NFATc1 was significantly suppressed after the treatment of flufenamic acid. Taken together, the results illustrated that flufenamic acid could inhibit MAPK and NFATc1 activation during osteoclastogenesis, in agreement with the result of RNA-sequencing.
6
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 4. Flufenamic acid inhibited the expression of osteoclast-specific genes. (A) BMMs were cultured with M-CSF and RANKL in the presence of different concentrations of flufenamic acid for 5 days. (B) BMMs were treated with or without 31.25 µg/mL flufenamic acid (FA), for 1, 3, or 5 days respectively. The expression of the osteoclast-specific genes CTSK, c-Fos, TRAP, VATPs-d2, DC-STAMP, and NFATc1 was determined by real-time RT-PCR and the result were normalized to the expression of GAPDH. Data are expressed as means ± SD. n = 3 (*p < 0.05; **p < 0.01; ***p < 0.001.)
4. Discussion
women, has attracted much attention in the context of postmenopausal osteoporosis treatment. Flufenamic acid is a clinically approved drug with anti-inflammatory and analgesic properties, which works by inhibiting the production of prostaglandins. In this study, we demonstrated that flufenamic acid could be a potent drug for preventing osteoporotic fractures in estrogen-deficient patients. In particular, Cell Counting Kit-8 assay and apoptosis detection test were used to demonstrate that flufenamic acid did not alter the viability of BMMs or induce apoptosis in them at concentrations that inhibited osteoclast differentiation. As shown in TRAP- staining assays, flufenamic acid exhibited a significant negative effect on osteoclast differentiation and function. The number of multinucleated cells was significantly reduced in the treatment group relative to the control group, in a dose-dependent manner. Moreover,
Osteoporosis is a metabolic disorder characterized by increased bone fragility and susceptibility to fracture, with decreased bone mineral density and deterioration of bone microstructure [29]. With a steady increase in the number of elderly people, osteoporotic fracture has become a major cause of morbidity and mortality in many countries [30–33]. Although several drugs have been developed for osteoporosis treatment, alternative approaches are still required, owing to the severe side effects of the extant treatments. For example, the intravenous use of bisphosphonates, the most widely prescribed agents in the osteoporosis management, might be associated with osteonecrosis of the jaws [34–36]. Therefore, research on tolerable and multifunctional agents, which both relieve the pain and prevent the fractures in elderly 7
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 5. Flufenamic acid inhibited osteoclast differentiation by suppressing the activation of MAPK and NFATc1. (A) BMMs were cultured with or without 31.25 µg/ mL flufenamic acid (FA) for 4 h and then treated with 50 ng/mL RANKL for the indicated periods. Cell lysates were then subjected to Western blotting analysis for pERK, ERK, p-JNK, JNK, p-p38, p38. (B) The gray levels of phosphorylated ERK, p38, and JNK were quantified and normalized to total ERK, p38, and JNK using Image J. Data are expressed as means ± SD. n = 3, (*p < 0.05; **p < 0.01; ***p < 0.001.) (C) BMMs were treated with or without 31.25 µg/mL flufenamic acid (FA) for the 1, 3, or 5 days respectively. Cell lysates were then subjected to Western blotting analysis for NFATc1 and GAPDH. (D) The gray levels of NFATc1 were quantified and normalized to GAPDH using Image J. Data are expressed as means ± SD. n = 3, (*p < 0.05; **p < 0.01; ***p < 0.001.)
the resorption pit assay and F-actin ring staining indicated that flufenamic acid could be a potent agent for preventing osteolysis in vitro by reducing the formation of F-actin ring. Furthermore, RNA-sequencing and real time RT-PCR suggested that numerous genes associated with osteoclasts differentiation were significantly suppressed by flufenamic acid, including NFATc1, cathepsin K, c-fos, TRAP, DC-STAMP, and VATPase d2. Western blot assays suggested that flufenamic acid represses the phosphorylation of ERK and P38 to obstruct the osteoclast maturation, consistent with the results of KEGG enrichment analysis. Therefore, flufenamic acid might be an attractive therapeutic agent in osteoporosis, because of its inhibitory effects on both osteoclast formation and bone resorption. An OVX-induced bone loss mouse model was used to further verify the protective role of flufenamic acid in vivo and demonstrate that it can reduce the probability of osteoporotic fractures in postmenopausal women. Micro-CT scanning and histological analysis showed that the number of trabecular bones increased in the treatment group compared with the sham group. In addition, quantitative analysis of ROI also indicated that flufenamic acid could attenuate the bone loss by improving the bone mineral density in OVX mice. Therefore, these results demonstrated the potential of flufenamic acid to act as a bone resorption inhibitor and prevent estrogen-deficiency-induced osteoporosis. Although the protective effects of flufenamic acid have been illustrated in our study, there remain certain caveats that might need improvement in the future. For instance, several clinical reports have suggested that the usage of NSAIDs after fracture could have adverse effects on bone healing, owing to a reduction in prostaglandin E2 synthesis [37–41]. This prompted us to further examine the exact relationship between bone formation and NSAIDs, excluding the interference from other factors, such as presence of inflammatory conditions or decreased level of physical activity [42,43]. Another limitation is that the present study does not fully examined the effect of flufenamic acid for M-CSF signaling in BMMs. The binding of the M-CSF to c-Fms could regulate TNF-induced inflammatory osteolysis[44]. However, the
result of RNA-sequencing indicated that M-CSF signaling pathway was not the main signaling pathway affected by flufenamic acid. Therefore, we examined the activation of MAPK signaling pathway at the protein level in this experiment. In addition, the concentration of flufenamic acid used in this study might be a little bit higher than small molecular inhibitors or antibodies [45,46]. However, in contrast to other published research on flufenamic acid that the concentration is usually between 20 µM and 100 µM, the concentration in this study might be reasonable for inhibiting osteoclast differentiation [47–49]. In conclusion, it is noteworthy that flufenamic acid could obstruct osteoclast differentiation and bone resorption in a dose-dependent manner both in vitro and in vivo. The underlying mechanism was attributed to the suppression of phosphorylation of MAPK pathway by flufenamic acid. Therefore, our results indicate that flufenamic acid could be an attracting therapeutic agent for the prevention of postmenopausal osteoporosis, and its clinical use might decrease the risk of fractures to a great extent. In the context of future drug development, our study also highlights the importance of developing compounds with dual action against bone resorption and pain in elderly people. Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (81472119 and 81672196) and Shanghai “Rising Stars of Medical Talent” Youth Development Program (Youth Medical Talents – Specialist Program). Appendix A. Supplementary material Supplementary data to this article can be found online at https:// 8
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
doi.org/10.1016/j.intimp.2019.106014. References [1] R. Eastell, T.W. O'Neill, L.C. Hofbauer, B. Langdahl, I.R. Reid, D.T. Gold, S.R. Cummings, Postmenopausal osteoporosis, Nat. Rev. Dis. Primers 2 (2016) 16069. [2] P.J. Meunier, C. Roux, E. Seeman, S. Ortolani, J.E. Badurski, T.D. Spector, J. Cannata, A. Balogh, E.M. Lemmel, S. Pors-Nielsen, R. Rizzoli, H.K. Genant, J.Y. Reginster, The effects of strontium ranelate on the risk of vertebral fracture in women with postmenopausal osteoporosis, N. Engl. J. Med. 350 (5) (2004) 459–468. [3] S.T. Harris, N.B. Watts, H.K. Genant, C.D. McKeever, T. Hangartner, M. Keller, C.H. Chesnut 3rd, J. Brown, E.F. Eriksen, M.S. Hoseyni, D.W. Axelrod, P.D. Miller, Effects of risedronate treatment on vertebral and nonvertebral fractures in women with postmenopausal osteoporosis: a randomized controlled trial. Vertebral Efficacy With Risedronate Therapy (VERT) Study Group, JAMA 282 (14) (1999) 1344–1352. [4] U.A. Liberman, S.R. Weiss, J. Broll, H.W. Minne, H. Quan, N.H. Bell, J. RodriguezPortales, R.W. Downs Jr., J. Dequeker, M. Favus, Effect of oral alendronate on bone mineral density and the incidence of fractures in postmenopausal osteoporosis. The Alendronate Phase III Osteoporosis Treatment Study Group, N. Engl. J. Med. 333 (22) (1995) 1437–1443. [5] R. Eastell, Treatment of postmenopausal osteoporosis, N. Engl. J. Med. 338 (11) (1998) 736–746. [6] X. Li, M.S. Ominsky, K.S. Warmington, S. Morony, J. Gong, J. Cao, Y. Gao, V. Shalhoub, B. Tipton, R. Haldankar, Q. Chen, A. Winters, T. Boone, Z. Geng, Q.T. Niu, H.Z. Ke, P.J. Kostenuik, W.S. Simonet, D.L. Lacey, C. Paszty, Sclerostin antibody treatment increases bone formation, bone mass, and bone strength in a rat model of postmenopausal osteoporosis, J. Bone Miner. Res. 24 (4) (2009) 578–588. [7] D.M. Black, C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 374 (3) (2016) 254–262. [8] C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 353 (6) (2005) 595–603. [9] G.D. Roodman, Cell biology of the osteoclast, Exp. Hematol. 27 (8) (1999) 1229–1241. [10] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation, Nature 423 (6937) (2003) 337–342. [11] S.L. Teitelbaum, F.P. Ross, Genetic regulation of osteoclast development and function, Nat. Rev. Genet. 4 (8) (2003) 638–649. [12] T. Wada, T. Nakashima, N. Hiroshi, J.M. Penninger, RANKL-RANK signaling in osteoclastogenesis and bone disease, Trends Mol. Med. 12 (1) (2006) 17–25. [13] T.J. Chambers, Regulation of the differentiation and function of osteoclasts, J. Pathol. 192 (1) (2000) 4–13. [14] K. Lee, I. Seo, M.H. Choi, D. Jeong, Roles of mitogen-activated protein kinases in osteoclast biology, Int. J. Mol. Sci. 19 (10) (2018). [15] K. Lee, Y.H. Chung, H. Ahn, H. Kim, J. Rho, D. Jeong, Selective regulation of MAPK signaling mediates RANKL-dependent osteoclast differentiation, Int. J. Biol. Sci. 12 (2) (2016) 235–245. [16] Z.H. Lee, H.-H. Kim, Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts, Biochem. Biophys. Res. Commun. 305 (2) (2003) 211–214. [17] K. Kim, S.H. Lee, J. Ha Kim, Y. Choi, N. Kim, NFATc1 induces osteoclast fusion via up-regulation of Atp6v0d2 and the dendritic cell-specific transmembrane protein (DC-STAMP), Mol. Endocrinol. 22 (1) (2008) 176–185. [18] J.H. Kim, N. Kim, Regulation of NFATc1 in osteoclast differentiation, J. Bone. Metab. 21 (4) (2014) 233–241. [19] S.L. Teitelbaum, Bone resorption by osteoclasts, Science 289 (5484) (2000) 1504–1508. [20] J.D. Ringe, H. Faber, O. Bock, S. Valentine, D. Felsenberg, M. Pfeifer, H.W. Minne, S. Schwalen, Transdermal fentanyl for the treatment of back pain caused by vertebral osteoporosis, Rheumatol. Int. 22 (5) (2002) 199–203. [21] G.A. Green, Understanding NSAIDs: from aspirin to COX-2, Clin Cornerstone 3 (5) (2001) 50–60. [22] W.F. Kean, W.W. Buchanan, The use of NSAIDs in rheumatic disorders 2005: a global perspective, Inflammopharmacology 13 (4) (2005) 343–370. [23] D.C. Bauer, E.S. Orwoll, K.M. Fox, T.M. Vogt, N.E. Lane, M.C. Hochberg, K. Stone, M.C. Nevitt, Aspirin and NSAID use in older women: effect on bone mineral density and fracture risk. Study of Osteoporotic Fractures Research Group, J. Bone Miner. Res. 11 (1) (1996) 29–35. [24] L.D. Carbone, F.A. Tylavsky, J.A. Cauley, T.B. Harris, T.F. Lang, D.C. Bauer, K.D. Barrow, S.B. Kritchevsky, Association between bone mineral density and the use of nonsteroidal anti-inflammatory drugs and aspirin: Impact of cyclooxygenase selectivity, J. Bone Miner. Res. 18 (10) (2003) 1795–1802. [25] J.B. Richards, L. Joseph, K. Schwartzman, N. Kreiger, A. Tenenhouse, D. Goltzman, Canadian multicentre osteoporosis study, the effect of cyclooxygenase-2 inhibitors on bone mineral density: results from the Canadian multicentre osteoporosis study, Osteoporos. Int. 17 (9) (2006) 1410–1419. [26] M. Kawashima, Y. Fujikawa, I. Itonaga, C. Takita, H. Tsumura, The effect of selective cyclooxygenase-2 inhibitor on human osteoclast precursors to influence osteoclastogenesis in vitro, Mod. Rheumatol. 19 (2) (2009) 192–198. [27] M. Kellinsalmi, V. Parikka, J. Risteli, T. Hentunen, H.V. Leskela, S. Lehtonen, K. Selander, K. Vaananen, P. Lehenkari, Inhibition of cyclooxygenase-2 down-regulates osteoclast and osteoblast differentiation and favours adipocyte formation in vitro, Eur. J. Pharmacol. 572 (2–3) (2007) 102–110. [28] M. Ishida, W.R. Shen, K. Kimura, A. Kishikawa, K. Shima, S. Ogawa, J. Qi, F. Ohori, T. Noguchi, A. Marahleh, H. Kitaura, DPP-4 inhibitor impedes lipopolysaccharide-
Fig. 6. Flufenamic acid prevented OVX-induced osteoporosis in mice. (A) The femurs of all groups of mice were scanned with a high-resolution micro-CT. (B) Quantitative analysis of bone mineral density (BMD), bone volume/tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and structure model index (SMI). Data are expressed as means ± SD. n = 5. (*p < 0.05; **p < 0.01; ***p < 0.001.) (C) Sections of femurs were stained with H&E and TRAP. (D) The number of osteoclasts per field of tissue (N.Oc/BS), and osteoclast surface/bone surface (Oc.S/BS) in sections stained by TRAP. Data are expressed as means ± SD. n = 5, (*p < 0.05; **p < 0.01; ***p < 0.001.)
9
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
[29] [30] [31]
[32]
[33]
[34] [35]
[36]
[37] [38]
[39] P.V. Giannoudis, D.A. MacDonald, S.J. Matthews, R.M. Smith, A.J. Furlong, P. De Boer, Nonunion of the femoral diaphysis, J. Bone Joint Surg. British 82-B (5) (2000) 655–658. [40] R.K. Hernandez, T.P. Do, C.W. Critchlow, R.E. Dent, S.S. Jick, Patient-related risk factors for fracture-healing complications in the United Kingdom General Practice Research Database, Acta Orthop. 83 (6) (2012) 653–660. [41] P. Geusens, P.J. Emans, J.J. de Jong, J. van den Bergh, NSAIDs and fracture healing, Curr. Opin. Rheumatol. 25 (4) (2013) 524–531. [42] K.A. Blackwell, L.G. Raisz, C.C. Pilbeam, Prostaglandins in bone: bad cop, good cop? Trends Endocrinol. Metab. 21 (5) (2010) 294–301. [43] A.P. Kurmis, T.P. Kurmis, J.X. O'Brien, T. Dalen, The effect of nonsteroidal antiinflammatory drug administration on acute phase fracture-healing: a review, J. Bone Joint Surg. Am. 94 (9) (2012) 815–823. [44] H. Kitaura, P. Zhou, H.J. Kim, D.V. Novack, F.P. Ross, S.L. Teitelbaum, M-CSF mediates TNF-induced inflammatory osteolysis, J. Clin. Invest. 115 (12) (2005) 3418–3427. [45] A. Marahleh, H. Kitaura, M. Ishida, K. Shima, A. Kishikawa, S. Ogawa, W.R. Shen, J. Qi, F. Ohori, T. Noguchi, Y. Nara, I. Mizoguchi, Effect of anti-c-fms antibody on osteoclast formation and proliferation of osteoclast precursor in vitro, J Vis Exp (145) (2019). [46] A. Kishikawa, H. Kitaura, K. Kimura, S. Ogawa, J. Qi, W.R. Shen, F. Ohori, T. Noguchi, A. Marahleh, Y. Nara, A. Ichimura, I. Mizoguchi, Docosahexaenoic acid inhibits inflammation-induced osteoclast formation and bone resorption in vivo through GPR120 by inhibiting TNF-alpha production in macrophages and directly inhibiting osteoclast formation, Front. Endocrinol. (Lausanne) 10 (2019) 157. [47] R. Guinamard, C. Simard, C. Del Negro, Flufenamic acid as an ion channel modulator, Pharmacol. Ther. 138 (2) (2013) 272–284. [48] R. Ge, L. Hu, Y. Tai, F. Xue, L. Yuan, G. Wei, Y. Wang, Flufenamic acid promotes angiogenesis through AMPK activation, Int. J. Oncol. 42 (6) (2013) 1945–1950. [49] P. Pongkorpsakol, S. Satitsri, P. Wongkrasant, P. Chittavanich, S. Kittayaruksakul, P. Srimanote, V. Chatsudthipong, C. Muanprasat, Flufenamic acid protects against intestinal fluid secretion and barrier leakage in a mouse model of Vibrio cholerae infection through NF-kappaB inhibition and AMPK activation, Eur. J. Pharmacol. 798 (2017) 94–104.
induced osteoclast formation and bone resorption in vivo, Biomed. Pharmacother. 109 (2019) 242–253. M.T. Drake, B.L. Clarke, E.M. Lewiecki, The pathophysiology and treatment of osteoporosis, Clin. Ther. 37 (8) (2015) 1837–1850. A.R. Cappola, D.M. Shoback, Osteoporosis therapy in postmenopausal women with high risk of fracture, JAMA 316 (7) (2016) 715–716. J.A. Kanis, C. Cooper, R. Rizzoli, J.Y. Reginster, Scientific Advisory Board of the European Society for, O. Economic Aspects of, A. the Committees of Scientific, F. National Societies of the International Osteoporosis, European guidance for the diagnosis and management of osteoporosis in postmenopausal women, Osteoporos. Int. 30 (1) (2019) 3–44. A. Singer, A. Exuzides, L. Spangler, C. O'Malley, C. Colby, K. Johnston, I. Agodoa, J. Baker, R. Kagan, Burden of illness for osteoporotic fractures compared with other serious diseases among postmenopausal women in the United States, Mayo Clin. Proc. 90 (1) (2015) 53–62. J. Compston, A. Cooper, C. Cooper, N. Gittoes, C. Gregson, N. Harvey, S. Hope, J.A. Kanis, E.V. McCloskey, K.E.S. Poole, D.M. Reid, P. Selby, F. Thompson, A. Thurston, N. Vine, G. National Osteoporosis Guideline, UK clinical guideline for the prevention and treatment of osteoporosis, Arch. Osteoporos. 12 (1) (2017) 43. I.R. Reid, Osteonecrosis of the jaw: who gets it, and why? Bone 44 (1) (2009) 4–10. S. Khosla, D. Burr, J. Cauley, D.W. Dempster, P.R. Ebeling, D. Felsenberg, R.F. Gagel, V. Gilsanz, T. Guise, S. Koka, L.K. McCauley, J. McGowan, M.D. McKee, S. Mohla, D.G. Pendrys, L.G. Raisz, S.L. Ruggiero, D.M. Shafer, L. Shum, S.L. Silverman, C.H. Van Poznak, N. Watts, S.B. Woo, E. Shane, B. American Society for, R. Mineral, Bisphosphonate-associated osteonecrosis of the jaw: report of a task force of the American Society for Bone and Mineral Research, J. Bone Miner. Res. 22 (10) (2007) 1479–1491. S.B. Woo, J.W. Hellstein, J.R. Kalmar, Narrative [corrected] review: bisphosphonates and osteonecrosis of the jaws, Ann. Intern. Med. 144 (10) (2006) 753–761. R.W. van Esch, M.M. Kool, S. van As, NSAIDs can have adverse effects on bone healing, Med. Hypotheses 81 (2) (2013) 343–346. Q. Li, Z. Zhang, Z. Cai, High-dose ketorolac affects adult spinal fusion: a metaanalysis of the effect of perioperative nonsteroidal anti-inflammatory drugs on spinal fusion, Spine (Phila Pa 1976) 36 (7) (2011) E461-8.
10
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Flufenamic acid inhibits osteoclast formation and bone resorption and act against estrogen-dependent bone loss in mice ⁎
Shutao Zhanga,1, Shicheng Huoa,1, Hui Lia, Haozheng Tanga, Bin'en Niea, Xinhua Qua, , ⁎ Bing Yuea, a
Department of Bone and Joint Surgery, Renji Hospital, School of Medicine, Shanghai Jiaotong University, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Flufenamic acid Osteoclast differentiation Osteoporosis MAPK RNA-Seq
Postmenopausal osteoporosis is one of the most common types of osteoporosis resulting from estrogen deficiency in elderly women. Nonsteroidal anti-inflammatory drugs (NSAIDs) are important drugs for pain relief in patients with osteoporosis. In this study, we report for the first time that flufenamic acid, a clinically approved and widely used NSAID, not only has analgesic properties but also shows a significant effect in terms of preventing postmenopausal osteoporosis. Quantitative RT-PCR analysis showed that treatment with flufenamic acid significantly downregulated the genes associated with osteoclast differentiation. Meanwhile, RNA-sequencing and western blot analyses suggested that flufenamic acid could inhibit the bone resorption by suppressing the phosphorylation of MAPK pathways. Moreover, an ovariectomy (OVX)-induced bone-loss mouse model indicated that flufenamic acid might be a potent drug for preventing osteoporotic fractures, as verified by microCT scanning and histological analysis. Therefore, this study proposes an attractive and potent drug with analgesic properties for the prevention of postmenopausal osteoporosis.
1. Introduction Osteoporosis is a metabolic bone disorder that is accompanied by micro-architectural deterioration of bone tissue and low bone mineral density [1]. Postmenopausal osteoporosis is one of the most common types of osteoporosis, resulting from estrogen deficiency in elderly women. The declining estrogen levels at menopause lead to an increased rate of bone turnover; especially the rate of bone resorption is significantly greater than that of bone formation [2–4]. This imbalance in bone remodeling might lead to loss of connectivity in trabecular bone and porosity of cortical bone, with a subsequent increase in bone fragility and susceptibility to fractures [5,6]. Every year, there are 1.5 million cases of osteoporotic fractures in the United States, with an annual direct cost of nearly $18 billion [7,8]. Although the incidence of fractures varies greatly by country, on average, up to 50% of women over the age of 50 are at the risk of such fractures [1]. Therefore, osteoporotic fractures impose a considerable financial burden on health services in the worldwide. Multinucleated osteoclasts originating from bone marrow monocytes/macrophages (BMMs), and it is an indispensable regulator for bone resorption. They dissolve the organic and mineral components of
bone by secreting acids and proteases [9–11]. The differentiation and function of osteoclasts are regulated by various growth factors, hormones, and cytokines, including macrophage colony stimulating factor (M-CSF) and receptor activator of nuclear factor κ-B ligand (RANKL) [12,13]. It has been demonstrated that mitogen-activated protein kinases (MAPK) represent an important pathway for the signaling transmission of extracellular stimuli. In addition, the phosphorylation of MAPK has been shown to regulate osteoclast precursor proliferation, adhesion, and cell-cell fusion, as well as the migration, survival, and bone resorption capacity of mature osteoclasts [14–16]. Furthermore, genes associated with osteoclast differentiation and function, such as tartrate-resistant acid phosphatase (TRAP), nuclear factor-activated T cells c1 (NFATc1), cathepsin K, V-ATPase, and c-Fos, are also significantly elevated after signal transduction cascades [17–19]. Nonsteroidal anti-inflammatory drugs (NSAIDs) are important agents for pain relief in patients with osteoporosis [20]. In the United States, NSAIDs account for around 70 million prescriptions, and 30 billion over-the-counter (OTC) medications are sold annually [21]. As the cyclooxygenase (COX) pathway has an integrated role in the inflammatory processes and biochemical recognition of pain, NSAIDs serve as efficient inhibitors of pain and inflammation [22]. During the
⁎
Corresponding authors. E-mail addresses: [email protected] (X. Qu), [email protected] (B. Yue). 1 Shutao Zhang and Shicheng Huo contributed equally to this work. https://doi.org/10.1016/j.intimp.2019.106014 Received 5 July 2019; Received in revised form 14 October 2019; Accepted 28 October 2019 1567-5769/ © 2019 Elsevier B.V. All rights reserved.
Please cite this article as: Shutao Zhang, et al., International Immunopharmacology, https://doi.org/10.1016/j.intimp.2019.106014
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
and stained for TRAP. The number of TRAP-positive cells with more than three nuclei was calculated.
past decades, several studies have suggested that NSAIDs usage in postmenopausal women who do not receive estrogen replacement could contribute to an increased bone mineral density [23–25]. This surprising benefit of NSAIDs has attracted much interest in the research community. For example, Celecoxib, a selective COX-2 inhibitor, was shown to drastically inhibit human osteoclast formation and bone resorption in a dose-dependent manner, via modulation of the prostaglandin synthesis enzyme [26]. In addition, indomethacin and parecoxib had also been suggested that it could suppress osteoclast maturation and bone resorption in vitro [27]. However, while these experiments verify the effects of NSAIDs on osteoclasts differentiation in vitro, little research has focused on the protective function of NSAIDs against postmenopausal osteoporosis and the exact mechanism behind it. Therefore, the investigation of these properties is necessary to elucidate the comprehensive functions of NSAIDs. Inspired by the findings above, we investigated whether flufenamic acid (FA), a clinically approved and widely used NSAID, could serve as a promising anti-osteoporosis agent and show protective effects in ovariectomized (OVX) mice. In this study, we report for the first time that flufenamic acid not only has analgesic properties but also helps prevent postmenopausal osteoporosis. A series of in vitro experiments suggest that flufenamic acid could obstruct the maturation and resorption of osteoclasts by inhibiting the activation of MAPK pathways. Moreover, an OVX-induced osteoporosis mouse model demonstrated that flufenamic acid is a potent drug for preventing osteoporotic fractures, as indicated by micro-CT scanning and histological analysis. Therefore, our study proposes a potent and promising agent for the treatment of postmenopausal osteoporosis.
2.3. Cytotoxicity assay Cell Counting Kit-8 assay was used to examine the cytotoxic effects of flufenamic acid, according to the manufacturer’s instructions. In brief, BMMs were seeded in a clear 96-well plate at a density of 1.0 × 104 cells per well in triplicate. Next, BMMs were incubated in the presence of 30 ng/mL M-CSF for 24 h under 37 °C and 5% CO2 to allow attachment of cells to the plates. Different concentrations of flufenamic acid (0, 1.95, 3.91, 7.81, 15.63, 31.25, 62.5, 125, 250, 500 µg/mL) were then added to the medium, which was cultured for 24, 48, and 72 h, respectively. At last, every well was added 10 µL of CCK-8 reagent, and the plates were incubated for an additional 2 h under 37 °C and 5% CO2. The optical density (OD) of these samples was recorded at a wavelength of 450 nm (with 650 nm serving as the reference wavelength) on an absorbance microplate reader (Bio-Tek Instruments, Winooski, VT, USA). Cell viability relative to the control group was calculated using the following formula: (experimental group OD - blank OD) / (control group OD - blank OD). The half maximal inhibitory concentration (IC50) was analyzed using GraphPad Prism 7.0 software (San Diego, CA, USA). 2.4. Cell apoptosis assay Cell apoptosis assay was conducted using the Annexin V-FITC/ propidium iodide (PI) Kit (Sangon Biotech, Shanghai, China), according to the manufacturer’s instructions. Briefly, BMMs were exposed to flufenamic acid for 48 and 72 h, at a concentration of 31.25 µg/mL. The cells were then gently washed thrice with PBS buffer and suspended in binding buffer. Next, 5 µL of Annexin V-FITC was added and incubated for 15 min at 37 °C in the dark. Finally, 10 μL of PI was used to stain the nucleus of the treated BMMs. The sample was examined within 4 h and results were analyzed with FlowJo (BD Biosciences).
2. Materials and methods 2.1. Reagents Fetal bovine serum (FBS), alpha-MEM, and penicillin/streptomycin were obtained from Gibco (Rockville, MD, United States). Recombinant mouse M-CSF and RANKL were obtained from R&D Systems (Minneapolis, MN, United States). Triton X-100, dimethyl sulfoxide (DMSO), and tartrate-resistant acid phosphatase (TRAP) staining kit were purchased from Sigma–Aldrich (St. Louis, MO, United States). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technology (Kumamoto, Japan). Rhodamine-labeled phalloidin was purchased from Cytoskeleton Inc. (Denver, CO, United States). Reverse transcription reagents and TB Green PCR Master Mix were obtained from TaKaRa Bio (Otsu, Japan). Primary and secondary antibodies were purchased from Cell Signaling Technology (Beverly, MA, United States). Flufenamic acid was purchased from Dalian Meilun Biotechnology Co.,Ltd (Dalian, China) and dissolved in DMSO.
2.5. Resorption pit assay BMMs were seeded onto bovine bone discs at a density of 1x104 cells/well in a clear 96-well tissue cultured treated plate. The cell cultivated in a complete ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF and 50 ng/mL RANKL for 4 days. Then flufenamic acid was added into the medium with a series of concentrations, including 0, 7.81, 15.63 and 31.25 µg/ml. After mature osteoclasts formed, the bone discs were sonicated to remove the adherent cells and fixed with 2.5% glutaraldehyde. At last, a scanning electron microscope (Hitachi S4800, Tokyo, Japan) was applied to visualize resorption pits and Image J software (Bethesda, MD, USA) was used to analyze the bone resorption area.
2.2. Mouse bone marrow macrophage (BMM) preparation and osteoclast differentiation
2.6. F-actin ring formation assay 4-week-old SPF female C57BL/6 mice were purchased from Jiesijie Experimental Animal Co., Ltd. (Shanghai, China). Primary bone marrow macrophages (BMMs) were extracted as described previously [28]. In brief, cells were isolated from the femoral bone marrow and cultured in ɑ-MEM supplemented with 10% FBS, 1% penicillin/ streptomycin, and 30 ng/mL M-CSF. Following a 24-hour incubation period, the suspension cells were discarded and the anchorage-dependent cells were grown in a 37 °C, 5% CO2 incubator until 90% confluence was obtained. The BMMs were then seeded into a 96-well plate at a density of 1 × 104 cells/ well and cultured in ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF, and 50 ng/mL RANKL, along with varying dose of flufenamic acid (0, 7.81, 15.63, and 31.25 µg/mL). The culture medium was replaced every other day until multinucleate osteoclasts were formed. Next, PBS buffer was used to wash the cells three times. Then, the osteoclasts were fixed with 4% paraformaldehyde for 15 min,
For the F-actin ring formation assay, flufenamic acid treated osteoclasts were fixed for 15 min with 4% paraformaldehyde and permeabilized for 5 min with 0.1% Triton X-100. They were then washed thrice with PBS buffer and incubated with a 1:500 dilution of the rhodamine -labeled phalloidin for 1 h at 37 °C in the dark. Finally, the nucleus was counterstained with DAPI and the stained cells were visualized using a fluorescence microscope (OLYMPUS, DP70, Tokyo, Japan) 2.7. RNA isolation and quantitative RT-PCR BMMs were seeded at 10 × 104 cells/ well in 24-well tissue cultured treated plates, and cultured in ɑ-MEM supplemented with 10% FBS, 30 ng/mL M-CSF, and 50 ng/mL RANKL. Next, the cells were 2
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
China) for 20 min, and then incubated with primary antibodies at 4 °C for 12 h. Next, the membranes were washed and incubated with the appropriate secondary antibodies. At last, the membranes were visualized using an Immobilon Western chemiluminescent HRP substrate (Millipore, Billerica, MA, USA). Quantitative analysis of the band intensity was carried out using the ImageJ software.
Table 1 Primers used in this study. Target gene
direction
Primer sequence (5′to 3′)
GAPDH
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC CTTCCAATACGTGCAGCAGA TCTTCAGGGCTTTCTCGTTC CGGGTTTCAACGCCGACTA TGGCACTAGAGACGGACAGAT CTGGAGTGCACGATGCCAGCGACA TCCGTGCTCGGCGATGGACCAGA AAGCCTTTGTTTGACGCTGT TTCGATGCCTCTGTGAGATG AAAACCCTTGGGCTGTTCTT AATCATGGACGACTCCTTGG CCGTTGCTTCCAGAAAATAACA TGTGGGATGTGAACTCGGAA
CTSK c-Fos TRAP VATPs-d2 DC-STAMP NFATc1
2.10. OVX-induced osteoporosis model All animal experiments were conducted in accordance with the guidelines and procedures approved by the Animal Care Committee at Renji Hospital, Shanghai Jiaotong University School of Medicine. Briefly, 20 SPF female C57BL/6 mice, with an age of 12 weeks, were randomly divided into four groups: sham (only injection with saline), vehicle (OVX and saline injection), low-dose flufenamic acid (OVX and 15 mg/kg flufenamic acid injection), and high-dose flufenamic acid (OVX and 30 mg/kg flufenamic acid injection). Next, the mice were subjected to either a bilateral ovariectomy (OVX) or a sham operation after generally anesthetized. Then, the incision was closed and mice were allowed to recover for 4 days. Flufenamic acid was injected intraperitoneally with every other day for 4 weeks and mice were weighed weekly. At the end of time, all the mice were sacrificed and their femur was harvested for micro-CT analysis and histological studies.
administered with either different concentrations of flufenamic acid (0, 7.81, 15.63, and 31.25 µg/mL) for 5 days or 31.25 µg/mL flufenamic acid for 1, 3, or 5 days. For total RNA extraction from BMMs, we used the RNeasy Mini kit (Qiagen). The RNA extraction was performed following the manufacturer’s instructions, and 1 μg of total RNA was applied to synthesize cDNA using the Primescript RT Master Kit, according to the manufacturer’s instructions. Primers (obtained from Sangon Biotech) used for quantitative RT–PCR are shown in Table 1. A TB Green Premix Ex Taq™ Kit was used to prepare the PCR reaction mixture, and the PCR amplification was set with the following parameters: initial denaturation at 95 °C (30 s), followed by 40 cycles at 95 °C (5 s), 60 °C (30 s), and 72 °C (45 s). The process of quantitative RTPCR was detected using ABI Prism 7500 (Applied Biosystems, Foster City, CA, USA). Data was analyzed using the comparative CT method, with GAPDH serving as the control. The results were presented as foldchange relative to the control, which was assigned a value of 1.
2.11. Micro-CT scanning A high-resolution micro-CT scanner was used to examine the microstructure changes of mice femur (SkyScan 1172, Kontich, Belgium). The equipment was set with the following parameters: 80 kV, 112 mA, and 9 mm pixel size. For quantitative assessment, bone mineral density (BMD), bone volume/ tissue volume (BV/TV), structure model index (SMI), trabecular separation (Tb.Sp), trabecular number (Tb.N), and trabecular thickness (Tb.Th) were analyzed using the scanner software, following the standardized protocols.
2.8. RNA sequencing transcriptomics
2.12. Histological analysis
The gene expression of BMMs treated with flufenamic acid (31.25 µg/mL) or DMSO (control) was determined using RNA-sequencing. Briefly, cells were collected after 5 days of treatment, and three independently prepared RNA samples from each group were used for RNA-Sequencing. Illumina sequencing was performed by OE biotech Co., Ltd. (Shanghai, China) using the Illumina HiseqTM 2500 (Illumina, Inc.). The data analyses were performed using edgeR software and statistical significance was defined as p values smaller than 0.05.
The fixed femurs were decalcified in 10% EDTA for about 4 weeks and subsequently embedded in paraffin. Next, the samples were subjected to hematoxylin and eosin (H&E) and TRAP staining. Finally, the slices were observed under a high-quality microscope. The number of TRAP + osteoclasts (N.Oc/BS, 1/mm) and the percentage of osteoclast surface per bone surface (OcS/BS, %) were analyzed for each sample. 2.13. Statistical analysis
2.9. Western blotting The data are expressed as means ± SD (standard error of the mean). The results were analyzed using Prism 7 (GraphPad Software Inc, CA, USA). One-way ANOVA and the two-tailed unpaired Student’s t-test were used to compare the groups. P values < 0.05 indicated significant difference.
For examining the signaling pathways affected by flufenamic acid, BMMs were seeded into 6-well plates at a density of 5 × 105 cells/well. After the cells were confluent, they were stimulated with or without flufenamic acid (31.25 µg/mL) for 4 h. Cells were then treated with 50 ng/mL RANKL for 0, 5, 10, 20, or 30 min. To determine the effect of flufenamic acid on NFATc1, BMMs were treated with 30 ng/mL M-CSF, 50 ng/mL RANKL, with or without flufenamic acid (31.25 µg/mL) for 1, 3, or 5 days. Total protein was extracted from cultured cells using radio immunoprecipitation assay (RIPA) lysis buffer (Beyotime Biotechnology, Shanghai, China) containing 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and protease inhibitor cocktail. Lysates were centrifuged at 4 °C, 12,000 g for 20 min, and the supernatants were collected. Protein concentrations were detected using a bicinchoninic acid protein assay (BCA, Thermo Fisher, MA, USA). Proteins were separated in 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). Following transfer, the membranes were incubated with QuickBlock™ Blocking Buffer (Beyotime Biotechnology, Shanghai,
3. Results 3.1. Flufenamic acid treatment was safe for BMMs To determine whether the inhibitory concentration of flufenamic acid on osteoclast differentiation could lead to cell death or apoptosis, we performed a CCK-8 assay and flow cytometry analysis. As shown in Fig. 1A-B, flufenamic acid treatment did not exhibit any significant inhibition in growth at a concentration of up to 31.25 μg/mL. Even when the treatment duration was extended to 72 h, no significant difference in cell viability was observed relative to the control group. Furthermore, as shown in Fig. 1C, the results of apoptosis assay indicated that flufenamic acid at a concentration of 31.25 μg/mL did not 3
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 1. Flufenamic acid did not inhibit cell viability at concentrations that affect osteoclast differentiation. (A) BMMs treated with different concentration of flufenamic acid for 24, 48 and 72 h and the proliferation were tested by CCK-8 assays. (B) The half maximal inhibitory concentration (IC50) of flufenamic acid at 24, 48 and 72 h was calculated using GraphPad Prism 7.0. (C) Flow cytometry analysis of the apoptosis rate of BMMs treated with flufenamic acid (31.25 μg/mL) for 48 and 72 h.
the surface of bone discs. As shown in Fig. 2C and D, numerous bone resorption pits were detected in the control group, while the resorption area was significantly decreased upon treatment with flufenamic acid, especially at the concentration of 31.25 µg/mL. Furthermore, we used immunofluorescence staining to detect the morphology of F-actin ring. As an integrated and well-polarized F-actin ring is indispensable for osteoclastic bone resorption, the inhibitory effect of flufenamic acid was apparent under the fluorescence microscope. As shown in Fig. 2E, the formation of F-actin ring was drastically reduced compared with the control group, consistent with the results of the scanning electron microscopy. Taken together, these results indicated that flufenamic acid might be a promising compound inhibiting bone resorption, and therefore, could block the osteoclast formation and osteoclastic bone resorption activity in vitro.
increase the proportion of Annexin-V-positive BMMs at both 48 and 72 h of treatment. Therefore, the ability of flufenamic acid to inhibit osteoclast differentiation is not associated with cell apoptosis. Taken together, these results demonstrate that flufenamic acid was safe toward BMMs at the concentration at which it inhibited osteoclast differentiation.
3.2. Flufenamic acid inhibited RANKL-induced osteoclastogenesis and osteoclastic bone resorption As positive TRAP staining is a specific characteristic of mature osteoclasts, we used this assay to determine whether flufenamic acid could efficiently inhibit RANKL-induced osteoclastogenesis at a range of concentrations, including 0, 7.81, 15.63 and 31.25 µg/ml. As shown in Fig. 2A-B, the differentiation of BMMs was significantly impeded in the treatment group, even with the presence of M-CSF and RANKL. Meanwhile, the number of multinucleate osteoclasts declined in a dose-dependent manner in contrast to the control group. As bone resorption is the vital function of osteoclasts, we used devitalized bovine bone discs to explore the mature osteoclast resorption capacity. Flufenamic acid was added in a series of concentration to the culture medium, to block the formation of multinucleate osteoclasts on
3.3. Flufenamic acid obstructed osteoclast differentiation at the transcriptome level The differentially expressed genes of BMMs were analyzed statistically to examine the possible mechanism underlying the inhibitory effect of flufenamic acid. After quantile normalization of the FPKM values followed by Student’s t-test at p = 0.05 and the selection of 4
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 2. Flufenamic acid inhibited RANKL-induced osteoclastogenesis, bone resorption and F-actin ring formation. (A) BMMs were cultured with different concentrations of flufenamic acid, M-CSF, and RANKL for 5 days. Then TRAP staining was applied to observe TRAP- positive multinuclear cells. (B) The number of TRAP positive multinuclear cells were calculated and presented graphically. (C, D) BMMs were seeded on to bone slices and treated with various concentrations of flufenamic acid. Bone resorption pits were examined using Scanning electron microscope (SEM) and the areas of resorption pit were measured using Image J. Data are expressed as means ± SD, (*** p < 0.001.) n = 5. (E) BMMs were cultured with M-CSF and RANKL and stimulated with different concentrations of flufenamic acid. Then BMMs were fixed with paraformaldehyde and stained with DAPI (nuclei) and rhodamine-phalloidin (F-actin).
related to the osteoclast differentiation, underwent significant inhibition. Therefore, we hypothesized that flufenamic acid inhibits the phosphorylation of MAPK to further obstruct the osteoclast maturation.
differentially expressed genes with at least a two-fold change in their expression, we identified 1254 differentially expressed genes (438 upregulated and 816 downregulated) with significant changes before and after the drug treatment. The distribution of differentially expressed gene for both treated and untreated BMMs can be seen in the heatmap and MA plot (Fig. 3A-B). KEGG pathway enrichment analysis is another key method to infer the mechanism of action of flufenamic acid towards BMMs. As shown in Fig. 3C, the pathway associated with signal transduction was downregulated the most, compared with the other genes. Particularly, the mitogen-activated protein kinase (MAPK), an important element
3.4. Flufenamic acid reduced the expression of osteoclast-related genes After the stimulation of RANKL, specific genes associated with the osteoclast activation and differentiation, such as CTSK, DC-STAMP, cFos, VATPs-d2, NFATc1 and TRAP are upregulated. Hence, we utilized real-time RT-PCR to further verify the results of RNA-sequencing. As depicted in Fig. 4A and B, treatment with flufenamic acid caused a 5
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 3. Transcriptome changes in BMMs treated with flufenamic acid or DMSO (control). (A) Cluster analysis of differentially expressed genes. Red indicates a highly expressed gene, and blue indicates a low expressed gene. Each group contains three independent samples. (B) The distribution of differentially expressed genes was exhibited in the MA map. (C) Differentially expressed genes enriched in the KEGG pathway. Upregulated and downregulated differentially expressed genes were shown at KEGG Level 2.
3.6. Flufenamic acid prevented OVX-induced osteoporosis
significant decrease of osteoclast-related gene expression in a time- and dose-dependent manner which was consistent with the RNA-sequencing. Hence, these results demonstrated that flufenamic acid could weaken the osteoclast bone resorption capacity by downregulating the RANKL-induced genes expression.
To investigate the influence of flufenamic acid treatment on estrogen-deficiency-induced osteoporosis, OVX-induced mouse bone loss model was used. As shown in Supplementary Fig. 1, all mice showed a stable weight gain during the 4 weeks of observation, indicating that therapeutic dose of flufenamic acid did not have obvious adverse effects in vivo. After 4 weeks of intraperitoneal injection, mice femurs were isolated and micro-CT was applied to examine the bone loss in the distal femur (Fig. 6A). Compared with the sham group, there was a significant decrease of trabecular bone in vehicle group. As shown in Fig. 6B, we found a reduction in BMD, BV/TV, Tb.Th, and Tb.N, whereas Tb.Sp and SMI were increased. However, there was a significant reversal in these trends upon treatment with flufenamic acid. In the therapeutic group, the values of BMD, BV/TV, Tb.Th, and Tb.N had a significant increase. Furthermore, Hematoxylin and Eosin (H&E) staining demonstrated that flufenamic acid had a beneficial effect on the bone mass (Fig. 6C-D). As indicated by TRAP staining, the number of multinucleated osteoclasts at the growth plates and the percentage of osteoclast surface per bone surface (Oc.S/BS%) had declined significantly in the treatment group compared with the vehicle group. Taken together, these results showed that flufenamic acid efficiently attenuated OVX-induced bone loss through the inhibition of osteoclast formation in vivo.
3.5. Flufenamic acid suppressed the activation of MAPK and NFATc1 To verify the hypothesis that flufenamic acid inhibits osteoclast differentiation and bone resorption by obstructing the phosphorylation of MAPK, we used western blotting to examine the phosphorylation of extracellular signal-regulated kinase (ERK), p38, and Jun kinase (JNK). As shown in Fig. 5A and B, the levels of phosphorylation of ERK and p38 were significantly lower in the flufenamic acid group in contrast to the control sample. However, there was no significant change in the phosphorylation of JNK. In addition, we assessed the expression of NFATc1, which is a vital transcription factor associated with osteoclast differentiation. As shown in Fig. 5C and D, the expression of NFATc1 increased obviously after stimulation of RANKL for 1 day, 3 days, and 5 days. However, the robust expression of NFATc1 was significantly suppressed after the treatment of flufenamic acid. Taken together, the results illustrated that flufenamic acid could inhibit MAPK and NFATc1 activation during osteoclastogenesis, in agreement with the result of RNA-sequencing.
6
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 4. Flufenamic acid inhibited the expression of osteoclast-specific genes. (A) BMMs were cultured with M-CSF and RANKL in the presence of different concentrations of flufenamic acid for 5 days. (B) BMMs were treated with or without 31.25 µg/mL flufenamic acid (FA), for 1, 3, or 5 days respectively. The expression of the osteoclast-specific genes CTSK, c-Fos, TRAP, VATPs-d2, DC-STAMP, and NFATc1 was determined by real-time RT-PCR and the result were normalized to the expression of GAPDH. Data are expressed as means ± SD. n = 3 (*p < 0.05; **p < 0.01; ***p < 0.001.)
4. Discussion
women, has attracted much attention in the context of postmenopausal osteoporosis treatment. Flufenamic acid is a clinically approved drug with anti-inflammatory and analgesic properties, which works by inhibiting the production of prostaglandins. In this study, we demonstrated that flufenamic acid could be a potent drug for preventing osteoporotic fractures in estrogen-deficient patients. In particular, Cell Counting Kit-8 assay and apoptosis detection test were used to demonstrate that flufenamic acid did not alter the viability of BMMs or induce apoptosis in them at concentrations that inhibited osteoclast differentiation. As shown in TRAP- staining assays, flufenamic acid exhibited a significant negative effect on osteoclast differentiation and function. The number of multinucleated cells was significantly reduced in the treatment group relative to the control group, in a dose-dependent manner. Moreover,
Osteoporosis is a metabolic disorder characterized by increased bone fragility and susceptibility to fracture, with decreased bone mineral density and deterioration of bone microstructure [29]. With a steady increase in the number of elderly people, osteoporotic fracture has become a major cause of morbidity and mortality in many countries [30–33]. Although several drugs have been developed for osteoporosis treatment, alternative approaches are still required, owing to the severe side effects of the extant treatments. For example, the intravenous use of bisphosphonates, the most widely prescribed agents in the osteoporosis management, might be associated with osteonecrosis of the jaws [34–36]. Therefore, research on tolerable and multifunctional agents, which both relieve the pain and prevent the fractures in elderly 7
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
Fig. 5. Flufenamic acid inhibited osteoclast differentiation by suppressing the activation of MAPK and NFATc1. (A) BMMs were cultured with or without 31.25 µg/ mL flufenamic acid (FA) for 4 h and then treated with 50 ng/mL RANKL for the indicated periods. Cell lysates were then subjected to Western blotting analysis for pERK, ERK, p-JNK, JNK, p-p38, p38. (B) The gray levels of phosphorylated ERK, p38, and JNK were quantified and normalized to total ERK, p38, and JNK using Image J. Data are expressed as means ± SD. n = 3, (*p < 0.05; **p < 0.01; ***p < 0.001.) (C) BMMs were treated with or without 31.25 µg/mL flufenamic acid (FA) for the 1, 3, or 5 days respectively. Cell lysates were then subjected to Western blotting analysis for NFATc1 and GAPDH. (D) The gray levels of NFATc1 were quantified and normalized to GAPDH using Image J. Data are expressed as means ± SD. n = 3, (*p < 0.05; **p < 0.01; ***p < 0.001.)
the resorption pit assay and F-actin ring staining indicated that flufenamic acid could be a potent agent for preventing osteolysis in vitro by reducing the formation of F-actin ring. Furthermore, RNA-sequencing and real time RT-PCR suggested that numerous genes associated with osteoclasts differentiation were significantly suppressed by flufenamic acid, including NFATc1, cathepsin K, c-fos, TRAP, DC-STAMP, and VATPase d2. Western blot assays suggested that flufenamic acid represses the phosphorylation of ERK and P38 to obstruct the osteoclast maturation, consistent with the results of KEGG enrichment analysis. Therefore, flufenamic acid might be an attractive therapeutic agent in osteoporosis, because of its inhibitory effects on both osteoclast formation and bone resorption. An OVX-induced bone loss mouse model was used to further verify the protective role of flufenamic acid in vivo and demonstrate that it can reduce the probability of osteoporotic fractures in postmenopausal women. Micro-CT scanning and histological analysis showed that the number of trabecular bones increased in the treatment group compared with the sham group. In addition, quantitative analysis of ROI also indicated that flufenamic acid could attenuate the bone loss by improving the bone mineral density in OVX mice. Therefore, these results demonstrated the potential of flufenamic acid to act as a bone resorption inhibitor and prevent estrogen-deficiency-induced osteoporosis. Although the protective effects of flufenamic acid have been illustrated in our study, there remain certain caveats that might need improvement in the future. For instance, several clinical reports have suggested that the usage of NSAIDs after fracture could have adverse effects on bone healing, owing to a reduction in prostaglandin E2 synthesis [37–41]. This prompted us to further examine the exact relationship between bone formation and NSAIDs, excluding the interference from other factors, such as presence of inflammatory conditions or decreased level of physical activity [42,43]. Another limitation is that the present study does not fully examined the effect of flufenamic acid for M-CSF signaling in BMMs. The binding of the M-CSF to c-Fms could regulate TNF-induced inflammatory osteolysis[44]. However, the
result of RNA-sequencing indicated that M-CSF signaling pathway was not the main signaling pathway affected by flufenamic acid. Therefore, we examined the activation of MAPK signaling pathway at the protein level in this experiment. In addition, the concentration of flufenamic acid used in this study might be a little bit higher than small molecular inhibitors or antibodies [45,46]. However, in contrast to other published research on flufenamic acid that the concentration is usually between 20 µM and 100 µM, the concentration in this study might be reasonable for inhibiting osteoclast differentiation [47–49]. In conclusion, it is noteworthy that flufenamic acid could obstruct osteoclast differentiation and bone resorption in a dose-dependent manner both in vitro and in vivo. The underlying mechanism was attributed to the suppression of phosphorylation of MAPK pathway by flufenamic acid. Therefore, our results indicate that flufenamic acid could be an attracting therapeutic agent for the prevention of postmenopausal osteoporosis, and its clinical use might decrease the risk of fractures to a great extent. In the context of future drug development, our study also highlights the importance of developing compounds with dual action against bone resorption and pain in elderly people. Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (81472119 and 81672196) and Shanghai “Rising Stars of Medical Talent” Youth Development Program (Youth Medical Talents – Specialist Program). Appendix A. Supplementary material Supplementary data to this article can be found online at https:// 8
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
doi.org/10.1016/j.intimp.2019.106014. References [1] R. Eastell, T.W. O'Neill, L.C. Hofbauer, B. Langdahl, I.R. Reid, D.T. Gold, S.R. Cummings, Postmenopausal osteoporosis, Nat. Rev. Dis. Primers 2 (2016) 16069. [2] P.J. Meunier, C. Roux, E. Seeman, S. Ortolani, J.E. Badurski, T.D. Spector, J. Cannata, A. Balogh, E.M. Lemmel, S. Pors-Nielsen, R. Rizzoli, H.K. Genant, J.Y. Reginster, The effects of strontium ranelate on the risk of vertebral fracture in women with postmenopausal osteoporosis, N. Engl. J. Med. 350 (5) (2004) 459–468. [3] S.T. Harris, N.B. Watts, H.K. Genant, C.D. McKeever, T. Hangartner, M. Keller, C.H. Chesnut 3rd, J. Brown, E.F. Eriksen, M.S. Hoseyni, D.W. Axelrod, P.D. Miller, Effects of risedronate treatment on vertebral and nonvertebral fractures in women with postmenopausal osteoporosis: a randomized controlled trial. Vertebral Efficacy With Risedronate Therapy (VERT) Study Group, JAMA 282 (14) (1999) 1344–1352. [4] U.A. Liberman, S.R. Weiss, J. Broll, H.W. Minne, H. Quan, N.H. Bell, J. RodriguezPortales, R.W. Downs Jr., J. Dequeker, M. Favus, Effect of oral alendronate on bone mineral density and the incidence of fractures in postmenopausal osteoporosis. The Alendronate Phase III Osteoporosis Treatment Study Group, N. Engl. J. Med. 333 (22) (1995) 1437–1443. [5] R. Eastell, Treatment of postmenopausal osteoporosis, N. Engl. J. Med. 338 (11) (1998) 736–746. [6] X. Li, M.S. Ominsky, K.S. Warmington, S. Morony, J. Gong, J. Cao, Y. Gao, V. Shalhoub, B. Tipton, R. Haldankar, Q. Chen, A. Winters, T. Boone, Z. Geng, Q.T. Niu, H.Z. Ke, P.J. Kostenuik, W.S. Simonet, D.L. Lacey, C. Paszty, Sclerostin antibody treatment increases bone formation, bone mass, and bone strength in a rat model of postmenopausal osteoporosis, J. Bone Miner. Res. 24 (4) (2009) 578–588. [7] D.M. Black, C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 374 (3) (2016) 254–262. [8] C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 353 (6) (2005) 595–603. [9] G.D. Roodman, Cell biology of the osteoclast, Exp. Hematol. 27 (8) (1999) 1229–1241. [10] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation, Nature 423 (6937) (2003) 337–342. [11] S.L. Teitelbaum, F.P. Ross, Genetic regulation of osteoclast development and function, Nat. Rev. Genet. 4 (8) (2003) 638–649. [12] T. Wada, T. Nakashima, N. Hiroshi, J.M. Penninger, RANKL-RANK signaling in osteoclastogenesis and bone disease, Trends Mol. Med. 12 (1) (2006) 17–25. [13] T.J. Chambers, Regulation of the differentiation and function of osteoclasts, J. Pathol. 192 (1) (2000) 4–13. [14] K. Lee, I. Seo, M.H. Choi, D. Jeong, Roles of mitogen-activated protein kinases in osteoclast biology, Int. J. Mol. Sci. 19 (10) (2018). [15] K. Lee, Y.H. Chung, H. Ahn, H. Kim, J. Rho, D. Jeong, Selective regulation of MAPK signaling mediates RANKL-dependent osteoclast differentiation, Int. J. Biol. Sci. 12 (2) (2016) 235–245. [16] Z.H. Lee, H.-H. Kim, Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts, Biochem. Biophys. Res. Commun. 305 (2) (2003) 211–214. [17] K. Kim, S.H. Lee, J. Ha Kim, Y. Choi, N. Kim, NFATc1 induces osteoclast fusion via up-regulation of Atp6v0d2 and the dendritic cell-specific transmembrane protein (DC-STAMP), Mol. Endocrinol. 22 (1) (2008) 176–185. [18] J.H. Kim, N. Kim, Regulation of NFATc1 in osteoclast differentiation, J. Bone. Metab. 21 (4) (2014) 233–241. [19] S.L. Teitelbaum, Bone resorption by osteoclasts, Science 289 (5484) (2000) 1504–1508. [20] J.D. Ringe, H. Faber, O. Bock, S. Valentine, D. Felsenberg, M. Pfeifer, H.W. Minne, S. Schwalen, Transdermal fentanyl for the treatment of back pain caused by vertebral osteoporosis, Rheumatol. Int. 22 (5) (2002) 199–203. [21] G.A. Green, Understanding NSAIDs: from aspirin to COX-2, Clin Cornerstone 3 (5) (2001) 50–60. [22] W.F. Kean, W.W. Buchanan, The use of NSAIDs in rheumatic disorders 2005: a global perspective, Inflammopharmacology 13 (4) (2005) 343–370. [23] D.C. Bauer, E.S. Orwoll, K.M. Fox, T.M. Vogt, N.E. Lane, M.C. Hochberg, K. Stone, M.C. Nevitt, Aspirin and NSAID use in older women: effect on bone mineral density and fracture risk. Study of Osteoporotic Fractures Research Group, J. Bone Miner. Res. 11 (1) (1996) 29–35. [24] L.D. Carbone, F.A. Tylavsky, J.A. Cauley, T.B. Harris, T.F. Lang, D.C. Bauer, K.D. Barrow, S.B. Kritchevsky, Association between bone mineral density and the use of nonsteroidal anti-inflammatory drugs and aspirin: Impact of cyclooxygenase selectivity, J. Bone Miner. Res. 18 (10) (2003) 1795–1802. [25] J.B. Richards, L. Joseph, K. Schwartzman, N. Kreiger, A. Tenenhouse, D. Goltzman, Canadian multicentre osteoporosis study, the effect of cyclooxygenase-2 inhibitors on bone mineral density: results from the Canadian multicentre osteoporosis study, Osteoporos. Int. 17 (9) (2006) 1410–1419. [26] M. Kawashima, Y. Fujikawa, I. Itonaga, C. Takita, H. Tsumura, The effect of selective cyclooxygenase-2 inhibitor on human osteoclast precursors to influence osteoclastogenesis in vitro, Mod. Rheumatol. 19 (2) (2009) 192–198. [27] M. Kellinsalmi, V. Parikka, J. Risteli, T. Hentunen, H.V. Leskela, S. Lehtonen, K. Selander, K. Vaananen, P. Lehenkari, Inhibition of cyclooxygenase-2 down-regulates osteoclast and osteoblast differentiation and favours adipocyte formation in vitro, Eur. J. Pharmacol. 572 (2–3) (2007) 102–110. [28] M. Ishida, W.R. Shen, K. Kimura, A. Kishikawa, K. Shima, S. Ogawa, J. Qi, F. Ohori, T. Noguchi, A. Marahleh, H. Kitaura, DPP-4 inhibitor impedes lipopolysaccharide-
Fig. 6. Flufenamic acid prevented OVX-induced osteoporosis in mice. (A) The femurs of all groups of mice were scanned with a high-resolution micro-CT. (B) Quantitative analysis of bone mineral density (BMD), bone volume/tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and structure model index (SMI). Data are expressed as means ± SD. n = 5. (*p < 0.05; **p < 0.01; ***p < 0.001.) (C) Sections of femurs were stained with H&E and TRAP. (D) The number of osteoclasts per field of tissue (N.Oc/BS), and osteoclast surface/bone surface (Oc.S/BS) in sections stained by TRAP. Data are expressed as means ± SD. n = 5, (*p < 0.05; **p < 0.01; ***p < 0.001.)
9
International Immunopharmacology xxx (xxxx) xxxx
S. Zhang, et al.
[29] [30] [31]
[32]
[33]
[34] [35]
[36]
[37] [38]
[39] P.V. Giannoudis, D.A. MacDonald, S.J. Matthews, R.M. Smith, A.J. Furlong, P. De Boer, Nonunion of the femoral diaphysis, J. Bone Joint Surg. British 82-B (5) (2000) 655–658. [40] R.K. Hernandez, T.P. Do, C.W. Critchlow, R.E. Dent, S.S. Jick, Patient-related risk factors for fracture-healing complications in the United Kingdom General Practice Research Database, Acta Orthop. 83 (6) (2012) 653–660. [41] P. Geusens, P.J. Emans, J.J. de Jong, J. van den Bergh, NSAIDs and fracture healing, Curr. Opin. Rheumatol. 25 (4) (2013) 524–531. [42] K.A. Blackwell, L.G. Raisz, C.C. Pilbeam, Prostaglandins in bone: bad cop, good cop? Trends Endocrinol. Metab. 21 (5) (2010) 294–301. [43] A.P. Kurmis, T.P. Kurmis, J.X. O'Brien, T. Dalen, The effect of nonsteroidal antiinflammatory drug administration on acute phase fracture-healing: a review, J. Bone Joint Surg. Am. 94 (9) (2012) 815–823. [44] H. Kitaura, P. Zhou, H.J. Kim, D.V. Novack, F.P. Ross, S.L. Teitelbaum, M-CSF mediates TNF-induced inflammatory osteolysis, J. Clin. Invest. 115 (12) (2005) 3418–3427. [45] A. Marahleh, H. Kitaura, M. Ishida, K. Shima, A. Kishikawa, S. Ogawa, W.R. Shen, J. Qi, F. Ohori, T. Noguchi, Y. Nara, I. Mizoguchi, Effect of anti-c-fms antibody on osteoclast formation and proliferation of osteoclast precursor in vitro, J Vis Exp (145) (2019). [46] A. Kishikawa, H. Kitaura, K. Kimura, S. Ogawa, J. Qi, W.R. Shen, F. Ohori, T. Noguchi, A. Marahleh, Y. Nara, A. Ichimura, I. Mizoguchi, Docosahexaenoic acid inhibits inflammation-induced osteoclast formation and bone resorption in vivo through GPR120 by inhibiting TNF-alpha production in macrophages and directly inhibiting osteoclast formation, Front. Endocrinol. (Lausanne) 10 (2019) 157. [47] R. Guinamard, C. Simard, C. Del Negro, Flufenamic acid as an ion channel modulator, Pharmacol. Ther. 138 (2) (2013) 272–284. [48] R. Ge, L. Hu, Y. Tai, F. Xue, L. Yuan, G. Wei, Y. Wang, Flufenamic acid promotes angiogenesis through AMPK activation, Int. J. Oncol. 42 (6) (2013) 1945–1950. [49] P. Pongkorpsakol, S. Satitsri, P. Wongkrasant, P. Chittavanich, S. Kittayaruksakul, P. Srimanote, V. Chatsudthipong, C. Muanprasat, Flufenamic acid protects against intestinal fluid secretion and barrier leakage in a mouse model of Vibrio cholerae infection through NF-kappaB inhibition and AMPK activation, Eur. J. Pharmacol. 798 (2017) 94–104.
induced osteoclast formation and bone resorption in vivo, Biomed. Pharmacother. 109 (2019) 242–253. M.T. Drake, B.L. Clarke, E.M. Lewiecki, The pathophysiology and treatment of osteoporosis, Clin. Ther. 37 (8) (2015) 1837–1850. A.R. Cappola, D.M. Shoback, Osteoporosis therapy in postmenopausal women with high risk of fracture, JAMA 316 (7) (2016) 715–716. J.A. Kanis, C. Cooper, R. Rizzoli, J.Y. Reginster, Scientific Advisory Board of the European Society for, O. Economic Aspects of, A. the Committees of Scientific, F. National Societies of the International Osteoporosis, European guidance for the diagnosis and management of osteoporosis in postmenopausal women, Osteoporos. Int. 30 (1) (2019) 3–44. A. Singer, A. Exuzides, L. Spangler, C. O'Malley, C. Colby, K. Johnston, I. Agodoa, J. Baker, R. Kagan, Burden of illness for osteoporotic fractures compared with other serious diseases among postmenopausal women in the United States, Mayo Clin. Proc. 90 (1) (2015) 53–62. J. Compston, A. Cooper, C. Cooper, N. Gittoes, C. Gregson, N. Harvey, S. Hope, J.A. Kanis, E.V. McCloskey, K.E.S. Poole, D.M. Reid, P. Selby, F. Thompson, A. Thurston, N. Vine, G. National Osteoporosis Guideline, UK clinical guideline for the prevention and treatment of osteoporosis, Arch. Osteoporos. 12 (1) (2017) 43. I.R. Reid, Osteonecrosis of the jaw: who gets it, and why? Bone 44 (1) (2009) 4–10. S. Khosla, D. Burr, J. Cauley, D.W. Dempster, P.R. Ebeling, D. Felsenberg, R.F. Gagel, V. Gilsanz, T. Guise, S. Koka, L.K. McCauley, J. McGowan, M.D. McKee, S. Mohla, D.G. Pendrys, L.G. Raisz, S.L. Ruggiero, D.M. Shafer, L. Shum, S.L. Silverman, C.H. Van Poznak, N. Watts, S.B. Woo, E. Shane, B. American Society for, R. Mineral, Bisphosphonate-associated osteonecrosis of the jaw: report of a task force of the American Society for Bone and Mineral Research, J. Bone Miner. Res. 22 (10) (2007) 1479–1491. S.B. Woo, J.W. Hellstein, J.R. Kalmar, Narrative [corrected] review: bisphosphonates and osteonecrosis of the jaws, Ann. Intern. Med. 144 (10) (2006) 753–761. R.W. van Esch, M.M. Kool, S. van As, NSAIDs can have adverse effects on bone healing, Med. Hypotheses 81 (2) (2013) 343–346. Q. Li, Z. Zhang, Z. Cai, High-dose ketorolac affects adult spinal fusion: a metaanalysis of the effect of perioperative nonsteroidal anti-inflammatory drugs on spinal fusion, Spine (Phila Pa 1976) 36 (7) (2011) E461-8.
10