Fluorescent and bimolecular-fluorescent protein tagging of genes at their native loci in Neurospora crassa using specialized double-joint PCR plasmids

Fungal Genetics and Biology 48 (2011) 866–873

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Technological Advancement

Fluorescent and bimolecular-fluorescent protein tagging of genes at their native loci in Neurospora crassa using specialized double-joint PCR plasmids Thomas M. Hammond a,1, Hua Xiao a,1, David G. Rehard a, Erin C. Boone a, Tony D. Perdue b, Patricia J. Pukkila b, Patrick K.T. Shiu a,⇑ a b

Division of Biological Sciences, University of Missouri, Columbia, MO 65211, United States Department of Biology, University of North Carolina, Chapel Hill, NC 27599, United States

a r t i c l e

i n f o

Article history: Received 5 February 2011 Accepted 3 May 2011 Available online 31 May 2011 Keywords: Double-joint polymerase chain reaction (DJPCR) Fluorescent protein tagging Targeted gene placement Filamentous fungi Bimolecular fluorescence complementation (BiFC) Meiotic silencing by unpaired DNA (MSUD)

a b s t r a c t The double-joint polymerase chain reaction (DJ-PCR) is a technique that can be used to construct vectors for targeted genome integration without laborious subcloning steps. Here we report the availability of plasmids that facilitate DJ-PCR-based construction of Neurospora crassa tagging vectors. These plasmids allow the creation of green or red fluorescent protein (GFP or RFP) tagging vectors for protein localization studies, as well as split-yellow fluorescent protein (YFP) tagging vectors for bimolecular fluorescence complementation (BiFC) analyses. We have demonstrated the utility of each plasmid with the tagging of known meiotic silencing proteins. Microscopic analysis of the tagged strains indicates that SMS-2 and QIP form macromolecular complexes in the perinuclear region during meiosis. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction The study of molecular genetics often involves inserting or removing DNA from a genome. The efficiency of this process can be improved by reducing the time and labor involved in the construction of transformation vectors, which are fragments of DNA designed to facilitate the genomic change, and in screening for individuals with the desired outcome. The finding that disrupting the Neurospora crassa non-homologous end-joining (NHEJ) pathway (e.g. by mutating mus-51 or mus-52) eliminates random integration of transgenes has led to a dramatic increase in screening efficiency (Ninomiya et al., 2004). This major technological advance has prompted several groups to construct tools to improve the efficiency of transformation vector construction. For example, the Neurospora Genome Project group has designed a strategy for semi-automated construction of genome-wide gene-replacement vectors (Colot et al., 2006), while Honda and Selker (2009) have developed a system for efficiently generating vectors and tagging a gene at its native locus with FLAG, HA, Myc, GFP, or HAT–FLAG. The tagging of genes at their native loci with fluorescent protein constructs is particularly desirable for our work on meiotic ⇑ Corresponding author. Fax: +1 573 882 0123. 1

E-mail address: [email protected] (P.K.T. Shiu). These authors contributed equally to this work.

1087-1845/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2011.05.002

silencing by unpaired DNA (MSUD), a mechanism that suppresses the expression of unpaired genes during meiosis (Shiu et al., 2001). In N. crassa, meiosis occurs in a relatively small number of asynchronously developing spore sacs (asci), which are encased in a hard-shelled fruiting body (perithecium). The limited amount of isolatable tissue has thus made microscopic techniques more feasible than biochemical ones, and as a result, our current model for MSUD is largely supported by a combination of genetic experimentation and fluorescent microscopy studies. In this model, the presence of unpaired DNA triggers the production of an aberrant RNA molecule that is made double-stranded (ds) by the SAD-1 RNA-directed RNA polymerase (RdRP) (Shiu and Metzenberg, 2002). The DCL-1 Dicer processes this dsRNA into small interfering (si) RNA (Alexander et al., 2008), which are then incorporated into a protein complex including the SMS-2 Argonaute (Lee et al., 2003) and possibly an exonuclease known as QIP. QIP colocalizes with SMS-2 in the perinuclear region, is required for MSUD, and interacts with an SMS-2 paralog (QDE-2) in the vegetative phase of the fungus (Maiti et al., 2007; Xiao et al., 2010; Lee et al., 2010). A fifth MSUD protein, SAD-2, is required for the perinuclear localization of SAD-1 (Shiu et al., 2006). Previous work with MSUD fluorescent protein tags relied predominantly on ‘‘first generation’’ tagging plasmids (Freitag et al., 2004; Freitag and Selker, 2005; Bardiya et al., 2008). Although these plasmids allow transformation-ready vectors to

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

be constructed for most genes in a single cloning step, their utilization limits the targeting of a transgene to a specific locus (i.e., his-3). For studies requiring more than one transgene to be expressed in a strain, an efficient way to construct a vector, designed to deliver a transgene anywhere in the genome, is highly desirable. This is especially true for MSUD studies, where we rely on fluorescent colocalization studies and split-yfp complementation assays to investigate the relationships among various proteins. The vector construction tools created by the Neurospora Genome Project group as well as Honda and Selker rely on yeast recombinatorial cloning as an improved method over conventional restriction fragment ligation and cloning (Colot et al., 2006; Honda and Selker, 2009). To create vectors for native locus tagging of Neurospora genes, we developed a series of plasmids that allow the use of a technique previously demonstrated in Aspergillus fungi: the double-joint polymerase chain reaction (DJ-PCR) (Yang et al., 2004; Yu et al., 2004). With DJ-PCR, oligonucleotide primers are used to create artificial overlaps in three DNA fragments necessary for a complete transformation vector, which are then fused and amplified without the need for ligation or cloning. The three DNA fragments include a center fragment, containing the desired transgene sequences, and two flanking fragments, containing sequences necessary to target the transgene to a specific genomic location. In a recent report, we used a qip-gfp native locus tag to show that QIP and SMS-2 colocalize in the perinuclear region (Xiao et al., 2010). Here we provide a full description of the steps we undertook to create this tag (as well as others) by DJ-PCR. In total, we have developed seven plasmids that facilitate DJ-PCR-based construction of N. crassa gfp, rfp, and split-yfp transformation vectors. We have demonstrated the utility of these plasmids by tagging qip, sms-2, and sad-2 at their native loci, visualizing their protein localization during meiosis, and further investigating the possibility of an interaction between QIP and SMS-2. The seven plasmids described in this work (GenBank accession numbers JF749198–749204) are available through the Fungal Genetics Stock Center (FGSC; McCluskey et al., 2010).

2. Materials and methods 2.1. Plasmid construction The final plasmids for this study are depicted in Fig. 1. The primer sets used are described below and in Table 1. pTH1067.9 (-gfp). The gfp-coding region was (PCR-)amplified from plasmid pMF272 (Freitag et al., 2004) using ‘‘primer set A’’ and the Aspergillus nidulans trpC terminator [trpC(T)] (Mullaney et al., 1985) was amplified from A. nidulans genomic DNA using ‘‘primer set B’’. The resulting DNA fragments were joined by fusion PCR, amplified with ‘‘primer set C’’, and inserted into pCRII-TOPO (Invitrogen, Carlsbad, CA). A hygromycin resistance gene (hph, encoding a hygromycin B phosphotransferase) was then released from plasmid pCB1004 (Carroll et al., 1994) with the restriction enzyme HpaI and inserted into the HpaI restriction site of the (GA)4::gfp::trpC(T)-pCRII-TOPO plasmid to create pTH1067.9. (GA)4 or ‘‘GA-linker’’ refers to a 24-bp DNA fragment encoding four repeats of the amino acids Glycine and Alanine. pTH1111.1 (-rfp). The A. nidulans pyrG terminator [pyrG(T)] (Oakley et al., 1987) was amplified from A. nidulans genomic DNA using ‘‘primer set D’’ and inserted into pCRII-TOPO to create plasmid pTH1083.1. A SpeI/NotI restriction fragment containing pyrG(T) was then released from pTH1083.1 and inserted into the identical restriction sites in the rfp-containing plasmid pMF334 (Freitag and Selker, 2005). The resulting rfp::pyrG(T) plasmid served as a template for the amplification of fragment (GA)4::rfp:: pyrG(T) with ‘‘primer set F’’, and the PCR product was inserted into

867

pCRII-TOPO. As described above, hph was inserted into the HpaI site of the resulting plasmid to create pTH1111.1. Since the dimeric rfp construct used here is subject to repeat-induced point (RIP) mutation in subsequent crosses, the inclusion of a rid (RIP defective; Freitag et al., 2002) allele in the target strain is recommended. pTH1112.8 (-yfpn). ApaI restriction sites were placed on both sides of pyrG(T) by the amplification of said terminator using ‘‘primer set I’’ with pTH1083.1 as a template, and the PCR product was inserted into pCRII-TOPO. The ApaI-bracketed terminator was then inserted into the ApaI site of the pYFPN plasmid (Bardiya et al., 2008). This modified plasmid was then used as a template for the amplification of (GA)4::yfpn::pyrG(T) with ‘‘primer set J’’, and the PCR product was inserted into pCRII-TOPO. hph was inserted into the HpaI site of the resulting plasmid to create pTH1112.8. pTH1108.2 (-yfpc). ApaI restriction sites were placed on both sides of trpC(T) by the amplification of said terminator using ‘‘primer set G’’ with pTH1067.9 as a template, and the PCR product was inserted into pCRII-TOPO. The ApaI-bracketed terminator was then inserted into the ApaI site of the pYFPC plasmid (Bardiya et al., 2008). This modified plasmid was then used as a template for the amplification of (GA)4::yfpc::trpC(T) with ‘‘primer set H’’, and the PCR product was inserted into pCRII-TOPO. hph was then inserted into the HpaI site of the resulting plasmid to create pTH1108.2. pTH1117.12 (gfp-). The N. crassa ccg-1 promoter region [ccg1(P)] (Loros et al., 1989) was amplified from N. crassa genomic DNA using ‘‘primer set K’’ and the gfp-coding region was amplified from pMF272 using ‘‘primer set L’’. The resulting DNA fragments were joined by fusion PCR, amplified with ‘‘primer set M’’, and inserted into pCRII-TOPO. hph was inserted into the EcoRV site of the ccg-1(P)::gfp::(GA)4-containing plasmid to create pTH1117.12. pTH1123.1 (yfpn-). ccg-1(P) was amplified from N. crassa genomic DNA using ‘‘primer set K’’ and the yfpn-coding region was amplified from pYFPN using ‘‘primer set L’’. The resulting DNA fragments were joined by fusion PCR, amplified with ‘‘primer set N’’, and inserted into pCRII-TOPO. hph was inserted into the EcoRV site of the ccg-1(P)::yfpn::(GA)4-containing plasmid to create pTH1123.1. pTH1124.1 (yfpc-). ccg-1(P) was amplified from N. crassa genomic DNA using ‘‘primer set O’’ and the yfpc-coding region was amplified from pYFPC using ‘‘primer set P’’. The resulting DNA fragments were joined by fusion PCR, amplified with ‘‘primer set Q’’, and inserted into pCRII-TOPO. hph was inserted into the EcoRV site of the ccg-1(P)::yfpc::(GA)4-containing plasmid to create pTH1124.1. 2.2. Double-joint polymerase chain reaction (DJ-PCR) Extensive technical details of DJ-PCR were described by Yang et al. (2004) and Yu et al. (2004). Our three-step version of the technique is similar to that of Yu et al. (2004) and a graphical description is provided in Fig. 2. 2.2.1. Step 1 The center and the flanking DNA fragments (Fig. 2) were amplified with AccuPrime Pfx Polymerase (Invitrogen) under standard PCR-cycling conditions. Center fragments were amplified using the plasmid templates, primer sets, and annealing temperatures described in Tables 2 and 3. Flanking DNA was amplified from N. crassa genomic DNA using the primer sets described in Table 3. 50 overhangs of 25–27 nucleotides were included in the forward primer for the right flank and the reverse primer for the left flank to allow fusion of the flanks and the center fragments in step 2.

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

13

13

ori

pCRII-TOPO

kan

M

M

A

F

R

868

>

<

amp

4.0 kb

{ TA cloning site } [EcoRV]

B

hph

pTH1067.9 (-gfp)

trpC(T)

} rfp

pTH1111.1 (-rfp)

{

pTH1112.8 (-yfpn)

{

pTH1108.2 (-yfpc)

{

pTH1117.12 (gfp-)

{

pTH1123.1 (yfpn-)

{

pTH1124.1 (yfpc-)

{

rfp

pyrG(T)

6.7 kb

hph

} hph

pyrG(T)

trpC(T)

6.4 kb

hph

6.2 kb

} gfp

yfpn

yfpc

7.3 kb

yfpn

} yfpc

C

GA-linker

gfp

{

ccg-1(P)

ccg-1(P)

}[

ccg-1(P)

hph

}[

]

hph

]

7.0 kb

6.8 kb

hph

}[

]

6.6 kb

Fig. 1. Plasmids for the construction of fluorescent protein tagging vectors with DJ-PCR. All plasmids encode a center fragment necessary for DJ-PCR-based construction of fluorescent protein tagging vectors. (A) pCRII-TOPO is the base plasmid. (B) Plasmids for C-terminal protein tagging are pTH1067.9 (-gfp), pTH1111.1 (-rfp), pTH1112.8 (-yfpn), and pTH1108.2 (-yfpc). The C-terminal tagging plasmids include a (GA)4-linker, a tag, a terminator, and a hygromycin resistance cassette all within the ‘‘TA’’ cloning site. (C) Plasmids for N-terminal protein tagging are pTH1117.12 (gfp-), pTH1123.1 (yfpn-), and pTH1124.1 (yfpc-). The N-terminal tagging plasmids include a promoter, a tag, and a (GA)4-linker within the ‘‘TA’’ cloning site. The hygromycin resistance (HpaI) cassette for the N-terminal tagging plasmids was inserted into the EcoRV site adjacent to the ‘‘TA’’ cloning site. The EcoRV site was destroyed during the cloning process. {}, sequence within ‘‘TA’’ cloning site; [], sequence within EcoRV site; pyrG(T), terminator sequence of the A. nidulans pyrG gene; trpC(T), terminator sequence of the A. nidulans trpC gene; ccg-1(P), promoter sequences of the N. crassa ccg-1 gene; hph, Escherichia coli hygromycin resistance cassette.

Table 1 Oligonucleotide primers used to create fluorescent protein tagging plasmids. Name

Sequence (50 –30 )

Set

GFP-Tag 2 GFP-Tag 3 GFP-Tag 4 GFP-Tag 5 GFP-Tag 1 An-pyrGT-F An-pyrGT-R RFP-linker AntrpCT-APAI-F AntrpCT-APAI-R YFPC-linker AnpyrGT-APAIF AnpyrGT-APAIR YFPN-linker NCCG-R1 NCCG-F1 NGFP-F1 NGFP-R1 TH013009b TH013009a TH031809a NCCG-R2 NYFPC-F1 TH033009b

GGAGCTGGTGCAGGCGCTGGAGCCATGGTGAGCAAGGGCGAGGA CACTAGAAGGCACTCTTTGCTGCTTACTTGTACAGCTCGTCCATGC GCATGGACGAGCTGTACAAGTAAGCAGCAAAGAGTGCCTTCTAGTG GTTAACCTGTGCATTCTGGGTAAACGA GGAGCTGGTGCAGGCGCT AAACTAGTTGAGTGTGAGTGGAAATGTGTAACG AAGTTAACGCTTCGGGTAGAGTATGTGGTCCTG GGAGCGGGTGCGGGTGCTGGAGCGATGGTGGCCTCCTCCGAGGAC GGGCCCGCAGCAAAGAGTGCCTTCTAGTG GGGCCCGTTAACCTGTGCATTCTGGGTAAACGA GGAGCGGGTGCGGGTGCTGGAGCGGACAAGCAGAAGAACGGCATCAAG GGGCCCTGAGTGTGAGTGGAAATGTGTAACG GGGCCCGTTAACGCTTCGGGTAGAGTATGTGGTCCTG GGAGCGGGTGCGGGTGCTGGAGCGATGGTGAGCAAGGGCGAGGAG TCCTCGCCCTTGCTCACCATTTTGGTTGATGTGAGGGGTTGTGAA CACGGCTGTCAAGTCCTGTGTGA TTCACAACCCCTCACATCAACCAAAATGGTGAGCAAGGGCGAGGA TCAGAGGGAGTGTGGGAAATGGTG AGCACCCGCACCCGCTCCTGCCCCCTTGTACAGCTCGTCCATGCCGTGAG TAGAAGGAGCAGTCCATCTGCGTGAATC AGCACCCGCACCCGCTCCTGCCCCGGCCATGATATAGACGTTGTGGCTGT CCTTGATGCCGTTCTTCTGCTTGTCCATTTTGGTTGATGTGAGGGGTTGTGAA TTCACAACCCCTCACATCAACCAAAATGGACAAGCAGAAGAACGGCATCAAGG AGCACCCGCACCCGCTCCTGCCCCCTTGTACAGCTCGTCCATGCCGAGAG

A A B B, C C D D, F F G G, H H I I, J J K K, O L L, P M M, N, Q N O P Q

2.2.2. Step 2 The center and the flanking fragments from step 1 were purified with the QIAquick Gel Extraction Kit (Qiagen). Subsequently, 2 ll of each flank (50–100 ng) and 4 ll of the desired center fragment (100–200 ng) were PCR-fused (Fig. 2C) with Expand Long Range

Polymerase (Roche, Indianapolis, IN) in a 25 ll reaction using the following PCR cycling parameter: (1) 92 °C, 2 min; (2) 92 °C, 10 s; 3) 58 °C, 4 min; (4) 68 °C, 6 min; (5) go to step 2, 10; (6) 68 °C, 10 min; (7) 4 °C, 1. Conventional oligonucleotide primers were not included in these reactions.

869

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

Left and right flank design

Double-joint PCR based fusion of flanks to center fragments from Fig. 1B and 1C.

A

C

N-terminal tagging left fl. right fl.

Step 1 left fl.

center (Fig.1B and 1C)

right fl.

e.g. hph::ccg-1(P)::gfp::GA(5)

5' overhang

gene target 5' fl.

5' end

3' end

3' fl.

ATG

i.

Step 2

ii.

B

joint 2 joint 1 iii.

C-terminal tagging left fl. right fl.

iv. gene target 5' fl.

3' end

3' fl.

NNNTAG

Step 3 np1

np2

Fig. 2. A three-step version of DJ-PCR. Three fragments of DNA are required for DJ-PCR: a center fragment and two flanking fragments. The two flanking fragments (left fl. or right fl.) for either the N- or C-terminal tagging protocol are shown with their relative positions to the targeted gene. The following terminology is used to describe the gene targeted for tagging: 50 flank, the region before the start codon; 50 end, the N-terminal end of the coding nucleotides; 30 end, the C-terminal end of the coding nucleotides; 30 flank, the region after the stop codon. (A) For N-terminal tagging vectors, the left flank is composed of 1.0–1.2 kb of the 50 flank, while the right flank is composed of 1.0–1.2 kb of the 50 end of the gene target. Primers are designed to fuse the start codon of the gene in the right flank ‘‘in-frame’’ with the GA-linker of the center fragment (see Table 3). (B) For C-terminal tagging vectors, the left flank is composed of 1.0–1.2 kb of the 30 end of the gene target, while the right flank is composed of 1.0–1.2 kb of the 30 flank. Primers are designed to fuse the last non-stop codon of the gene in the left flank ‘‘in-frame’’ with the GA-linker of the center fragment (see Table 3). (C) Step 1. The three DNA fragments required for DJ-PCR are amplified and gel-purified. For N-terminal tagging vectors, the center fragment contains hph, ccg-1(P), a tag, and the linker. For C-terminal tagging vectors, the center fragment contains the linker, a tag, a terminator, and hph. Step 2. The flanks and the center fragment are included in a PCR reaction lacking conventional oligonucleotide PCR primers. Intermolecular priming of the reaction occurs because of the complementarity between the ends of the flanks and the center fragments, resulting in their fusion. Step 3. ‘‘Nested primers’’ (np1 and np2), which prime sites inward from the termini of the step 2 product, are used to amplify the final tagging vector. Nested primers are designed to amplify a final tagging vector from positions that allow for the inclusion of approximately 1.0 kb flanks on either side of the center fragment.

Table 2 Plasmids for DJ-PCR-based fluorescent protein tagging vector construction. Plasmid template

Purpose

Primer names

Annealing temp. (°C)

Expected size (kb)

pTH1067.9 pTH1111.1 pTH1112.8 pTH1108.2 pTH1117.12 pTH1123.1 pTH1124.1

-gfp -rfp -yfpn -yfpc gfpyfpnyfpc-

GFP-T-HPH-F1 and GFP-T-HPH-R1 YFPN-105-7-F and YFP-C-108-2-R ‘‘ YFPC-108-2-F and YFP-C-108-2-R pTH116F and pTH116R ‘‘ ‘‘

65 68 68 68 65 65 65

2.7 3.3 2.4 2.3 3.3 3.1 2.9

2.2.3. Step 3 The final tagging vector was amplified with Expand Long Range Polymerase using 2.5 ll of the raw product from step 2 and ‘‘nested’’ primers (Table 3) in a 25-ll reaction (Fig. 2C). Typically, three separate final reactions were performed for each tagging vector. The three reaction products were combined and purified with the QIAquick PCR-Purification Kit (Qiagen) before use in transformation. 2.3. Strains, transformation, and crosses Auxotrophic markers used in this study were obtained from the FGSC. Description of genetic loci can be found in the N. crassa eCompendium (http://bmbpcu36.leeds.ac.uk/~gen6ar/newgenelist/ genes/gene_list.htm). Transformations were performed by electroporation of conidia (Margolin et al., 1997) with selection for hygromycin resistance. Essentially, mus mutants P8-42 and P8-43 (Table 4) served as the transformation hosts, and six to eight hygromycin-resistant colonies were picked to appropriately supplemented Vogel’s medium (Vogel, 1956). Conidia from one to four candidate transformants were used to fertilize protoperithecia of a fl strain (F2-23 or F2-26). From these crosses, homokaryotic progeny of opposite mating types were isolated for each transformant

and their tag and target gene functionalities were tested. In our cases, the tag functionality could be screened by crossing two relevant progeny (e.g. gfp-sms-2  gfp-sms-2) and examining the sexual tissue for a fluorescent signal. For the gene function assay, since all target genes in this study are required for meiosis, a tagged gene is deemed functional if it allows for the ascospore production in a homozygous cross. For all strains, a final confirmation of correct transgene integration was performed by standard PCR using the same nested primer sets used to construct the tagging vector (Fig. 4). For strains that required tagging of two different genes, each gene was tagged individually in its own recipient strain and was later combined with the other tagged gene through a cross. 2.4. Fluorescence microscopy Typically, 6- to 8-days-old asci were fixed and prepared for microscopic analysis according to Alexander et al. (2008). Preliminary screening by fluorescence microscopy was performed on a Zeiss Universal Microscope. Confocal microscopy was performed on a Zeiss LSM710 microscope. Visualization of the YFP was achieved by use of a 514 nm Argon laser line for excitation and the detector was set to collect emission at 535–600 nm.

870

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

Table 3 Oligonucleotide primers for DJ-PCR-based vector construction. Oligo name

Sequence (50 –30 )

Purpose

Centers GFP-T-HPH-F1

GGGGCAGGAGCTGGTGCAGGCGCTGGAGCCAT

Center (F): -gfp

GCCCTTGTTAACTGATATTGAAGGAGCAT

GFP-T-HPH-R1 YFPN-105-7-F

GGGGCAGGAGCGGGTGCGGGTGCTGGAGCGAT

Center (R): -gfp Center (F): -rfp, -yfpn

YFPC-108-2-F

GGGGCAGGAGCGGGTGCGGGTGCTGGAGCGGA

Center (F): -yfpc

YFPC-108-2-R pTH116F pTH116R

GGCCCGTTAACTGATATTGAAGGAGCAT GCGCGTCCATTCGCCATTCA CGCTCCAGCACCCGCACCCGCTCCT

Center (R): -rfp, -yfpn/c Center (F): gfp-, yfpn/cCenter (R): gfp-, yfpn/c-

qip flanks QIP-A QIP-GFP1

CAGCGCCTGCACCAGCTCCTGCCCCCAACTCCCAGTTTTCACACACAGTAGTC

GATCTGCCGAGGAATGGAAGCAG

QIP-GFP2

CTCCTTCAATATCAGTTAACAAGGGCCTGGCAATGTTGTAACGCGCATC TGTTCAGTCCGCCTTGTCGTTGT GGGTTCAGCGGTATCTCGGTCTTC CCCATCCATTCCATGCCTCTTTC

Left flank (F): -gfp, -yfpn/c Left flank (R): -gfp Right flank (F): -gfp

QIP-B QIP-C QIP-D QIP-YFPC1

CAGCACCCGCACCCGCTCCTGCCCCCAACTCCCAGTTTTCACACACAGTAGTC

Right flank (R): -gfp, -yfpn/c Nested (F): -gfp, -yfpn/c Nested (R): -gfp, -yfpn/c Left flank (R): -yfpn/c

QIP-YFPC2

TGCTCCTTCAATATCAGTTAACGGGCCCTGGCAATGTTGTAACGCGCATC

Right flank (F): -yfpn/c

sms-2 flanks SMS-2-E SMS-2-NGFP1

GTCCACTTGGTGCCATTCCCACT

Left flank (F): gfp-, yfpn/cLeft flank (R): gfp-, yfpn/c-

GCAGCCTGAATGGCGAATGGACGCGCGCGGAGGGTGTCAAAACTCACAA CAGGAGCGGGTGCGGGTGCTGGAGCGATGTCTGCTCCTGGCTCTCCC GTGCCATTCTGCTGCTTCCAGTT CACTTGCCTACCACGCCATGATT TGCTCAAACCGCCGTAATTGTTG

Right flank (F): gfp-, yfpn/c-

SMS-2-F SMS-2-G SMS-2-H sad-2 flanks SAD-2-A SAD-2-YFPC1

GGGATTTATGCCCGCGTTCTCTA CAGCACCCGCACCCGCTCCTGCCCCAAGCGCCGCCATCTGTGCATAAC

Left flank (F): -rfp Left flank (R): -rfp

SMS-2-NGFP2

SAD-2-YFPC2

TGCTCCTTCAATATCAGTTAACGGGCCCCCCATCCTCATCTTCCATCACC CTTTCAGCAGCCCCCAACAACTC CGCCCATCATAACTTCCGAGTCAA GCCTTCTCCAGCCCATCACAACT

SAD-2-B SAD-2-C SAD-2-D

Right flank (R): gfp-, yfpn/cNested (F): gfp-, yfpn/cNested (R): gfp-, yfpn/c-

Right flank (F): -rfp Right flank (R): -rfp Nested (F): -rfp Nested (R): -rfp

Center fragment primers include a 50 overhang (double underlined nucleotides) on either the forward (F) or reverse (R) primer that codes for the fifth GA dipeptide of the linker between the tagged protein and the tag. Primers were designed to fuse tags to the start codon (N-termial tags, e.g. gfp-) or the last non-stop codon (C-terminal tags, e.g. -gfp). The positions of these codons are indicated with bold. The underlined nucleotides represent the 50 overhangs necessary for the fusion of flanks to center fragments. The primers designated as left flank, right flank, and center primers are used in step 1, while the nested primers are used in step 3 (Fig. 2C).

Table 4 Strains used in this study. Strain

Genotype

F2-23 F2-26 F5-06 F5-21 P8-42 P8-43 P9-42 P13-65 P14-04 P15-22 P15-44 P15-46 P15-49 P15-51 P15-62 P15-63 P15-64

rid; fl A rid; fl a rid; fl; gfp-sms-2::hph a rid; fl; mus-51D::bar; sad-2-rfp::hph A rid his-3; mus-51D::bar a rid his-3; mus-52D::bar A Oak Ridge wild-type a rid his-3+::yfpn; mus-52D::bar A rid his-3+::yfpc; mus-51D::bar a rid his-3; mus-52D::bar; gfp-sms-2::hph A rid; qip-yfpn::hph; yfpc-sms-2::hph a rid; qip-yfpn::hph; yfpc-sms-2::hph A rid; mus-52D::bar qip-yfpc::hph; yfpn-sms-2::hph a rid; mus-52D::bar qip-yfpc::hph; yfpn-sms-2::hph A rid; mus-52D::bar qip-gfp::hph a rid his-3; mus-52D::bar qip-gfp::hph A rid his-3; mus-51D::bar; sad-2-rfp::hph a

Parameters for GFP, RFP, and DAPI visualization were as previously described (Xiao et al., 2010). 3. Results 3.1. Construction of DJ-PCR-based N. crassa tagging vectors The plasmids depicted in Fig. 1 were designed to generate the center fragment for use in step 1 of the DJ-PCR-based vector

construction (Fig. 2). The center fragment is different between Nterminal and C-terminal tagging vectors. In N-terminal tagging vectors, it contains hph, ccg-1(P), a tag, and the linker. In C-terminal tagging vectors, it contains the linker, a tag, a terminator, and hph (Fig. 1). For six of the seven plasmid templates, a single predominant band of the expected size was obtained as a reaction product when PCR was performed under standard conditions (Fig. 3A). The C-terminal rfp tagging plasmid pTH1111.1, however, produced several bands within the vicinity of the expected product size (Fig. 3A). The predominant band was identified by DNA sequencing to be the result of false priming by the forward primer YFPN-1057-F. To reduce the problem of false priming with the rfp plasmid, we tested different ratios of forward and reverse primers for the amplification of the rfp center fragment. False priming by YFPN105-7-F was not detected when the concentration of the reverse primer was used at the recommended level (0.3 lM) and primer YFPN-105-7F was lowered to 0.02 lM (Fig. 3C). The single amplification product observed at these concentrations was determined to be the desired one by cloning and DNA sequencing (data not shown). Crude products from the fusion step of the DJ-PCR protocol (Fig. 2, step 2) were used directly as the template in the final amplification step (Fig. 2, step 3). Final amplification products for six of the seven DJ-PCR-based vectors were represented by a single predominant band of the expected size (Fig. 3B). These were qip-gfp, center from pTH1067.9; qip-yfpn, center from pTH1112.8; qip-yfpc, center from pTH1108.2; gfp-sms-2, center from pTH1117.12; yfpn-sms-2, center from pTH1123.1; and yfpc-sms-2,

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

871

Fig. 3. Center fragment amplification. (A) DJ-PCR center fragments were amplified using the fluorescent protein tagging plasmids as templates and AccuPrime Pfx Polymerase according to the manufacturer’s recommended reaction conditions. Specific PCR parameters and primer sets are listed in Table 2 and Table 3. For each reaction product, 2.5 ll of 25 ll total volume was analyzed by gel-electrophoresis on a 1% agarose/TAE gel. The lanes (from left to right) correspond to reaction products from the following templates: 2, pTH1067.9 (-gfp); 3, pTH1111.1 (-rfp); 4, pTH1112.8 (-yfpn); 5, pTH1108.2 (-yfpc); 6, pTH1117.12 (gfp-); 7, pTH1123.1 (yfpn-); 8, pTH1124.1 (yfpc-). Note that with one exception (lane 3, pTH1111.1, -rfp), all reaction products are represented by a single predominant band that matches the expected product size listed in Table 2. (B) The final tagging vectors (obtained after amplification with nested primers) are shown. For each reaction product, 0.5 ll of 50 ll total volume was analyzed, except for the sad-2-rfp vector (lane 3, 2.5 ll). The average concentration for the seven vectors was 362 ng/ll. The lanes correspond to the following vectors: 2, qip-gfp; 3, sad-2-rfp; 4, qipyfpn; 5, qip-yfpc; 6, gfp-sms-2; 7, yfpn-sms-2; 8, yfpc-sms-2. (C) The multiple fragment amplification problem observed for the pTH1111.1 (-rfp) center fragment was traced back to false priming by primer YFPN-105-7F. To address this problem, a series of AccuPrime Pfx Polymerase reactions were performed with different levels of the forward and reverse primers. For each of the reaction products, 2.5 ll of 25 ll total volume was analyzed by gel-electrophoresis on a 1% agarose/TAE gel. Note that by reducing the concentration of primer YFPN-105-7F to .02 lM, a single predominant band of the expected size was obtained (lane 9). The identity of this product has been confirmed by cloning and sequencing (data not shown). 1 kb DNA Ladder (Invitrogen) was used as the size marker.

center from pTH1124.1. The average amount of vector for these six products was 18 lg, which was enough for 36 transformations. However, the sad-2-rfp vector made with the center fragment from pTH1111.1 gave one product near the predicted size range (5.3 kb) and one 700 bp lower (Fig. 3B). The likely origins of these products are discussed below. Despite the presence of these undesired bands in the final amplification product, obtaining the tagged sad2-rfp strain was as straightforward as obtaining the others. 3.2. Transformation and candidate screening Because homologous integration in mus mutants is very efficient, only a small number (one to four) of candidate transformants are needed from each transformation. Candidates can be immediately crossed to a standard female (fl) strain to obtain homokaryotic progeny and the tag functionality conferred by these strains can be tested by microscopic analysis and phenotypic assays. Screening progeny from a few independent transformants in such a manner mitigates potential problems caused by PCR-induced mutations in the tagging vector and allows the time consuming step of molecular confirmation (Fig. 4) to come after the tag and gene function tests. For each strain construction in this work, one to eight homokaryotic progeny were analyzed and all were shown

to confer a fluorescent signal and proper tagged gene function (and in 90% of cases, transformants showed similar fluorescent signal strength). 3.3. SMS-2 and QIP interact in the perinuclear region QIP, SMS-2, and SAD-2 are all required for meiosis. Loss-offunction mutations or deletions of any one of these genes in both parents result in a barren cross (Lee et al., 2003, 2010; Shiu et al., 2006; Xiao et al., 2010). All of the strains used in this study are capable of going through meiosis, suggesting that the tags and/or tagging process do not severely affect the normal function of the three proteins. Previous work with first generation tagging plasmids has shown that the MSUD proteins predominantly localize in the perinuclear region (Shiu et al., 2006; Alexander et al., 2008; Xiao et al., 2010; Lee et al., 2010). In agreement with the above, the native locus tags created for this study place QIP, SAD-2, and SMS-2 in the same region (Fig. 5). Colocalization of the MSUD proteins suggests that they may co-exist in a protein complex. Additionally, QIP coimmunoprecipitates with an SMS-2 paralog in the vegetative phase of the fungus (Maiti et al., 2007), suggesting that it may interact directly with SMS-2 during meiosis.

872

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

Fig. 4. Tag confirmation. (A) The nested primers used to amplify each tagging vector (Table 3) were also used to confirm their correct integration. For N-terminal tags, these primers (set N) amplify the 50 flank, the tag, and the 50 end of the tagged gene. For C-terminal tags, these primers (set C) amplify the 30 end of the gene, the tag, and the 30 flank. (B) Genomic DNA was isolated from the following strains and used in PCR with the indicated primer sets. The genotype is listed above the lane number. Top: Lane 2, P15-44; lane 3, P15-46; lane 4, P15-49; lane 5, P15-51; lane 6, P15-62; lane 7, P15-63; lane 8, P9-42; lane 10; P15-44; lane 11, P15-46; lane 12, P15-49; lane 13, P15-51; lane 14, P942. Bottom: Lane 2, P15-64; lane 3, F5-21; lane 4, P9-42; lane 6, P15-22, lane 7, F5-06; lanes 8-11, sms-2+. Product size predictions for the tagged and untagged loci are as follows: qip-yfpn, 4.5 kb; qip-yfpc, 4.4 kb; qip-gfp, 4.8 kb; qip+, 2.3 kb; yfpc-sms-2, 5.0 kb; yfpn-sms-2, 5.2 kb; sad-2-rfp, 5.3 kb; sad-2+, 2.1 kb; gfp-sms-2, 5.4 kb; sms-2+, 2.3 kb. Size predictions match observations for products from all strains. 1 kb DNA Ladder (Invitrogen) was used as the size marker.

Accordingly, we investigated the relationship between SMS-2 and QIP more closely with a BiFC assay. Alternate tagging of SMS-2 and QIP at the native locus with YFPN and YFPC resulted in the reconstitution of the YFP fluorophore (Fig. 5J and M). These results provide the strongest evidence to date that QIP and SMS-2 are members of an MSUD complex that processes mRNA in the perinuclear region.

4. Discussion The seven plasmids described in this work were designed to facilitate DJ-PCR-based construction of fluorescent protein vectors for N. crassa. Because N-terminal tags separate the target gene’s start codon from its promoter region, N-terminal tagging plasmids include a standard N. crassa promoter (from ccg-1). Similarly, because C-terminal tags separate the target gene’s terminator from its stop codon, C-terminal tagging plasmids include the A. nidulans terminator sequence. Although terminator sequences may not be necessary in N. crassa (Carroll et al., 1994), they were included on the chance that they could improve the stability of transcripts from the tagged genes. Based on the C-terminal tagging strategy used by Yang et al. (2004), codons for four dipeptides of a (GA)5 linker are included in all of the plasmids. These are used as a flexible linker between the tagged protein and the tag. The fifth dipeptide for the linker is encoded by a 50 overhang in either the forward or reverse oligonucleotide primer used to amplify the center fragment (Table 3). Two slightly different linker sequences were tested in this study.

The first (50 GGG GCA GGA GCT GGT GCA GGC GCT GGA GCC 30 ) was used in pTH1067.9 (-gfp) while the second (50 GGG GCA GGA GCG GGT GCG GGT GCT GGA GCG 30 ) was used in all other tagging plasmids. The two linkers appeared to work equally well in the tagging constructs. During this study, a couple of problems were detected with pTH1111.1, the rfp-tagging plasmid. These include false priming during the amplification of the center fragment (step 1) and more than one high-concentration fragment being present in the sad-2rfp final amplification product (step 3) (Fig. 2 and 3B). It is likely that the two problems are connected, as the optimal conditions for step 1 (Fig. 3C) were not used before the final amplification (step 3). It is also possible that the unexpected (lower) band could be due to the loss of one of the 700-bp rfp repeats during PCRamplification. However, even though no attempt was made to gel-purify the correct fragment for the fusion step, there were no problems in obtaining the sad-2-rfp strain. DJ-PCR-based techniques offer several advantages over conventional cloning strategies for vector construction. The primary advantage is with time and labor. The protocol described here can easily produce enough purified vector for >30 transformations, essentially within the time it takes to run three PCR reactions. Also, in our experience, the protocol has almost always yielded a single predominant product of the expected size. Another advantage is that the flanks are interchangeable for all of the N-terminal tagging center fragments and most of the C-terminal center fragments (with -gfp being the exception). For example, the sms-2 flanks can be used for the gfp-, yfpn-, and yfpc- vectors, while the qip flanks can be used for the -yfpn, -yfpc, and -rfp vectors.

T.M. Hammond et al. / Fungal Genetics and Biology 48 (2011) 866–873

873

and members of the Shiu Laboratory for their indispensable help. During the course of this work, T.M.H. was supported by a Christopher S. Bond Life Science fellowship from the University of Missouri, followed by a Ruth L. Kirschstein National Research Service Award from the National Institute of General Medical Sciences. This work was supported by National Science Foundation Grant MCB0918937 (to P.K.T.S.). References

Fig. 5. Analysis of QIP, SMS-2 and SAD-2 fluorescent tags. Micrographs illustrate prophase asci expressing (A–C) qip-gfp (P15-62  P15-63). (D–F) gfp-sms-2 (F506  P15-22). (G–I) sad-2-rfp (F5-21  P15-64). (J–L) qip-yfpn and yfpc-sms-2 (P1544  P15-46). (M–O) qip-yfpc and yfpn-sms-2 (P15-49  P15-51). (P–R) yfpn and yfpc (P13-65  P14-04). The bar equals 5 lm.

A possible complication of this technique is an increased chance of PCR-induced mutations in the tagging vector. This may be a problem if the mutations occur in the flank representing the coding region or in the tag itself. To mitigate this potential problem, we have optimized the process by using a high-fidelity polymerase for the amplification of the initial fragments, followed by a mixture of high-fidelity and high-processivity polymerases for the fusion and amplification (see Section 2). Preliminary screening for fluorescent signal and function of the tagged gene is recommended before the time-consuming confirmation step (for correct integration). The work of Yang et al. (2004) and Yu et al. (2004) demonstrated the utility of DJ-PCR for fungal research. The plasmids provided here are designed to adapt this technique to fluorescent protein tagging in N. crassa. In conjunction with the NHEJ mutants (which prevent ectopic integration), these plasmids should help eliminate transgenic strain construction as the time-limiting aspect of N. crassa molecular genetics, allowing more time to be spent on hypothesis testing and experimentation. Acknowledgments The authors thank James Birchler for the use of his microscopy equipment, Nancy Keller for providing A. nidulans genomic DNA,

Alexander, W.G., Raju, N.B., Xiao, H., Hammond, T.M., Perdue, T.D., Metzenberg, R.L., Pukkila, P.J., Shiu, P.K.T., 2008. DCL-1 colocalizes with other components of the MSUD machinery and is required for silencing. Fungal Genet. Biol. 45, 719–727. Bardiya, N., Alexander, W.G., Perdue, T.D., Barry, E.G., Metzenberg, R.L., Pukkila, P.J., Shiu, P.K.T., 2008. Characterization of interactions between and among components of the meiotic silencing by unpaired DNA machinery in Neurospora crassa using bimolecular fluorescence complementation. Genetics 178, 593–596. Carroll, A.M., Sweigard, J.A., Valent, B., 1994. Improved vectors for selecting eesistance to hygromycin. Fungal Genet. Newslett. 41, 22. Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., Litvinkova, L., Weiss, R.L., Borkovich, K.A., Dunlap, J.C., 2006. A high-throughput gene knockout procedure for Neurospora reveals functions for multiple transcription factors. Proc. Natl. Acad. Sci. USA 103, 10352–10357. Freitag, M., Selker, E.U., 2005. Expression and visualization of red fluorescent protein (RFP) in Neurospora crassa. Fungal Genet. Newslett. 52, 14–17. Freitag, M., Williams, R.L., Kothe, G.O., Selker, E.U., 2002. A cytosine methyltransferase homologue is essential for repeat-induced point mutation in Neurospora crassa. Proc. Natl. Acad. Sci. USA 99, 8802–8807. Freitag, M., Hickey, P.C., Raju, N.B., Selker, E.U., Read, N.D., 2004. GFP as a tool to analyze the organization, dynamics and function of nuclei and microtubules in Neurospora crassa. Fungal Genet. Biol. 41, 897–910. Honda, S., Selker, E.U., 2009. Tools for fungal proteomics: multifunctional Neurospora vectors for gene replacement, protein expression and protein purification. Genetics 182, 11–23. Lee, D.W., Pratt, R.J., McLaughlin, M., Aramayo, R., 2003. An argonaute-like protein is required for meiotic silencing. Genetics 164, 821–828. Lee, D.W., Millimaki, R., Aramayo, R., 2010. QIP, a component of the vegetative RNA silencing pathway, is essential for meiosis and suppresses meiotic silencing in Neurospora crassa. Genetics 186, 127–133. Loros, J.J., Denome, S.A., Dunlap, J.C., 1989. Molecular cloning of genes under control of the circadian clock in Neurospora. Science 243, 385–388. Maiti, M., Lee, H., Liu, Y., 2007. QIP, a putative exonuclease, interacts with the Neurospora Argonaute protein and facilitates conversion of duplex siRNA into single strands. Genes Dev. 21, 590–600. Margolin, B.S., Freitag, M., Selker, E.U., 1997. Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Fungal Genet. Newslett. 44, 34–36. McCluskey, K., Wiest, A., Plamann, M., 2010. The fungal genetics stock center: a repository for 50 years of fungal genetics research. J. Biosci. 35, 119–126. Mullaney, E.J., Hamer, J.E., Roberti, K.A., Yelton, M.M., Timberlake, W.E., 1985. Primary structure of the trpC gene from Aspergillus nidulans. Mol. Gen. Genet. 199, 37–45. Ninomiya, Y., Suzuki, K., Ishii, C., Inoue, H., 2004. Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. USA 101, 12248–12253. Oakley, B.R., Rinehart, J.E., Mitchell, B.L., Oakley, C.E., Carmona, C., Gray, G.L., May, G.S., 1987. Cloning, mapping and molecular analysis of the pyrG (orotidine-50 phosphate decarboxylase) gene of Aspergillus nidulans. Gene 61, 385–399. Shiu, P.K.T., Metzenberg, R.L., 2002. Meiotic silencing by unpaired DNA: properties, regulation, and suppression. Genetics 161, 1483–1495. Shiu, P.K.T., Raju, N.B., Zickler, D., Metzenberg, R.L., 2001. Meiotic silencing by unpaired DNA. Cell 107, 905–916. Shiu, P.K.T., Zickler, D., Raju, N.B., Ruprich-Robert, G., Metzenberg, R.L., 2006. SAD-2 is required for meiotic silencing by unpaired DNA and perinuclear localization of SAD-1 RNA-directed RNA polymerase. Proc. Natl. Acad. Sci. USA 103, 2243– 2248. Vogel, H.J., 1956. A convenient growth medium for Neurospora (Medium N). Microbial Genet. Bull. 13, 42–43. Xiao, H., Alexander, W.G., Hammond, T.M., Boone, E.C., Perdue, T.D., Pukkila, P.J., Shiu, P.K.T., 2010. QIP, a protein that converts duplex siRNA into single strands, is required for meiotic silencing by unpaired DNA. Genetics 186, 119–126. Yang, L., Ukil, L., Osmani, A., Nahm, F., Davies, J., De Souza, C.P.C., Dou, X., PerezBalaguer, A., Osmani, S.A., 2004. Rapid production of gene replacement constructs and generation of a green fluorescent protein-tagged centromeric marker in Aspergillus nidulans. Eukaryotic Cell 3, 1359–1362. Yu, J., Hamari, Z., Han, K., Seo, J., Reyes-Domínguez, Y., Scazzocchio, C., 2004. Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet. Biol. 41, 973–981.