Fluorescent hybridisation combined with flow cytometry and hybridisation of total RNA to analyse the composition of microbial communities in human faeces using 16S rRNA probes

FEMS Microbiology Ecology 43 (2003) 237^245

www.fems-microbiology.org

Fluorescent hybridisation combined with £ow cytometry and hybridisation of total RNA to analyse the composition of microbial communities in human faeces using 16S rRNA probes Lionel Rigottier-Gois  , Anne-Gae«lle Le Bourhis, Genevie've Gramet, Violaine Rochet, Joe«l Dore¤ Institut National de la Recherche Agronomique, Unite¤ d’Ecologie et de Physiologie du Syste'me Digestif, ba“t. 405, Domaine de Vilvert, 78352 Jouy en Josas Cedex, France Received 15 May 2002 ; received in revised form 3 September 2002; accepted 2 October 2002 First published online 7 November 2002

Abstract To determine the structure of human faecal microbiota, faecal samples from 23 healthy individuals were analysed with a similar set of probes targeting six phylogenetic groups using rRNA dot-blot hybridisation and whole cell fluorescent in situ hybridisation (FISH) combined with flow cytometry. When microbiota compositions derived by each method were compared, the results were not statistically different for Clostridium coccoides, Fusobacterium prausnitzii, Bifidobacterium spp. and Enterobacteria. Conversely, the proportions were significantly different for Bacteroides and Atopobium (P 6 0.05). The metabolic state of these bacteria within the colon could explain the discrepancy observed between the rRNA level and the actual cell proportion. However, both approaches supplied consistent and complementary information on the structure of the faecal microbiota. FISH combined with flow cytometry appears best suited to future high throughput analysis. ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Human fecal microbiota; Dot-blot hybridisation; Fluorescent in situ hybridisation; Flow cytometry

1. Introduction The human colon is colonised by a wide range of bacterial communities amounting to 1014 bacteria and playing an important role in the health status of the host due to their involvement in nutrition, immunology and pathology [1,2]. To acquire more knowledge concerning the role of these bacterial communities in human health, epidemiological investigations are required. The attention paid to dietary modulation of the colonic microbiota using functional foods such as probiotics has further increased the need to better understand the structure and activities of the colonic microbiota. To be able to conduct epidemiological studies, high throughput methods are required to collect qual-

* Corresponding author. Tel. : +33 (1) 34 65 23 08; Fax : +33 (1) 34 65 24 92. E-mail address : [email protected] (L. Rigottier-Gois).

itative and quantitative information from large numbers of samples. These methods should also take into account the dynamics of the colonic microbiota. Traditionally, the faecal microbiota has been studied using bacteriological culture methods based on anaerobic selective media [3,4]. Culture-based studies have shown that faecal bacteria comprise 400 distinct species, but 70% of these bacteria belonged to the following six genera: Bacteroides, Eubacterium, Clostridium, Ruminococcus, Fusobacterium and Bi¢dobacterium. However, most bacteria from the faecal microbiota are strict anaerobes and thus di⁄cult to culture. Analyses based on microscopic examination have shown that 60 to 70% of the faecal bacteria cannot be cultured [5,6]. Culture-based studies have thus only made it possible to partially identify the composition of the faecal microbiota. The current development of molecular methods in microbial ecology is now enabling the culture-independent analysis of the faecal microbiota. Molecular analyses have mainly been targeted at ribosomal RNA and, more speci¢cally, at 16S rRNA [7]. Applied to faecal microbiota, molecular approaches based on the direct study of 16S

0168-6496 / 02 / $22.00 ; 2002 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII : S 0 1 6 8 - 6 4 9 6 ( 0 2 ) 0 0 4 1 6 - 6

FEMSEC 1456 10-2-03

238

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

rRNA genes [5] or using 16S rRNA probe hybridisation [8,9] have revealed the predominance of four phylogenetic groups gathering the six dominant cultivable genera. The Bacteroides group comprises the genus Bacteroides and also encloses the genera Prevotella and Porphyromonas. The Clostridium coccoides group includes species of Clostridium, Eubacterium, Ruminococcus and Butyrivibrio and corresponds to the Clostridium rRNA sub-cluster XIVa de¢ned by Collins et al. [10]. The Clostridium leptum group contains members of Clostridium, Eubacterium, Ruminococcus and Anaero¢lum genera as well as the Fusobacterium prausnitzii species and corresponds to the Clostridium rRNA cluster IV of Collins et al. [10]. The Bi¢dobacterium genus represents the fourth predominant group of the faecal microbiota. In addition to these four phylogenetic groups, sub-dominant groups, like the Enterobacteria, including Escherichia coli [9], and the Atopobium cluster, including the Coriobacterium group [11], were frequently detected in human faeces. Although molecular methods were consistent in terms of dominant groups [12], a more thorough analysis of the data acquired independently revealed di¡erences in the proportions of each phylogenetic group, depending on the approach used. For instance, the Bacteroides group is by far the main group in terms of rRNA index when using dot-blot hybridisation [9,13], while the C. coccoides group is the main one in terms of the number of cells when using £uorescent in situ hybridisation (FISH) [8]. These inconsistencies between studies could be explained by di¡erent probe speci¢cities or sampling strategies. To conclusively determine which is the main group in human faecal microbiota, we used the same faecal samples and two direct approaches based on 16S rRNA probe hybridisation with a similar set of probes targeting the main components of the faecal microbiota. Dot-blot hybridisation represented in our group the reference method to characterize the composition of faecal microbiota in healthy individuals. It was compared to FISH analysis adapted to £ow cytometry detection, and applied in this study to analyse the composition of the faecal microbiota in humans.

2. Materials and methods 2.1. faecal samples Faeces from 23 healthy human subjects (12 men and 11 women) between 3 and 68 years of age were collected. Donors were on a West European diet. None had any history of digestive pathology or received antibiotic treatment within six months prior to the study. Faecal samples were collected as described in Rochet et al. [14] in sterile plastic boxes and kept under anaerobic conditions using an anaerocult0 A (Merck, Nogent sur Marne, France) and stored at 4‡C for a maximum of 4 h before processing.

2.2. Probes The probes used in this study targeted the small subunit rRNA. The sequences, reference strains and references of the control and group-speci¢c probes are presented in Table 1. 2.3. Total RNA extraction and dot-blot hybridisation Total RNA was extracted from 0.2 g of frozen faecal material as described by Stahl et al. [15] as modi¢ed by Dore¤ et al. [13]. rRNA standards were prepared by extracting RNA from the reference strains in Table 1. Determination of total RNA extracted from faeces was performed using the universal probe Univ 1390 against the rRNA standard of E. coli MRS600 (Roche Molecular Diagnostics). An equivalent of 200 ng of total RNA from each faecal sample were blotted in triplicate or duplicate on Nylon membranes (one membrane per probe). The hybridisation was performed overnight at 42‡C in 10 ml of hybridisation bu¡er (900 mM NaCl, 19.5 mM NaH2 PO4 , 30.5 mM Na2 HPO4 , 5 mM EDTA, 0.5% sodium dodecyl sulfate (SDS), 10UDenhart’s solution, 0.5 mg ml31 PolyA, pH 7.2) containing 40 nmol of radioactively labelled probe. Two washing steps were performed for 30 min each in 200 ml 1USSC, 1% SDS at the appropriate washing temperatures of the group-speci¢c probe (Table 1). The degree of hybridisation on dot-blots was quantitated by radio-imaging using the Instant Imager (Packard Instrument). Results are expressed as rRNA indexes representing the group-speci¢c rRNA as a percentage of the total bacterial rRNA assessed with the EUB 338 probe targeting a region conserved within the domain bacteria [16]. 2.4. Cell ¢xation, permeabilisation and in situ hybridisation Faeces were homogenised by mechanical kneading for 3 min and 0.5 g aliquots (wet weight) added to 4.5 ml of sterile brain heart infusion (BHI) broth. The suspension was mixed 3^5 min in a 50-ml stoppered sterile glass jar ¢tted with a magnetic stirrer. One volume of the suspension was added to 3 volumes of 4% paraformaldehyde (PFA) in phosphate-bu¡ered saline (PBS; 130 mM NaCl, 3 mM NaH2 PO4 2H2 O, 7 mM Na2 HPO4 12H2 O, pH 7.2). After overnight ¢xation at 4‡C, the ¢xed suspension in PFA was stored at 370‡C until hybridisation. The EUB 338 probe was used as the positive control probe. The NON 338 probe designed by Wallner et al. [17] was used as the negative control probe. Both control probes were covalently linked at their 5P end either to £uorescein isothiocyanate (FITC) or to the sulfoindocyanine dye indodicarbocyanine (Cy5 ; Interactiva). The group-speci¢c probes were only labelled at their 5P end with Cy5. 100 Wl of ¢xed suspension was mixed into 1.0 ml of PBS. Before hybridisation, cells were always pelleted at

FEMSEC 1456 10-2-03

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

239

Table 1 16S rRNA-targeted oligonucleotide probes, experimental wash temperatures and strains used as reference in rRNA dot-blot hybridisation Probe

Sequence from 5P to 3P end

OPD codea

Reference RNA extracted from

Wash temperature Reference (‡C)

EUB 338 Bacto 1080 Bac 303 Erec 482 Fprau 645 Bif 228 Bif 164 Enter 1432 Ato 291 NON 338

GCTGCCTCCCGTAGGAGT GCACTTAAGCCGACACCT CCAATGTGGGGGACCTT GCTTCTTAGTCARGTACCG CCTCTGCACTACTCAAGAAAAAC GATAGGACGCGACCCCAT CATCCGGCATTACCACCC CTTTTGCAACCCACT GGTCGGTCTCTCAACCC ACATCCTACGGGAGGC

S-D-Bact-0338-a-A-18 S-*-Bacto-1080-a-A-18 S-*-Bacto-0303-a-A-17 S-*-Erec-0482-a-A-19 S-*-Fprau-0645-a-A-23 S-G-Bif-0228-a-A-18 S-G-Bif-0164-a-A-18 S-*-Ent-1432-a-A-15 S-*-Ato-0291-a-A-17 NAb

Escherichia coli MRS600 (Roche) Bacteroides vulgatus ATCC8482 NAb Ruminococcus productus ATCC 27340 F. prausnitzii L2-6c Bi¢dobacterium longum ATCC 15707 NAb Escherichia coli MRS600 (Roche) Collinsella aerofaciens ATCC 25986 NAb

54 50 NAb 47 50 53.5 NAb 43 56.5 NAb

[16] [13] [27] [8] [28] [30] [29] [9] [11] [17]

a

OPD code: oligonucleotide probe database code NA : not applicable c Strain F. prausnitzii L2-6 kindly provided by H. Flint, Rowett Research Institute, UK. b

8000Ug for 3 min in a microcentrifuge tube and resuspended in a volume of 1 ml. After one wash in Tris^ EDTA bu¡er (100 mM Tris^HCl, pH 8.0, 50 mM EDTA), pellets were resuspended in Tris^EDTA bu¡er containing 1 mg ml31 lysozyme (Serva, Heidelberg, Germany) and incubated for 10 min at room temperature. Cells were then washed in PBS to remove lysozyme and equilibrated in the hybridisation solution (900 mM NaCl, 20 mM Tris^HCl, pH 8.0, 0.1% SDS, 30% formamide). A 50-Wl aliquot of this suspension was used for FISH with control and group-speci¢c probes. Hybridisation was performed in a 96-well microtiter plate overnight at 35‡C in the hybridisation solution containing 4 ng Wl31 of the appropriate labelled probe(s). Following hybridisation, 150 Wl of hybridisation solution was added in each well and the cells were pelleted at 4000Ug for 15 min. Non-speci¢c binding of the probe was removed by incubating the bacterial cell suspension at 37‡C for 20 min in a washing solution (64 mM NaCl, 20 mM Tris^HCl, pH 8.0, 0.1% SDS). Cells were ¢nally pelleted and resuspended in PBS. Aliquots of 100 Wl were added to 1 ml of Facs Flow (Becton Dickinson) for data acquisition by £ow cytometry. 2.5. Flow cytometry Data acquisition was performed using a Facs Calibur £ow cytometer (Becton Dickinson) equipped with an aircooled argon ion laser providing 15 mW at 488 nm combined with a 635-nm red-diode laser. All the parameters were collected as logarithmic signals. The 488-nm laser was used to measure the forward angle scatter (FSC, in the 488-nm band-pass ¢lter), the side angle scatter (SSC, in the 488-nm band-pass ¢lter), and the green £uorescence intensity (FL1, in the 530-nm band-pass ¢lter) conferred by the FITC-labelled probes. The red diode laser was used to detect the red £uorescence conferred by the Cy5-labelled probes (FL4, in a 660-nm band-pass ¢lter). The acquisition threshold was set in the side scatter channel. The rate of events in the £ow was generally lower than 3000 events s31 . With faecal suspensions, a total of

100 000 events were stored in list mode ¢les. Subsequent analyses were conducted using CellQuest software (Becton Dickinson). Cell enumeration was performed by combining, in one hybridisation tube, one group Cy5-probe with the EUB 338-FITC probe. An FL1 histogram (green £uorescence) was used to evaluate the total number of bacteria hybridising with the EUB 338-FITC probe. A gate was designed in this histogram representing the total number of bacterial cells in the sample and was used to build an FL4 histogram (red £uorescence) to directly estimate the proportion of cells targeted by the group Cy5-probe in the sample. The proportion of cells was corrected by eliminating background £uorescence, which was measured using the negative control NON 338-Cy5 probe. Results were expressed as cells hybridising with the group-Cy5 probe as a proportion of the total bacteria hybridising with the EUB 338-FITC bacteria domain probe. 2.6. Statistical analysis The mean rRNA indexes determined by dot-blot hybridisation and the mean cell proportions estimated by FISH were calculated using the results of duplicates with FISH and of triplicates or duplicates with rRNA dot-blot hybridisation. Only means with a standard error of less than 6% with RNA and 2% with FISH were accepted. The Mann^Whitney (Wilcoxon) W-test to compare the medians was performed using StatGraphics0 (Manugistics, Rockville, MD, USA) to determine whether there was a signi¢cant di¡erence between the proportions of the bacterial groups determined by the two methods, at a con¢dence level of 95% (P 6 0.05).

3. Results 3.1. Composition of faecal microbiota assessed by rRNA hybridisation RNAs were successfully extracted from the 23 samples

FEMSEC 1456 10-2-03

240

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

tested. Yields ranged from 1.5 to 258 Wg g wet weight31 . The rRNA indexes obtained from the groups targeted with the set of probes are detailed in Table 2. A large variation was observed between individual faecal samples. Bacteroides represented the main rRNA index with a relative proportion of 41.7% X 13.5% and a range from 12.1% to 64.2%. The probe for C. coccoides detected 21.9% X 10.2% of the total rRNA and was the second highest rRNA index (ranging from 11.8% to 54.6%). The third highest was observed with the probe for F. prausnitzii, which represented on average 9.2% X 7.4% of total rRNA hybridised (range from 2.0% to 33.9%). When probes Bif 228, Enter 1432 and Ato 291 were used, the rRNA indexes were 2.9% X 4.2%, 1.0% X 2.7% and 0.3% X 0.5%, respectively. When the rRNA indexes of the six groups were added together, a total of 76.9% X 19.8% was found (from 46.4% to 125.8%). Surprisingly, the total of the rRNA indexes for four individuals was higher than 100% (samples 3, 5, 17 and 25).

composition of the faecal microbiota of the 23 samples was successfully analysed by FISH adapted for detection by £ow cytometry. The proportions of cells hybridised with the group-speci¢c probes among the bacteria detected with the EUB 338 probe are presented in Table 3. The most abundant group was detected with the C. coccoides group probe and represented 22.0% X 7.6% of cells with a range from 10.4% to 38.5%. The F. prausnitzii group was the second most represented with 11.3% X 5.9% of cells detected (ranging from 1.3%^25.5%). The Bacteroides group came third and accounted for 9.1% X 6.7% of bacterial cells (ranging from 0.4%^26.1%). The probes for Bi¢dobacterium, Enterobacteria and Atopobium groups gathered 4.1% X 3.9%, 1.0% X 2.8% and 3.7% X 2.8% of bacterial cells, respectively. When the proportions of bacterial cells were added together, a mean of 51.0% X 14.4% was obtained with the six group-speci¢c probes (ranging from 26.9% to 75.5%).

3.2. Composition of faecal microbiota assessed by FISH combined with £ow cytometry

3.3. Correspondence between compositions of faecal microbiota assessed with the two 16S rRNA probing methods

Typical £ow cytometry histograms and dot-plots are presented in Fig. 1. All group-speci¢c probes gave a shift in signal of 1 log unit or more, allowing the speci¢c detection and enumeration of the corresponding cells. The

The distribution of the proportions of each group is represented in Fig. 2. Statistical analyses were performed to determine whether there were statistically signi¢cant di¡erences between the relative proportions of the groups

Table 2 Proportions of Bacteroides, C. coccoides, F. prausnitzii, Bi¢dobacterium, Enterobacteria and Atopobium groups in healthy humans measured by rRNA dot-blot hybridisation using EUB 338 as reference compared to Bacto 1080, Erec 482, Fprau 645, Bif 228, Enter 1432 and Ato 291 Individual Bacterial group

1 2 3 4 5 6 7 8 9 11 12 13 14 15 16 17 18 19 20 21 22 23 25 Mean

Bacto 1080 Mean ( X S.D.)

Erec 482 Mean ( X S.D.)

Fprau 645 Mean ( X S.D.)

Bif 228 Mean ( X S.D.)

Enter 1432 Mean ( X S.D.)

Ato 291 Mean ( X S.D.)

Total Mean ( X S.D.)

52.8 37.4 61.0 47.3 36.5 33.9 29.9 51.6 43.2 42.2 45.9 35.8 31.8 64.2 28.4 30.4 55.4 12.1 48.8 20.7 63.9 25.2 39.9 41.7

17.1 17.0 27.9 16.6 47.1 36.5 23.7 16.9 11.8 28.6 12.3 18.1 20.2 16.0 19.8 54.6 15.1 31.3 12.4 18.1 19.6 15.2 27.0 21.9

6.4 10.4 12.4 8.0 27.1 14.7 7.5 7.0 10.6 2.0 6.8 5.6 6.5 5.5 5.9 11.4 6.2 6.3 6.1 6.3 5.5 5.3 33.9 9.2 X 7.4

0.5 1.9 8.5 1.4 12.3 12.8 0.5 0.4 0.5 0.4 0.7 1.0 11.1 0.6 2.6 10.3 1.2 9.9 0.3 1.0 0.4 1.6 1.5 2.9 X 4.2

0.0 1.1 2.2 0.3 2.0 1.6 0.2 0.1 0.1 0.1 0.1 1.5 13.9 0.1 0.4 2.2 0.4 1.2 0.1 0.1 0.1 0.2 0.1 1 X 2.7

0.0 0.1 0.0 0.1 0.8 0.1 0.1 0.2 0.0 0.1 0.1 1.0 0.1 0.0 1.0 2.1 0.0 0.9 0.1 0.1 0.0 0.4 0.0 0.3

76.8 67.9 111.9 73.5 125.8 99.6 62.0 76.3 66.3 73.2 65.9 63.2 83.6 86.4 58.0 111.0 78.4 61.6 67.7 46.4 89.6 48.0 102.4 76.9 X 19.8

X 13.5

X 10.2

FEMSEC 1456 10-2-03

X 0.5

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

241

Fig. 1. Flow cytometry dot-plots and histograms obtained by FISH analysis of sample 1. Fixed cells were hybridised in (A) with either NON 338-FITC in FL1 or NON 338-Cy5 in FL4, (B) with a combination of EUB 338-FITC and Erec 482-Cy5, (C) with a combination of EUB 338-FITC and Fprau 645-Cy5 and in (D) with a combination of EUB 338-FITC and Bac 303-Cy5. FL1 histograms show green £uorescence intensities conferred by EUB 338-FITC. The events under the region R1 corresponded to bacterial cells hybridised with the probe EUB 338-FITC. This region was designed according to the level of background when NON 338-FITC was used. FL4 histograms were gated on the region R1 corresponding to M1 of the FL1 histogram. FL4 histograms show red £uorescence intensities conferred by the Cy5 probes. The events under M2 represented the proportion of bacterial cells hybridised with the group-speci¢c probe within the total bacterial cells hybridised with the bacteria domain probe EUB 338-FITC. The proportion of cells was corrected by eliminating background £uorescence, which was measured using the negative control NON 338-Cy5 probe.

according to the molecular approach used. Statistically signi¢cant di¡erences (P 6 0.05) were found between the proportions of Bacteroides and Atopobium groups. When the proportions of each phylogenetic group were added together and compared, a statistically signi¢cant di¡erence

was observed between the totals obtained by each method. Conversely, no statistically signi¢cant di¡erences were found between the proportions derived by the two methods for the C. coccoides, F. prausnitzii, Bi¢dobacterium and Enterobacteria groups.

FEMSEC 1456 10-2-03

242

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

Table 3 Proportions of Bacteroides, C. coccoides, F. prausnitzii, Bi¢dobacterium, Enterobacteria and Atopobium groups in healthy humans assessed by FISH combined with £ow cytometry detection using Bac 303, Erec 482, Fprau 645, Bif 164, Enter 1432 and Ato 291 Individual Bacterial group

1 2 3 4 5 6 7 8 9 11 12 13 14 15 16 17 18 19 20 21 22 23 25 Mean

Bac 303 Mean ( X S.D.)

Erec 482 Mean ( X S.D.)

Fprau 645 Mean ( X S.D.)

Bif 164 Mean ( X S.D.)

Enter 1432 Mean ( X S.D.)

Ato 291 Mean (S.D.)

Total Mean (S.D.)

12.0 12.1 5.9 4.9 3.7 6.4 19.1 26.1 10.3 8.3 21.5 3.8 7.7 17.1 6.5 1.4 13.0 0.4 10.8 3.1 7.7 1.1 6.3 9.1

38.5 23.4 32.7 29.0 22.3 24.7 25.9 22.8 30.5 25.1 20.2 12.7 14.2 14.5 18.8 10.4 16.7 13.4 29.2 14.5 31.1 11.5 26.4 22.0

14.7 13.2 7.3 12.5 10.5 15.4 5.6 10.7 17.3 10.0 12.9 5.3 9.8 25.5 15.6 3.9 9.9 1.3 12.3 5.6 14.1 1.6 18.3 11.3

5.0 9.3 2.0 2.3 5.0 2.9 0.5 5.4 0.0 1.0 1.9 5.1 4.8 8.0 0.2 12.0 5.3 3.7 2.3 0.0 2.2 0.0 14.7 4.1

2.0 2.1 0.0 0.0 0.0 0.2 0.0 1.5 0.2 0.0 0.0 2.7 13.6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 1.0 0.0 0.0 1

3.3 4.3 3.6 1.7 2.2 4.1 5.3 8.0 2.6 3.1 1.4 3.6 4.3 0.0 5.7 6.0 1.3 8.5 2.1 3.7 1.0 10.6 0.1 3.7

75.5 64.4 51.5 50.3 43.7 53.7 56.4 74.5 60.9 47.5 57.9 33.2 54.4 65.0 46.8 33.6 46.2 27.4 56.7 26.9 57.2 24.8 65.8 51.0

X 6.7

X 7.6

X 5.9

4. Discussion Two 16S rRNA probing methods were used in this study to characterise the composition of faecal microbiota in 23 healthy humans. The rRNA dot-blot hybridisation determined the relative proportion of the rRNA of a phylogenetic group among the total bacterial rRNA. FISH

Fig. 2. Distribution of the proportion of bacterial groups in human faeces assessed by relative rRNA dot-blot hybridisation and by relative cell enumeration by FISH combined with £ow cytometry.

X 3.9

X 2.8

X 2.8

X 14.4

combined with £ow cytometry estimated the relative proportion of the bacterial cells of a group within the total number of bacterial cells. When comparing faecal microbiota composition, results were not statistically di¡erent for the following four groups: C. coccoides, F. prausnitzii, Bi¢dobacterium spp. and Enterobacteria. The results were, however, signi¢cantly di¡erent for the Bacteroides and Atopobium groups. When the results of the two methods were compared independently, the composition of the faecal microbiota of our samples were consistent with several studies based on the same molecular methods. The rRNA indexes of the six predominant groups of the faecal microbiota were consistent with the rRNA indexes estimated by Dore¤ et al. [13] and Sghir et al. [9]. In particular, with an rRNA index of more than 37%, the Bacteroides group was the major group in the faecal microbiota of healthy humans. This result was consistent with the observation that Bacteroides was the most common cultivable group and represented 30% of the total cultivable bacteria [4]. The composition of the faecal microbiota obtained by FISH adapted to £ow cytometry detection correlated well with the composition observed when FISH was combined with microscopic detection and automated image analysis [8,18,19]. Using FISH, the C. coccoides group was the main group representing more than 22% of the total bacteria in the faecal microbiota. The 9% of bacterial cells hybridising with the probe Bac 303 was consistent with the proportion of Bac-

FEMSEC 1456 10-2-03

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

teroides cells estimated when the same group probe was used previously (e.g. 4.6% in Tannock et al. [19]). However, this proportion was lower than in Franks et al. [8], when detected with the probes Bfra 602 and Bdis 656, where it amounted to 20%. In the present study, analysing one set of faecal samples using two molecular methods with a similar set of probes showed similar proportions of C. coccoides, F. prausnitzii, Bi¢dobacterium spp. and Enterobacteria groups. The C. coccoides and F. prausnitzii groups are predominant phylogenetic groups in the faecal microbiota, and both methods supplied the same information, as previously reported [8,9]. Concerning the Bi¢dobacterium group, although no statistically signi¢cant di¡erence was observed between the two methods, a bimodal distribution of the frequency of proportions was evident in the total RNA hybridisation, but not with FISH. Among the individuals analysed, RNA from Bi¢dobacterium was either expressed poorly, with 18 out of 23 individuals exhibiting rRNA indexes below 2.6%, or substantially, with ¢ve individuals exhibiting rRNA indexes higher than 9%. This suggests that the Bi¢dobacterium species have di¡erent levels of adaptation to the distal colon. This could be linked to the metabolic heterogeneity of the species within the genus Bi¢dobacterium [20]. Alternatively, external parameters such as the diet of each individual can positively in£uence the Bi¢dobacterium spp., as has been shown with dietary ¢bres [21,22]. Regarding Enterobacteria, a good correlation between the two methods was observed. The best example concerns faecal sample 14, which presented an unusually high level of Enterobacteria with 13.9% X 4.8% detected by rRNA dot-blot hybridisation and 13.6% X 0.5% by FISH. The rRNA and cell proportions of the Bacteroides group are consistent with molecular studies using either one or other of the two probing strategies [12]. Discrepancy between the proportions of the Bacteroides group had already been observed when the results of the two probing techniques were compared but it could be explained by the samplings which were di¡erent. In the present study we observed that, for the same set of faecal samples, this di¡erence still exists. The speci¢city of the Bacteroides group probes used could be one reason for the di¡erence. Two probes were used for the following reasons : (i) the probe Bac 303 targeting the genera Bacteroides and Prevotella was di⁄cult to label radioactively and thus not reliable for evaluating the rRNA index (G. Gramet, personal communication) ; (ii) the probe Bacto 1080, which in addition to Bac 303 detects the Porphyromonas genus, targeted a region not accessible in FISH technology (L. Rigottier-Gois, unpublished observation). The importance of the accessibility of the probe to its target has been shown by Fuchs et al., for the 16S and 23S rRNA of E. coli [23,24]. However, the Porphyromonas genus could hardly explain the 31% di¡erence in the proportion of Bacteroides estimated by the two methods. Culture or even molecular-based studies [5] showed that Porphyro-

243

monas members represented less than 2% of the total bacteria in human faeces. Our main hypothesis is that the di¡erence relates to the actual parameters measured by the two methods. rRNA dot-blot hybridisation gave an rRNA index that re£ects the number of ribosomal operons, the ribosomal content of cells, and the general metabolic activity, while the FISH analysis measured a proportion of cells. The amount of rRNA per cell is di¡erent according to the type of species and the metabolic state of the bacterial cell [25]. We observed that the rRNA indexes and cell proportions were consistent for most of the phylogenetic groups in human faeces, with the exception of Bacteroides, where the rRNA content was signi¢cantly higher than the relative cell proportion. This could indicate that the Bacteroides are metabolically more active than the other groups in the human colon. This observation could be related to the great nutritional ability and versatility of the bacteria in the Bacteroides group [26]. Complex exogenous and endogenous substrates are their main source of energy in the distal colon. Their high metabolic activity may result from the ability of Bacteroides to degrade endogenous muco-polysaccharides and glycopolysaccharides which are produced in the whole colon. Conversely, the high relative proportion of Atopobium cells compared to their small rRNA index could be due to a less appropriate nutritional environment for the bacteria of this group. In spite of the variations observed for these two groups, it is important to note that the di¡erences observed represent less than 0.5 log unit of population equivalent, which is the level of precision usually offered by culture-based methods. On average, more than 50% of the bacterial cells and 70% of the total RNA were detected with our set of group-speci¢c probes. This means that new probes have to be developed and validated to detect other bacteria present in the faecal microbiota and not yet enumerated with the current set of probes. E¡orts now have to be made to further analyse the 16S rDNA from clone libraries of total DNA or from cultivated members of the faecal microbiota to enlarge the set of phylogenetic groups to detect and better describe the bacterial composition of human faeces. This study o¡ers a solid basis of information concerning the reliability of FISH combined with £ow cytometry as used to characterise the composition of faecal microbiota as it gave consistent and complementary data with respect to the reference method of rRNA dot-blot hybridisation. In the near future, if large scale analyses are to be conducted, we will use FISH combined with £ow cytometry because it is undoubtedly a high throughput method. For instance, it could be applied to samples from healthy humans from all over the world to provide a geographic description of the composition of the faecal microbiota. With this method it will be possible to analyse on a larger scale the colonisation of the gut in infants or the impact of ageing on intestinal microbiota. It will also be possible to

FEMSEC 1456 10-2-03

244

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245

perform nutritional studies to assess the potential bene¢ts of functional foods on faecal microbiota. This high throughput method might also contribute to the identi¢cation of changes in the composition of the intestinal microbiota in patients su¡ering from in£ammatory bowel diseases.

Acknowledgements We thank P. Pochart and V. Chmiliewski for their helpful advice and comments during the set-up of the £ow cytometry detection of microorganisms. We gratefully acknowledge the human volunteers who took part to the study. This study was carried out with ¢nancial support from the Commission of the European Communities, speci¢cally the RTD programme ‘Quality of Life and Management of Living Resources’, QLK1-2000-108, ‘Microbe Diagnostics’, coordinated by Professor Michae«l Blaut (Dife, Germany).

References [1] Falk, P.G., Hooper, L.V., Midtvedt, T. and Gordon, J.I. (1998) Creating and maintaining the gastrointestinal ecosystem: what we know and need to know from gnotobiology. Microbiol. Mol. Biol. Rev. 62, 1157^1170. [2] Salminen, S., Bouley, C., Boutron-Ruault, M.C., Cummings, J.H., Franck, A., Gibson, G.R., Isolauri, E., Moreau, M.C., Roberfroid, M. and Rowland, I. (1998) Functional food science and gastrointestinal physiology and function. Br. J. Nutr. 80, S147^S171. [3] Finegold, S.M., Sutter, V.L. and Mathisen, G.E. (1983). In: Human Intestinal Micro£ora in Health and Disease (Hentges, D.J., Ed.), pp. 3^31. Academic Press, New York. [4] Moore, W.E. and Holdeman, L.V. (1974) Human fecal £ora: the normal £ora of 20 Japanese^Hawaiians. Appl. Microbiol. 27, 961^ 979. [5] Suau, A., Bonnet, R., Sutren, M., Godon, J.J., Gibson, G.R., Collins, M.D. and Dore¤, J. (1999) Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65, 4799^4807. [6] Wilson, K.H. and Blitchington, R.B. (1996) Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 62, 2273^2278. [7] Amann, R.I., Ludwig, W. and Schleifer, K.H. (1995) Phylogenetic identi¢cation and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59, 143^169. [8] Franks, A.H., Harmsen, H.J., Raangs, G.C., Jansen, G.J., Schut, F. and Welling, G.W. (1998) Variations of bacterial populations in human feces measured by £uorescent in situ hybridization with groupspeci¢c 16S rRNA-targeted oligonucleotide probes. Appl. Environ. Microbiol. 64, 3336^3345. [9] Sghir, A., Gramet, G., Suau, A., Rochet, V., Pochart, P. and Dore¤, J. (2000) Quanti¢cation of bacterial groups within human fecal £ora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 66, 2263^2266. [10] Collins, M.D., Lawson, P.A., Willems, A., Cordoba, J.J., FernandezGarayzabal, J., Garcia, P., Cai, J., Hippe, H. and Farrow, J.A. (1994) The phylogeny of the genus Clostridium : proposal of ¢ve new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44, 812^ 826.

[11] Harmsen, H.J.M., Wildeboer-Veloo, A.C.M., Grijpstra, J., Knol, J., Degener, J.E. and Welling, G.W. (2000) Development of 16S rRNAbased probes for the Coriobacterium group and the Atopobium cluster and their application for enumeration of Coriobacteriaceae in human feces from volunteers of di¡erent age groups. Appl. Environ. Microbiol. 66, 4523^4527. [12] Dore¤, J. and Rigottier-Gois, L. (2001) Analyse mole¤culaire de la £ore colique. Gastroenterol. Clin. Biol. 25 (Spec. No. 2), C74^C78. [13] Dore¤, J., Sghir, A., Hannequart-Gramet, G., Corthier, G. and Pochart, P. (1998) Design and evaluation of a 16S rRNA-targeted oligonucleotide probe for speci¢c detection and quantitation of human fecal Bacteroides populations. Syst. Appl. Microbiol. 21, 65^71. [14] Rochet, V., Rigottier-Gois, L., Beguet, F. and Dore¤, J. (2001) Composition of human intestinal £ora analysed by £uorescent in situ hybridisation using group-speci¢c 16S rRNA-targeted oligonucleotide probes. Genet. Sel. Evol. 33, S339^S352. [15] Stahl, D.A., Flesher, B., Mans¢eld, H.R. and Montgomery, L. (1988) Use of phylogenetically-based hybridization probes for studies of ruminal microbial ecology. Appl. Environ. Microbiol. 54, 1079^1084. [16] Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R. and Stahl, D.A. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with £ow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56, 1919^1925. [17] Wallner, G., Amann, R. and Beisker, W. (1993) Optimizing £uorescent in situ hybridization with rRNA-targeted oligonucleotide probes for £ow cytometric identi¢cation of microorganisms. Cytometry 14, 136^143. [18] Harmsen, H.J., Gibson, G.R., El¡erich, P., Raangs, G.C., Wildeboer-Veloo, A.C., Argaiz, A., Roberfroid, M.B. and Welling, G.W. (2000) Comparison of viable cell counts and £uorescence in situ hybridization using speci¢c rRNA-based probes for the quanti¢cation of human fecal bacteria. FEMS Microbiol. Lett. 183, 125^129. [19] Tannock, G.W., Munro, K., Harmsen, H.J., Welling, G.W., Smart, J. and Gopal, P.K. (2000) Analysis of the fecal micro£ora of human subjects consuming a probiotic product containing Lactobacillus rhamnosus DR20. Appl. Environ. Microbiol. 66, 2578^2588. [20] Scardovi, V. (1984) In: Bergey’s Manual of Systematic Bacteriology, Vol. 1, pp. 1418^1434 (N.R. Krieg, a.J.G.H., Ed.), Williams and Wilkins, Baltimore, MD. [21] Bouhnik, Y., Flourie, B., D’Agay-Abensour, L., Pochart, P., Gramet, G., Durand, M. and Rambaud, J.C. (1997) Administration of transgalacto-oligosaccharides increases fecal bi¢dobacteria and modi¢es colonic fermentation metabolism in healthy humans. J. Nutr. 127, 444^448. [22] Bouhnik, Y., Flourie, B., Riottot, M., Bisetti, N., Gailing, M.F., Guibert, A., Bornet, F. and Rambaud, J.C. (1996) E¡ects of fructo-oligosaccharides ingestion on fecal bi¢dobacteria and selected metabolic indexes of colon carcinogenesis in healthy humans. Nutr. Cancer 26, 21^29. [23] Fuchs, B.M., Wallner, G., Beisker, W., Schwippl, I., Ludwig, W. and Amann, R. (1998) Flow cytometric analysis of the in situ accessibility of Escherichia coli 16S rRNA for £uorescently labeled oligonucleotide probes. Appl. Environ. Microbiol. 64, 4973^4982. [24] Fuchs, B.M., Syutsubo, K., Ludwig, W. and Amann, R. (2001) In situ accessibility of Escherichia coli 23S rRNA to £uorescently labelled oligonucleotide probes. Appl. Environ. Microbiol. 67, 961^ 968. [25] Klappenbach, J.A., Dunbar, J.M. and Schmidt, T.M. (2000) rRNA operon copy number re£ects ecological strategies of bacteria. Appl. Environ. Microbiol. 66, 1328^1333. [26] Salyers, A.A., Vercellotti, J.R., West, S.E.H. and Wilkins, T.D. (1977) Fermentation of mucin and plant polysaccharides by strains of Bacteroides from human colon. Appl. Environ. Microbiol. 33, 319^322. [27] Manz, W., Amann, R., Ludwig, W., Vancanneyt, M. and Schleifer, K.H. (1996) Application of a suite of 16S rRNA-speci¢c oligonucleotide probes designed to investigate bacteria of the phylum cytophaga-

FEMSEC 1456 10-2-03

L. Rigottier-Gois et al. / FEMS Microbiology Ecology 43 (2003) 237^245 £avobacter-bacteroides in the natural environment. Microbiology 142, 1097^1106. [28] Suau, A., Rochet, V., Sghir, A., Gramet, G., Brewaeys, S., Sutren, M., Rigottier-Gois, L. and Dore¤, J. (2001) Fusobacterium prausnitzii and related species represent a dominant group within the human fecal £ora. Syst. Appl. Microbiol. 24, 139^145. [29] Langendijk, P.S., Schut, F., Jansen, G.J., Raangs, G.C., Kamphuis, G.R., Wilkinson, M.H. and Welling, G.W. (1995) Quantitative £uo-

245

rescence in situ hybridization of Bi¢dobacterium spp. with genus-speci¢c 16S rRNA-targeted probes and its application in fecal samples. Appl. Environ. Microbiol. 61, 3069^3075. [30] Mangin, I., Bouhnik, Y., Suau, A., Rochet, V., Raskine, L., Crenn, P., Dyard, F., Rambaud, J.C. and Dore¤, J. (2002) Molecular analysis of intestinal microbiota composition to evaluate the e¡ect of PEG and lactulose laxatives in humans. Microbiol. Ecol. Health Dis. 14, 54^62.

FEMSEC 1456 10-2-03