- Email: [email protected]
Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro
NSC 16083
No. of Pages 9
28 February 2015 Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028 1
Neuroscience xxx (2015) xxx–xxx
3
FLUOXETINE AND S-CITALOPRAM INHIBIT M1 ACTIVATION AND PROMOTE M2 ACTIVATION OF MICROGLIA IN VITRO
4
F. SU, a H. YI, a L. XU b AND Z. ZHANG a*
5 6 7
a The Department of Neurology of Affiliated ZhongDa Hospital, The Institute of Neuropsychiatry and Medical School of Southeast University, Nanjing, China
8 9
b Laboratory of Learning and Memory, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
2
10
Key words: depression, microglia, fluoxetine, S-citalopram. 11
Abstract—Increasing evidence has suggested that microglia dysfunction plays an important role in the pathogenesis of depression. Both classical activation (M1 activation) and alternative activation (M2 activation) may be involved in the process. M1-activated microglia secrete various pro-inflammatory cytokines and neurotoxic mediators, which may contribute to the development of depression, while M2-activated microglia promote tissue reconstruction by releasing anti-inflammatory cytokines involved in the process of depression. Selective serotonin reuptake inhibitors (SSRIs) are first-line treatments for depression, and their effects on immune system modulation have recently gained attention. Several studies have suggested that SSRIs affect the M1 activation of microglia, but results have varied. In addition, little is known about the effect of SSRIs on M2 activation in depression. The aim of this study was to investigate the effects of fluoxetine and S-citalopram, two widely used SSRIs in clinical, on both the M1 and M2 activation of microglia (the murine BV2 cell line and mouse primary microglia cell). The indexes of activation were measured by real-time polymerase chain reaction (PCR), enzymelinked immunosorbent assay (ELISA) and Western blot. The present results showed that both fluoxetine and Scitalopram significantly down-regulated the indexes of M1 activation and up-regulated the M2 activation indexes on mRNA and protein levels either in cell line or primary cells. Taken together, the results suggested that fluoxetine and S-citalopram modulated the immune system by inhibiting M1 activation and by improving M2 activation of microglia and that the immune system modulation may partially mediate the therapeutic effects of antidepressant drugs-SSRIs. Ó 2015 Published by Elsevier Ltd. on behalf of IBRO.
*Corresponding author. Tel/fax: +86-25-83262241. E-mail address: [email protected] (Z. Zhang). These authors equally contributed to the work. Abbreviations: CD86, cluster of differentiation 86; DMEM, Dulbecco’ s modified Eagle medium; ELISA, enzyme-linked immunosorbent assay; FBS, fetal bovine serum; IFN-c, interferon-c; IL-6, interleukin-6; LPS, lipopolysaccharide; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide; NO, nitric oxide; SOCS3, suppressor of cytokine signaling 3; SSRIs, selective serotonin reuptake inhibitors; STAT, signal transducers and activators of transcription; TNF-a, tumor necrosis factor-a. http://dx.doi.org/10.1016/j.neuroscience.2015.02.028 0306-4522/Ó 2015 Published by Elsevier Ltd. on behalf of IBRO. 1
INTRODUCTION
12
The relationship of inflammation with depression has been supported by some well-known observations. For examples, major depressive disorder (MDD) is associated with raised inflammatory markers (Dahl and et al., 2014) and inflammatory medical illnesses (Lo and et al., 2010). In addition, patients treated with cytokines for various illnesses are at an increased risk of developing depression (Wichers and Maes, 2002). Even though the association between inflammation and depression is not consistently significant in all studies or for all cytokines, the positive results of meta-analysis gave convincing evidence for the relationship, and the heterogeneity of different studies may arise from the differences of age, gender, race, symptom severity and the phase of illness (Dowlati and et al., 2010). Based on these observations, the hypothesis has been posited, in which inflammatory processes might contribute to the development of depression, and numerous studies have attempted to explain how inflammatory processes cause changes in brain structure and function related to depression (Capuron and Miller, 2011; Raison and Miller, 2011). Increasing evidence suggested that inflammation can reduce neurogenesis (Barrientos and et al., 2003; Iosif and et al., 2006; Ben and et al., 2008), motivate the activity of hypothalamic–pituitary–adrenal (HPA) axis Miller et al., 1999; Hu et al., 2009 and inhibit the function of serotonin system (Yang and et al., 2004; Fujigaki and et al., 2006; Zhu et al., 2006), all of which are believed to play key roles in the development of depression. The above evidences have implicated inflammation involves in the etiology of depression and have formed the foundation of the neuro-inflammation theory of depression. The dysfunction of microglia in depression is now gaining much more attention, as the microglia cell is generally considered as the most important immune cell in the central nervous system. In healthy brains, the microglia are ‘resting’ and play the role of immune supervision (Nimmerjahn et al., 2005). However, in pathological conditions, microglia can be activated by various stimulations (Aloisi, 2001), and different stimulations induce the activation of microglia into a ‘classical (M1)’ or ‘alternative (M2)’ activated states (Colton and Wilcock, 2010). The M1-activated cells undergo rapid proliferation, express activation markers [such as cluster of
13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
NSC 16083
No. of Pages 9
28 February 2015
2 57 58
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
differentiation 86 (CD86)] and secrete various pro-inflammatory cytokines [such as tumor necrosis factor-a (TNFa), interleukin-6 (IL-6), interleukin 1-b (IL-1b)] and cytotoxic factors [such as nitric oxide (NO) and reactive oxygen–nitrogen species] (Aloisi, 2001). Microglia cells in this state generally act in tissue defense and promote the destruction of pathogens (Kettenmann and et al., 2011). However, the microglia cells can induce inflammo-toxicity of the healthy tissue at the same time (Colton and Wilcock, 2010). Hence the M2-activated microglia cells are key aspects in keeping the homeostasis in the CNS by secreting anti-inflammatory cytokines [for example, IL-10 and transforming growth factor-b (TGF-b)] to down-regulate the pro-inflammatory process and initiate tissue reconstruction (Kettenmann and et al., 2011). The balance between M1/M2 activation is extremely important in keeping healthy and resisting diseases. It has been suggested that excessive M1 activation and deficiency of M2 activation is of great significance in the etiology and pathogenesis of depression. In addition, anti-inflammatory medications may be beneficial in the treatment process (Eyre et al., 2014). Selective serotonin reuptake inhibitors (SSRIs) have been a first-line choice for the treatment of depression for several decades, and the SSRIs act, at least in part, by increasing monoamine transmission. However, in recent decades, the antidepressants have been proven to modulate the inflammation process (Roumestan and et al., 2007; Hannestad et al., 2011). Clinical studies showed that the elevated serum levels of pro-inflammatory cytokines in depressed patients are often turned to normalization after successful treatment with antidepressants (Hannestad et al., 2011). In vitro studies further support the finding by showing that SSRIs can inhibit the activation of peripheral immune cells from either human or rodent (Roumestan and et al., 2007). Although the SSRIs affect the immune cell in the peripheral nervous system, it is not reasonable to conclude that SSRIs modulate the inflammation process in the CNS and that the therapeutic effects may be related to inflammation. Recently, several studies have shed light on this issue by focusing on the effects of SSRIs on microglia activation. However, the results of such studies have been variable and even contradictory (Ha et al., 2006; Hashioka and et al., 2007; Lim and et al., 2009; Horikawa and et al., 2010; Liu and et al., 2011; Lee and et al., 2011; Tynan and et al., 2012; Du et al., 2014). Furthermore, all the studies only focused on the M1 activation of microglia affected by SSRIs, and no study to date has investigated the effect of SSRIs on the M2 activation of microglia. Accordingly, in the current study, we sought to investigate the effect of fluoxetine and S-citalopram, two widely used SSRIs, on both the M1 and M2 activation of microglia via the research of the murine BV2 cell line and primary microglia cell in vitro. The present study had investigated whether fluoxetine and S-citalopram reduce inflammation indexes of M1 activation and increase the indexes of M2 activation, and whether the effect was concentration-dependent. In summary, the study may provide new evidence concerning the pharmacological mechanism of SSRIs, especially their
promotion of M2 activation of microglia, which may contribute to understanding the pathogenesis and developing new treatment options for depression.
118
EXPERIMENTAL PROCEDURES
121
119 120
Reagents
122
Fluoxetine, lipopolysaccharide (LPS), recombinant interferon-c (IFN-c) and IL-4 were all purchased from Sigma–Aldrich (USA). S-citalopram was purchased from Lundbeck (Denmark). Fluoxetine and S-citalopram were initially dissolved in phosphate-buffered saline (PBS, 150 mM NaCl, 5 mM phosphate, pH 7.4). LPS, recombinant IFN-c and IL-4 were initially dissolved in sterile distilled–deionized water. In all cases, subsequent dilutions to working concentrations were made using cell culture media.
123
BV2 microglial cell culture
133
BV2 cells, which were purchased from Cell Bank of Chinese Academy of Sciences, Shanghai, China, were maintained in Dulbecco’ s modified Eagle medium (DMEM, Invitrogen, USA) with 10% fetal bovine serum (FBS, Invitrogen, USA) in a 5% CO2 incubator. Plated cells were grown in DMEM with 10% FBS overnight. In all experiments, cells were treated with LPS (200 ng/ml) and INF-c (20 ng/ml) or IL-4 (10 ng/ml) in the absence or presence of the indicated concentrations of fluoxetine or S-citalopram (20 or 60 lM) in serum-free DMEM.
134
Primary microglial cell culture
144
Primary microglia cells were prepared from the whole brains of 1–2-day-old SD rat. Briefly, the whole brain were chopped and dissociated by mechanical disruption using a nylon mesh. The cells were seeded in poly-Dlysine-coated flasks. After in vitro culture for 14 days, microglia cells were isolated from mixed glia cultures by mild trypsinization. The prepared primary microglia cultures were more than 95% pure, as determined by CD11b immunocytochemical staining (data not shown). Cells were cultured for 24 h before drug treatment. The experimental protocol was carried out in accordance with the European Communities Council Directive of 24 November 1986 and we spared no efforts to minimize the number of animals used and their suffering.
145
Cell viability assay
159
Cell viability was determined by the tetrazolium salt 3-[4, 5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma–Aldrich, USA) assay. Microglia cells were plated into 96-well culture plates at a density of 5 104 cells/ml with 200-ml culture medium per well. Following treatment with different concentrations (1, 10, 20, 40, 60, 80, and 100 lM) of fluoxetine or S-citalopram for 24 h, 5 mg/ml MTT solution was added to each well and incubated at 37 °C for 4 h. The medium was aspirated and 200-ml dimethyl sulfoxide was added. The absorbance value was measured using
160
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
124 125 126 127 128 129 130 131 132
135 136 137 138 139 140 141 142 143
146 147 148 149 150 151 152 153 154 155 156 157 158
161 162 163 164 165 166 167 168 169 170
NSC 16083
No. of Pages 9
28 February 2015
3
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
172
a multi-well spectrophotometer (Bio-Rad, USA) at 490 nm.
173
MATERIALS AND METHODS
174
The experiment was conducted on both the BV2 cells and primary microglia cells with the same procedure. 20 or 60 lM SSRIs (fluoxetine or S-citalopram) were added to the cells in the presence of 200 ng/ml LPS + 20 ng/ml INF-c or 10 ng/ml IL4, with three replicates for each concentration and three replicates for each plate. In order to align with the approach commonly used by other research groups investigating the effects of antidepressants on microglia activation, cells were then returned to the incubator for a further 24-h period (Hashioka and et al., 2007; Horikawa and et al., 2010; Liu and et al., 2011; Tynan and et al., 2012). Post-incubation, cells and cell culture supernatants were harvested for subsequent analysis by RT-PCR, enzyme-linked immunosorbent assay (ELISA) and Western blot.
171
175 176 177 178 179 180 181 182 183 184 185 186 187 188
189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211
212 213 214 215 216 217 218 219 220
221 222 223 224 225
The measurement for the mRNA expressions of IL-1b, IL-6, TNFa, iNOS and IL-10 by real-time PCR Total RNA was extracted from induced cell cultures using the Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. Identical amounts of RNA (1 mg) were reverse transcribed into cDNA by using a commercial RT-PCR kit (Takara, China) according to the manufacturer’s instructions. cDNA was subsequently amplified by PCR with specific primers (TNFa forward, GATCGGTCCCCAAAGGGATG; TNFa reverse, CCTC CACTTGGTGGTTTGTG; IL-1b forward, TGCCACCTT TTGACAG TGATG; IL-1b reverse, TGATGTGCTGC TGCGAGATT; IL-6 forward, GTGGCTA AGGACCAAG ACCA; IL-6 reverse, TTCCAAGAAACCATCTGGCTA; iNOS forward, CCTTGGTGAAGGGACTGAGC; iNOS reverse, CAACGTTCTCCGTTC TCTTGC; IL-10forward, GGCGCTG TCATCGATTTCTC; IL-10 reverse, ATG GCC TTGTAGACACCTTGG;18s forward, CAGCCAC CCGAGATTGAGCA;18s reverse, TAGTA CGACG GGCGGTGTG). Gene expression was calculated relative to the endogenous control samples (18s) and to the control sample to give a relative quantification (RQ) value. ELISA measurements for IL-1b, TNFa and IL-10 concentrations IL-1b, TNFa and IL-10 concentrations were measured using commercially available ELISA kits (R&D Systems, USA). Assays were performed according to the manufacturers’ instructions and absorbance read at 450 nm using a micro-plate reader. Absorbance was then calculated as a concentration using a standard curve. Western blot analysis for CD86 and CD206 expressions To confirm changes in CD86 and CD206 levels, cells were collected for Western blot analysis at designated times. In brief, cells were lysed in lysis buffer (Beyotime,
China). Protein concentrations in cell lysates were determined using a protein assay kit (Biyuntian, China). An equal amount of protein from each sample was separated by SDS–polyacrylamide gel electrophoresis (10% gel) and transferred to Trans-Blot SD membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1 h, followed by incubation overnight with primary anti-bodies (Santa, USA, 1:1000). Immunoreactive bands were detected using a peroxidase-linked anti-rabbit or anti-mouse IgG (Kelian, China, 1:5000). Immunoreactive bands were detected by enhanced chemiluminescence (ECL) plus detection reagent (Pierce, USA), and analyzed using an Omega 16ic Chemiluminescence Imaging System (Ultra-Lum, USA).
226
Statistical analysis
240
All results were expressed as mean ± SEM. Statistical analysis of data was done by a one-way ANOVA using LSD (least significant difference) or Dunnett’s test in multiple comparisons of means. Differences were considered statistically significant if the p value <0.05.
241
RESULTS
246
227 228 229 230 231 232 233 234 235 236 237 238 239
242 243 244 245
Cell viability
247
As compared to untreated cells, no significant differences were found in the viability of cells after treating with different concentrations of fluoxetine or S-citalopram (in both cases p > 0.05, data not shown).
248
Effects of antidepressants on LPS + INFc-induced gene expressions of pro-inflammatory cytokines and iNOS in microglia cells
252
The results indicated significant effects of antidepressant treatment on the gene expressions in microglia cells, which included those of IL-1b (F = 34.105, p < 0.001), IL-6 (F = 51.747, p < 0.001), TNFa (F = 136.616, p < 0.001) and iNOS (F = 192.342, p < 0.001) in BV2 cells, and those of IL-1b (F = 66.806, p < 0.001), IL-6 (F = 117.296, p < 0.001), TNFa (F = 55.636, p < 0.001) and iNOS (F = 334.422, p < 0.001) in primary cells. As shown in Fig. 1, LPS + INFc significantly increased the mRNA expressions of all inflammation indexes with an exception of IL-6 in BV2 cells (p < 0.05 in all cases). Furthermore, fluoxetine (both 20 and 60 lM) significantly reduced the IL-1b mRNA expression in BV2 cells (p < 0.001 in both cases), while 60 lM fluoxetine and 60 lM S-citalopram significantly reduced the IL-1b mRNA expression in primary cells (p = 0.017, p < 0.001, respectively). Fluoxetine and S-citalopram (both in 20 and 60 lM) significantly reduced the gene expression of IL-6 and iNOS in BV2 cells and primary cells (p < 0.05 in all cases), without the effect of 20 lM S-citalopram in BV2 cells (p = 0.374, p = 1.000, respectively). The two concentrations of fluoxetine and 60 lM S-citalopram significantly decreased the TNFa mRNA expression in BV2 cells (p = 0.022, p < 0.001, p = 0.015, respectively), while only the antidepressants at the higher concentration significantly reduced TNFa mRNA
255
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
249 250 251
253 254
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281
NSC 16083
No. of Pages 9
28 February 2015
4
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 1. Effects of antidepressants on LPS + INFc-induced gene expressions of pro-inflammatory cytokines and iNOS in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control groupvehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60– 60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The mRNA expressions were measured by real-time PCR. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
Fig. 2. Effects of antidepressants on LPS + INFc-induced productions of pro-inflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The cytokine productions were measured by ELISA. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
282 283
284 285 286 287 288 289
expression in primary cells (p = 0.027, p = 0.026, respectively). Effects of antidepressants on LPS + INFc-induced pro-inflammatory cytokines concentrations in microglia cells The results indicated significant effects of antidepressant treatment on the cytokine productions in microglia cells, which included those of IL-1b (F = 220.824, p < 0.001)
and TNFa (F = 41.969, p < 0.001) in BV2 cell, and those of IL-1b (F = 83.800, p < 0.001) and TNFa (F = 3.744, p = 0.048) in primary cells. As illustrated in Fig. 2, LPS + INFc significantly induced the production of IL-1b in both BV2 cells and microglia primary cells (p < 0.001 in both cases). Furthermore, both antidepressants, at both concentrations, significantly inhibited the IL-1b production (p < 0.05 in all cases) without the effect of 20 lM S-citalopram in BV2 cells (p = 0.288). For TNFa, LPS + INFc significantly
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
290 291 292 293 294 295 296 297 298 299
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 3. Effects of antidepressants on LPS + INFc-induced expression of M1 activation markers in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control groupvehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The protein expressions were measured by Western blot. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄ p < 0.001 vs. model group alone.
300 301 302 303 304
305 306 307 308 309 310 311 312 313 314 315 316
317 318 319 320 321 322 323 324 325 326 327 328
induced the production from BV2 cells but failed to have any significant effect on the primary cells (p = 0.036, p = 0.963, respectively). Both antidepressants, at both concentrations, had no significant effect on TNFa production (p > 0.05 in all cases). Effects of antidepressants on LPS + INFc-induced expressions of M1-activation markers in microglia cells
5
Fig. 4. Effects of antidepressants on IL4-induced gene expression of anti-inflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20- incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The mRNA expressions were measured by real-time PCR. Data represent the mean ± SEM of three independent experiments. ⁄ p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
S-citalopram significantly up-regulated the expression of IL-10 mRNA in primary cells (p < 0.001 in both cases).
329
Effects of antidepressants on IL4-induced production of anti-inflammatory cytokines in microglia cells
331
The results indicated significant effects of antidepressant treatment on IL-10 productions both in BV2 cells (F = 34.510, p < 0.001) and primary microglia cells (F = 71.620, p < 0.001). As shown in Fig. 5, IL-4 significantly enhanced the IL-10 production both in BV2 cells and primary cells (p < 0.05 in both cases).
333
The results indicated significant effects of antidepressant treatment on CD86 expressions in microglia cells either in BV2 cells (F = 249.965, p < 0.001) or in primary cells (F = 437.921, p < 0.001). As shown in Fig. 3, LPS + INFc significantly enhanced CD86 expression in both BV2 cells and primary cells (p < 0.001 in both cases). Furthermore, both antidepressants at both concentrations significantly decreased CD86 expression (p < 0.001 in all cases).
Effects of antidepressants on IL4-induced gene expression of anti-inflammatory cytokine in microglia cells The results indicated significant effects of antidepressant treatment on IL-10 mRNA expressions both in BV2 cells (F = 57.590, p < 0.001) and primary microglia cells (F = 1132.230, p < 0.001). As illustrated in Fig. 4, IL-4 significantly improved the expression of IL-10 mRNA both in the BV2 cells and primary cells (p < 0.05 in both cases). Furthermore, 60 lM fluoxetine significantly enhanced the expression of IL-10 mRNA in BV2 cells (p = 0.013), and both 60 lM fluoxetine and 60 lM
Fig. 5. Effects of antidepressants on IL4-induced production of antiinflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L Scitalopram. The cytokine productions were measured by ELISA. Data represent the mean ± SEM of three independent experiments. ⁄ p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
330
332
334 335 336 337 338
NSC 16083
No. of Pages 9
28 February 2015
6 339 340 341 342 343
344 345
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Furthermore, both concentrations of fluoxetine and 60 lM S-citalopram significantly increased the IL-10 production either in BV2 cells or in primary cells (p < 0.05 in all cases), while 20 lM S-citalopram significantly reduced the production of IL-10 by primary cells (p = 0.003). Effects of antidepressants on IL4-induced expression of M2 activation markers in microglia cells
356
The results indicated significant effects of antidepressant treatment on CD206 expressions both in BV2 cells (F = 43.054, p < 0.001) and primary microglia cells (F = 208.710, p < 0.001). As shown in Fig. 6, IL-4 significantly improved the expression of CD206 in primary cells (p < 0.001) but failed to have any significant effect on BV2 cells (p = 0.132). Furthermore, fluoxetine at both concentrations and 60 lM Scitalopram significantly increased the expressions of CD206 in both BV2 cells and primary cells (p < 0.05 in all cases).
357
DISCUSSION
358
The present study demonstrated that both fluoxetine and S-citalopram significantly reduced the gene expression and protein production of pro-inflammatory mediators in both BV2 cells and primary microglia cells. This implies that the inhibitory effects of M1 activation of microglia may be a common mechanism of SSRIs to exert their antidepressant action. Furthermore, the study firstly reported that both fluoxetine and S-citalopram significantly promoted the M2 activation of microglia. This is a very significant finding as it suggests that the
346 347 348 349 350 351 352 353 354 355
359 360 361 362 363 364 365 366 367
Fig. 6. Effects of antidepressants on IL4-induced expression of M2 activation markers in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20– 20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The marker expressions were measured by Western blot. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄ p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
SSRIs affect the immune system in CNS via inhibiting the M1 activation as well as via promoting the M2 activation of microglia. Just as mentioned above, in order to keep the comparability with previous studies investigating the effects of SSRIs on microglia activation, both mRNA and protein levels of microglia were tested after costimulation with SSRI and LPS + IFN-c or IL-4 for 24 h. But for cytokines like IL-1b, TNFa and IL-10, gene and protein levels were measured at the same time point and the temporal effect of treatment on gene and protein expression should be taken into consideration. It is proven that the gene level of inflammatory factors changed during the 24 h after stimulation. They generally reached peak at about 6 to 12 h, and then decreased gradually. And according to our study, the mRNA levels of most factors could maintain a significantly higher level compared to the treated group after 24 h. Universally activation maker expressions and cytokine secretions generally increased from 3 to 24 h and reached peak from 6 to 24 h after stimulation. Consequently, it is reasonable to make measurement at 24 h when the variance of both protein and mRNA could be observed. Microglia, the brain-specific macrophage, play a crucial role in inflammation modulation in the CNS, and microglia dysfunction is believed to result in CNS immune disorder (Saijo and Glass, 2011). Recently, the role of microglia in some ‘non-primary inflammatory’ disease has gained attention. For cerebrovascular disease, such as ischemia stroke and intracerebral hemorrhage, microglia cells may contribute to injury and yet are crucial for remodeling and repair. Therapies that inhibit M1 activation or augment M2 activation would be beneficial for recovery (Taylor and Sansing, 2013). For neurodegenerative diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD), the switch from M2 to M1 microglial activation is believed to play an important role in disease progression. Therefore, the best treatment for these diseases should involve anti-inflammatory components (Rogers and et al., 2007; Varnum and Ikezu, 2012). For depression, the investigations of microglia are in the beginning and therefore the demonstration of a pathogenic role for microglial activation in depression is actually difficult. However, some indirect but converging evidence has already begun to emerge (Steiner and et al., 2011; Torres-Platas and et al., 2014). Steiner and et al. (2011) demonstrated an increased density of microglia positive for quinolinic acid, an N-methyl-D-aspartate (NMDA) glutamate receptor agonist produced and released by activated microglia in the brain by comparing depressed patients who committed suicide to healthy controls. Additionally, the ratio of primed over ramified (‘‘resting’’) microglia were proved to be significantly increased in the brain from depressed suicides (Torres-Platas and et al., 2014). These data implied that in depressed patients, the immune system seems to be over-activated, and this contributes to the development of depression (Miller et al., 2009; Krishnadas and Cavanagh, 2012), which may, at least in part, result from the massive M1 activation of microglia. The antidepressant efficacy of
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489
minocycline (Miyaoka and et al., 2012; Hinwood and et al., 2012; Arakawa and et al., 2012), which is suggested to selectively inhibit microglial M1, but not M2 activation (Kobayashi and et al., 2013), further supports the idea that microglia activation dysfunction plays an important role in the etiology of depression. However, up to date, the imbalance of microglial activation (M1 vs. M2) has not been examined in models of depression (Burke and et al., 2014). In addition, SSRIs have been shown to affect the immune system (Tuglu and et al., 2003; Basterzi and et al., 2005), and their modulating effect on microglia activation has recently gained attention. Consistent with most of previous studies, the present study demonstrated that both fluoxetine and S-citalopram can significantly reduce the expression and release of the pro-inflammation index of microglia (Hashioka and et al., 2007; Lim and et al., 2009; Horikawa and et al., 2010; Liu and et al., 2011; Lee and et al., 2011; Du et al., 2014). It also provided evidence for the anti-inflammation properties of SSRIs and suggested that SSRIs may exert neuro-protective ability by inhibiting the M1 activation of microglia. However, contrary results have also been presented in other studies. Ha et al. (2006) demonstrated that 1 lM fluoxetine significantly improved the release of NO and iNOS mRNA expression of ‘resting’ BV2 cells, which might indicate that fluoxetine could be responsible for the promotion effect on the M1 activation of microglia. However, in their experiment, the concentration of fluoxetine was much lower than the putative level of the SSRIs within brain tissue following therapeutic administration. Furthermore, in a diseased brain with an immune disorder, microglia are more likely to be activated rather than resting. Altogether, our experiments seem more comparable with the modulatory effect of SSRIs on microglia during their administration in depression. However, Ha et al.’s study may indicate that the regulating effect of fluoxetine on activation of microglia is concentration-dependent. The study of Tynan et al. also supported this idea (Tynan and et al., 2012). According to their results, fluoxetine, citalopram, sertraline, paroxetine and fluvoxamine at concentrations lower than 5 lM all significantly improved the production of TNFa in M1-activated microglia. Taken together, the immune modulation effects of SSRIs may be concentration-dependent, but in the process of treating depression, they may inhibit the M1 activation of microglia in CNS. These data suggest that the anti-inflammatory properties of SSRIs may partially mediate their neuro-protective and anti-depressant ability. M2-activated microglia are considered to reduce the damage to healthy tissues during the inflammation phase by playing an anti-inflammatory role. Additionally, M2-activated microglia also produce various growth factors to promote tissue repair (Colton and Wilcock, 2010). Accordingly, in a diseased brain, the enhancement of the M2 activation of microglia would be beneficial for recovery, and this has been proven in numerous diseases (Rogers and et al., 2007; Salemi and et al., 2011; Varnum and Ikezu, 2012; Taylor and Sansing, 2013; Rizzo and et al., 2014). For depression, no direct evidence supports a relationship between disease process and M2-activated
7
microglia, but a recent study gives some indication that this relationship may exist. Burke et al. proved that the antidepressant efficacy of minocycline is accomplished by the improvement of M2 activation of microglia in certain brain regions (Burke and et al., 2014). This finding implies that the promotion of M2 activation of microglia may be beneficial for recovery from depression. In the current study, we firstly demonstrated that fluoxetine and S-citalopram can both improve the M2 activation of microglia, especially at higher concentrations (60 lM). This finding indicates that the immune modulation effect of SSRIs also involves the improvement of M2 activation of microglia and that the immune modulation effect may also mediate the neuro-protective and antidepressant role of SSRIs. The cellular mechanism of how SSRIs affected the microglia activation was beyond the present study, but the changes of inflammatory agents could give us some implications. M1 stimuli such as LPS and IFN-c induce the activation of the transcription factors NF-jB (p65 and p50), activator protein 1 (AP-1), interferon regulatory factor 3 (IRF3) and signal transducers and activators of transcription 1 (STAT1) through the Tolllike receptor 4 (TLR4) and receptors for IFN, which leads to the transcription of genes of IL12p40, TNF, IL1b and IL-6 during M1-activating process. Fluoxetine and S-citalopram significantly inhibited LPS and IFN-c induced IL-1b secretion, but failed to decrease TNF-a expression. These results indicated that LPS and IFN-c induce IL-1b and TNF-a secretion from microglia through different pathways, while SSRIs may only block IL-1b production. Therefore, exploring the molecular mechanism of microglia activation, especially in the cytokine release could be helpful in understanding the anti-inflammatory effects of SSRIs. Meanwhile, fluoxetine and S-citalopram displayed different modulation effects on microglia activation and it is assumed that different SSRIs affect the M1 activation of microglia via the different cell signaling pathways, for example by elevating intracellular Ca2+ (Horikawa and et al., 2010), inhibiting inhibitory subunit of NF-kB (IkBa) degradation, restraining nuclear factor kB (NF-kB) Liu and et al., 2011, blocking protein kinase A (PKA) function Hashioka and et al., 2007 and up-regulating b-arrestin 2 expression (Du et al., 2014). And the differences were speculated to result from the different chemical structures of SSRIs. While for M2 activation, as the present study firstly investigated the effects of SSRIs on microglia M2 activation, the underlying mechanism is totally ill-defined so far. It is proven that M2 stimuli such as IL-4 and IL13 signals through IL-4 receptor-a to activate STAT6, which regulates the expressions of M2-activation genes such as suppressor of cytokine signaling 3 (SOCS3) and IL10. In addition to STAT pathway, a variety of other signaling molecules are important in regulating IL-4-induced anti-inflammation, such as SOCS-1, Fes tyrosine kinase and a number of phosphatases including SH2-containing inositol phosphatase (SHIP), SHP-1, and SHP-2 (Jiang et al., 2000). Moreover, IL-4 induced expression of peroxisome proliferator-activated receptor (PPAR)gamma, an important anti-inflammatory receptor was pro-
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550
NSC 16083
No. of Pages 9
28 February 2015
8
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
592
ven in microglia (Kitamura and et al., 2000). Thus a complex interaction of signaling pathways and regulators was involved in the IL-4 induced microglia M2 activation and exploring the effects of SSRIs on these pathways may contribute to a better understanding of the pharmacological mechanism of SSRIs. However, it should be noted that several questions remain unsolved in this study. Firstly, even though it is reasonable to make measurement at 24 h when the variance of both protein and mRNA could be observed and a better comparability of the results could be gained at this time point, the temporal effect of treatment on gene and protein expression still needed to be paid great attention. And to better identify the effects of SSRIs on microglia activation, these indexes of inflammation should be tested at several time points in the future studies and the gene measurement should be done ahead of protein measurement. Secondly, the finding regarding TNFa release of primary microglia cells conflicted with previous studies, as we demonstrated that LPS + INFc did not significantly increase the TNFa production. In previous studies, LPS and INFc both significantly enhanced TNFa release (Colton and Wilcock, 2010), but they were generally used separately to induce the activation. In our study, the combination of LPS and INFc resulted in more intensive activation, and the rise of TNFa release may continue only a short time. Testing the inflammation indexes at several time points could also give a solution to this issue. Thirdly, differences of inflammatory indexes expressions also existed between the BV2 cells and primary microglia cells. This finding may imply that the cell properties changed and that they may not be an accurate model. Therefore, in vivo studies are needed to test the effect of SSRIs on microglia activation. Lastly and perhaps most importantly, the effects of SSRIs at different concentrations varied substantially, especially for M2 activation. We do not fully understand the meaning of this phenomenon, as the level of the SSRIs within brain tissue after successful treatment is still a matter of debate (Horikawa and et al., 2010). Pharmacokinetic experiments should give us more detailed information.
593
CONCLUSION
594
600
In summary, the SSRIs inhibited the LPS + INFcinduced M1 activation of microglia and promoted the IL4-induced M2 activation of microglia, suggesting that the therapeutic effects of SSRIs may be partially mediated by their effects of immune modulation, which involve in either in M1 inhibition or in M2 promotion effects.
601
CONFLICT OF INTEREST
551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591
595 596 597 598 599
602
The authors have no conflict of interests.
603
Acknowledgments—This work was supported by the National Nature Science Finding of China (31371074), National Science and Technology Major Projects (2012ZX09506-001-009), Clinical Medicine Science and Technology Project of Jiangsu Province (BL2013025, BL2014077), China Postdoctoral Science Founda-
604 605 606 607
tion (2103M531257) and Strategic Priority Research Program of Chinese Academy of Science (XDB02020002).
608
REFERENCES
610
Aloisi F (2001) Immune function of microglia. Glia 36(2):165–179. Arakawa S et al. (2012) Minocycline produced antidepressant-like effects on the learned helplessness rats with alterations in levels of monoamine in the amygdala and no changes in BDNF levels in the hippocampus at baseline. Pharmacol Biochem Behav 100(3):601–606. Barrientos RM et al. (2003) Brain-derived neurotrophic factor mRNA downregulation produced by social isolation is blocked by intrahippocampal interleukin-1 receptor antagonist. Neuroscience 121(4):847–853. Basterzi AD et al. (2005) IL-6 levels decrease with SSRI treatment in patients with major depression. Hum Psychopharmacol 20(7):473–476. Ben MO et al. (2008) Intrahippocampal transplantation of transgenic neural precursor cells overexpressing interleukin-1 receptor antagonist blocks chronic isolation-induced impairment in memory and neurogenesis. Neuropsychopharmacology 33(9):2251–2262. Burke NN et al. (2014) Minocycline modulates neuropathic pain behaviour and cortical M1–M2 microglial gene expression in a rat model of depression. Brain Behav Immun 42:147–156. Capuron L, Miller AH (2011) Immune system to brain signaling: neuropsychopharmacological implications. Pharmacol Ther 130(2):226–238. Colton C, Wilcock DM (2010) Assessing activation states in microglia. CNS Neurol Disord: Drug Targets 9(2):174–191. Dahl J et al. (2014) The plasma levels of various cytokines are increased during ongoing depression and are reduced to normal levels after recovery. Psychoneuroendocrinology 45:77–86. Dowlati Y et al. (2010) A meta-analysis of cytokines in major depression. Biol Psychiatry 67(5):446–457. Du RW, Du RH, Bu WG (2014) Beta-arrestin 2 mediates the antiinflammatory effects of fluoxetine in lipopolysaccharide-stimulated microglial cells. J Neuroimmune Pharmacol 9(4):582–590. Eyre HA, Stuart MJ, Baune BT (2014) A phase-specific neuroimmune model of clinical depression. Prog Neuropsychopharmacol Biol Psychiatry 54:265–274. Fujigaki H et al. (2006) The signal transducer and activator of transcription 1alpha and interferon regulatory factor 1 are not essential for the induction of indoleamine 2,3-dioxygenase by lipopolysaccharide: involvement of p38 mitogen-activated protein kinase and nuclear factor-kappaB pathways, and synergistic effect of several proinflammatory cytokines. J Biochem 139(4):655–662. Ha E et al. (2006) Fluoxetine increases the nitric oxide production via nuclear factor kappa B-mediated pathway in BV2 murine microglial cells. Neurosci Lett 397(3):185–189. Hannestad J, DellaGioia N, Bloch M (2011) The effect of antidepressant medication treatment on serum levels of inflammatory cytokines: a meta-analysis. Neuropsychopharmacology 36(12):2452–2459. Hashioka S et al. (2007) Antidepressants inhibit interferon-gammainduced microglial production of IL-6 and nitric oxide. Exp Neurol 206(1):33–42. Hinwood M et al. (2012) Evidence that microglia mediate the neurobiological effects of chronic psychological stress on the medial prefrontal cortex. Cereb Cortex 22(6):1442–1454. Horikawa H et al. (2010) Inhibitory effects of SSRIs on IFN-gamma induced microglial activation through the regulation of intracellular calcium. Prog Neuropsychopharmacol Biol Psychiatry 34(7):1306–1316. Hu F, Pace TW, Miller AH (2009) Interferon-alpha inhibits glucocorticoid receptor-mediated gene transcription via STAT5
611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
609
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 762 763 764
activation in mouse HT22 cells. Brain Behav Immun 23(4):455–463. Iosif RE et al. (2006) Tumor necrosis factor receptor 1 is a negative regulator of progenitor proliferation in adult hippocampal neurogenesis. J Neurosci 26(38):9703–9712. Jiang H, Harris MB, Rothman P (2000) IL-4/IL-13 signaling beyond JAK/STAT. J Allergy Clin Immunol 105(6 Pt. 1):1063–1070. Kettenmann H et al. (2011) Physiology of microglia. Physiol Rev 91(2):461–553. Kitamura Y et al. (2000) Interleukin-4-inhibited mRNA expression in mixed rat glial and in isolated microglial cultures. J Neuroimmunol 106(1–2):95–104. Kobayashi K et al. (2013) Minocycline selectively inhibits M1 polarization of microglia. Cell Death Dis 4:e525. Krishnadas R, Cavanagh J (2012) Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry 83(5):495–502. Lee CH et al. (2011) Pre- and post-treatments with escitalopram protect against experimental ischemic neuronal damage via regulation of BDNF expression and oxidative stress. Exp Neurol 229(2):450–459. Lim CM et al. (2009) Fluoxetine affords robust neuroprotection in the postischemic brain via its anti-inflammatory effect. J Neurosci Res 87(4):1037–1045. Liu D et al. (2011) Anti-inflammatory effects of fluoxetine in lipopolysaccharide (LPS)-stimulated microglial cells. Neuropharmacology 61(4):592–599. Lo FS et al. (2010) Outcome of psychiatric symptoms presenting at onset of multiple sclerosis: a retrospective study. Mult Scler 16(6):742–748. Miller AH, Pariante CM, Pearce BD (1999) Effects of cytokines on glucocorticoid receptor expression and function. Glucocorticoid resistance and relevance to depression. Adv Exp Med Biol 461:107–116. Miller AH, Maletic V, Raison CL (2009) Inflammation and its discontents: the role of cytokines in the pathophysiology of major depression. Biol Psychiatry 65(9):732–741. Miyaoka T et al. (2012) Minocycline as adjunctive therapy for patients with unipolar psychotic depression: an open-label study. Prog Neuropsychopharmacol Biol Psychiatry 37(2):222–226. Nimmerjahn A, Kirchhoff F, Helmchen F (2005) Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 308(5726):1314–1318. Raison CL, Miller AH (2011) Is depression an inflammatory disorder? Curr Psychiatry Rep 13(6):467–475.
9
Rizzo F et al. (2014) Cellular therapy to target neuroinflammation in amyotrophic lateral sclerosis. Cell Mol Life Sci 71(6):999–1015. Rogers J et al. (2007) Neuroinflammation in Alzheimer’s disease and Parkinson’s disease: are microglia pathogenic in either disorder? Int Rev Neurobiol 82:235–246. Roumestan C et al. (2007) Anti-inflammatory properties of desipramine and fluoxetine. Respir Res 8:35. Saijo K, Glass CK (2011) Microglial cell origin and phenotypes in health and disease. Nat Rev Immunol 11(11):775–787. Salemi J et al. (2011) Flipping the switches: CD40 and CD45 modulation of microglial activation states in HIV associated dementia (HAD). Mol Neurodegener 6(1):3. Steiner J et al. (2011) Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: evidence for an immune-modulated glutamatergic neurotransmission? J Neuroinflammation 8:94. Taylor RA, Sansing LH (2013) Microglial responses after ischemic stroke and intracerebral hemorrhage. Clin Dev Immunol 2013:746068. Torres-Platas SG et al. (2014) Evidence for increased microglial priming and macrophage recruitment in the dorsal anterior cingulate white matter of depressed suicides. Brain Behav Immun 42:50–59. Tuglu C et al. (2003) Increased serum tumor necrosis factor-alpha levels and treatment response in major depressive disorder. Psychopharmacology 170(4):429–433. Tynan RJ et al. (2012) A comparative examination of the antiinflammatory effects of SSRI and SNRI antidepressants on LPS stimulated microglia. Brain Behav Immun 26(3):469–479. Varnum MM, Ikezu T (2012) The classification of microglial activation phenotypes on neurodegeneration and regeneration in Alzheimer’s disease brain. Arch Immunol Ther Exp (Warsz) 60(4):251–266. Wichers M, Maes M (2002) The psychoneuroimmunopathophysiology of cytokine-induced depression in humans. Int J Neuropsychopharmacol 5(4):375–388. Yang W et al. (2004) Altered RNA editing of serotonin 5-HT2C receptor induced by interferon: implications for depression associated with cytokine therapy. Brain Res Mol Brain Res 124(1):70–78. Zhu CB, Blakely RD, Hewlett WA (2006) The proinflammatory cytokines interleukin-1beta and tumor necrosis factor-alpha activate serotonin transporters. Neuropsychopharmacology 31(10):2121–2131.
(Accepted 13 February 2015) (Available online xxxx)
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761
No. of Pages 9
28 February 2015 Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028 1
Neuroscience xxx (2015) xxx–xxx
3
FLUOXETINE AND S-CITALOPRAM INHIBIT M1 ACTIVATION AND PROMOTE M2 ACTIVATION OF MICROGLIA IN VITRO
4
F. SU, a H. YI, a L. XU b AND Z. ZHANG a*
5 6 7
a The Department of Neurology of Affiliated ZhongDa Hospital, The Institute of Neuropsychiatry and Medical School of Southeast University, Nanjing, China
8 9
b Laboratory of Learning and Memory, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China
2
10
Key words: depression, microglia, fluoxetine, S-citalopram. 11
Abstract—Increasing evidence has suggested that microglia dysfunction plays an important role in the pathogenesis of depression. Both classical activation (M1 activation) and alternative activation (M2 activation) may be involved in the process. M1-activated microglia secrete various pro-inflammatory cytokines and neurotoxic mediators, which may contribute to the development of depression, while M2-activated microglia promote tissue reconstruction by releasing anti-inflammatory cytokines involved in the process of depression. Selective serotonin reuptake inhibitors (SSRIs) are first-line treatments for depression, and their effects on immune system modulation have recently gained attention. Several studies have suggested that SSRIs affect the M1 activation of microglia, but results have varied. In addition, little is known about the effect of SSRIs on M2 activation in depression. The aim of this study was to investigate the effects of fluoxetine and S-citalopram, two widely used SSRIs in clinical, on both the M1 and M2 activation of microglia (the murine BV2 cell line and mouse primary microglia cell). The indexes of activation were measured by real-time polymerase chain reaction (PCR), enzymelinked immunosorbent assay (ELISA) and Western blot. The present results showed that both fluoxetine and Scitalopram significantly down-regulated the indexes of M1 activation and up-regulated the M2 activation indexes on mRNA and protein levels either in cell line or primary cells. Taken together, the results suggested that fluoxetine and S-citalopram modulated the immune system by inhibiting M1 activation and by improving M2 activation of microglia and that the immune system modulation may partially mediate the therapeutic effects of antidepressant drugs-SSRIs. Ó 2015 Published by Elsevier Ltd. on behalf of IBRO.
*Corresponding author. Tel/fax: +86-25-83262241. E-mail address: [email protected] (Z. Zhang). These authors equally contributed to the work. Abbreviations: CD86, cluster of differentiation 86; DMEM, Dulbecco’ s modified Eagle medium; ELISA, enzyme-linked immunosorbent assay; FBS, fetal bovine serum; IFN-c, interferon-c; IL-6, interleukin-6; LPS, lipopolysaccharide; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide; NO, nitric oxide; SOCS3, suppressor of cytokine signaling 3; SSRIs, selective serotonin reuptake inhibitors; STAT, signal transducers and activators of transcription; TNF-a, tumor necrosis factor-a. http://dx.doi.org/10.1016/j.neuroscience.2015.02.028 0306-4522/Ó 2015 Published by Elsevier Ltd. on behalf of IBRO. 1
INTRODUCTION
12
The relationship of inflammation with depression has been supported by some well-known observations. For examples, major depressive disorder (MDD) is associated with raised inflammatory markers (Dahl and et al., 2014) and inflammatory medical illnesses (Lo and et al., 2010). In addition, patients treated with cytokines for various illnesses are at an increased risk of developing depression (Wichers and Maes, 2002). Even though the association between inflammation and depression is not consistently significant in all studies or for all cytokines, the positive results of meta-analysis gave convincing evidence for the relationship, and the heterogeneity of different studies may arise from the differences of age, gender, race, symptom severity and the phase of illness (Dowlati and et al., 2010). Based on these observations, the hypothesis has been posited, in which inflammatory processes might contribute to the development of depression, and numerous studies have attempted to explain how inflammatory processes cause changes in brain structure and function related to depression (Capuron and Miller, 2011; Raison and Miller, 2011). Increasing evidence suggested that inflammation can reduce neurogenesis (Barrientos and et al., 2003; Iosif and et al., 2006; Ben and et al., 2008), motivate the activity of hypothalamic–pituitary–adrenal (HPA) axis Miller et al., 1999; Hu et al., 2009 and inhibit the function of serotonin system (Yang and et al., 2004; Fujigaki and et al., 2006; Zhu et al., 2006), all of which are believed to play key roles in the development of depression. The above evidences have implicated inflammation involves in the etiology of depression and have formed the foundation of the neuro-inflammation theory of depression. The dysfunction of microglia in depression is now gaining much more attention, as the microglia cell is generally considered as the most important immune cell in the central nervous system. In healthy brains, the microglia are ‘resting’ and play the role of immune supervision (Nimmerjahn et al., 2005). However, in pathological conditions, microglia can be activated by various stimulations (Aloisi, 2001), and different stimulations induce the activation of microglia into a ‘classical (M1)’ or ‘alternative (M2)’ activated states (Colton and Wilcock, 2010). The M1-activated cells undergo rapid proliferation, express activation markers [such as cluster of
13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56
NSC 16083
No. of Pages 9
28 February 2015
2 57 58
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
differentiation 86 (CD86)] and secrete various pro-inflammatory cytokines [such as tumor necrosis factor-a (TNFa), interleukin-6 (IL-6), interleukin 1-b (IL-1b)] and cytotoxic factors [such as nitric oxide (NO) and reactive oxygen–nitrogen species] (Aloisi, 2001). Microglia cells in this state generally act in tissue defense and promote the destruction of pathogens (Kettenmann and et al., 2011). However, the microglia cells can induce inflammo-toxicity of the healthy tissue at the same time (Colton and Wilcock, 2010). Hence the M2-activated microglia cells are key aspects in keeping the homeostasis in the CNS by secreting anti-inflammatory cytokines [for example, IL-10 and transforming growth factor-b (TGF-b)] to down-regulate the pro-inflammatory process and initiate tissue reconstruction (Kettenmann and et al., 2011). The balance between M1/M2 activation is extremely important in keeping healthy and resisting diseases. It has been suggested that excessive M1 activation and deficiency of M2 activation is of great significance in the etiology and pathogenesis of depression. In addition, anti-inflammatory medications may be beneficial in the treatment process (Eyre et al., 2014). Selective serotonin reuptake inhibitors (SSRIs) have been a first-line choice for the treatment of depression for several decades, and the SSRIs act, at least in part, by increasing monoamine transmission. However, in recent decades, the antidepressants have been proven to modulate the inflammation process (Roumestan and et al., 2007; Hannestad et al., 2011). Clinical studies showed that the elevated serum levels of pro-inflammatory cytokines in depressed patients are often turned to normalization after successful treatment with antidepressants (Hannestad et al., 2011). In vitro studies further support the finding by showing that SSRIs can inhibit the activation of peripheral immune cells from either human or rodent (Roumestan and et al., 2007). Although the SSRIs affect the immune cell in the peripheral nervous system, it is not reasonable to conclude that SSRIs modulate the inflammation process in the CNS and that the therapeutic effects may be related to inflammation. Recently, several studies have shed light on this issue by focusing on the effects of SSRIs on microglia activation. However, the results of such studies have been variable and even contradictory (Ha et al., 2006; Hashioka and et al., 2007; Lim and et al., 2009; Horikawa and et al., 2010; Liu and et al., 2011; Lee and et al., 2011; Tynan and et al., 2012; Du et al., 2014). Furthermore, all the studies only focused on the M1 activation of microglia affected by SSRIs, and no study to date has investigated the effect of SSRIs on the M2 activation of microglia. Accordingly, in the current study, we sought to investigate the effect of fluoxetine and S-citalopram, two widely used SSRIs, on both the M1 and M2 activation of microglia via the research of the murine BV2 cell line and primary microglia cell in vitro. The present study had investigated whether fluoxetine and S-citalopram reduce inflammation indexes of M1 activation and increase the indexes of M2 activation, and whether the effect was concentration-dependent. In summary, the study may provide new evidence concerning the pharmacological mechanism of SSRIs, especially their
promotion of M2 activation of microglia, which may contribute to understanding the pathogenesis and developing new treatment options for depression.
118
EXPERIMENTAL PROCEDURES
121
119 120
Reagents
122
Fluoxetine, lipopolysaccharide (LPS), recombinant interferon-c (IFN-c) and IL-4 were all purchased from Sigma–Aldrich (USA). S-citalopram was purchased from Lundbeck (Denmark). Fluoxetine and S-citalopram were initially dissolved in phosphate-buffered saline (PBS, 150 mM NaCl, 5 mM phosphate, pH 7.4). LPS, recombinant IFN-c and IL-4 were initially dissolved in sterile distilled–deionized water. In all cases, subsequent dilutions to working concentrations were made using cell culture media.
123
BV2 microglial cell culture
133
BV2 cells, which were purchased from Cell Bank of Chinese Academy of Sciences, Shanghai, China, were maintained in Dulbecco’ s modified Eagle medium (DMEM, Invitrogen, USA) with 10% fetal bovine serum (FBS, Invitrogen, USA) in a 5% CO2 incubator. Plated cells were grown in DMEM with 10% FBS overnight. In all experiments, cells were treated with LPS (200 ng/ml) and INF-c (20 ng/ml) or IL-4 (10 ng/ml) in the absence or presence of the indicated concentrations of fluoxetine or S-citalopram (20 or 60 lM) in serum-free DMEM.
134
Primary microglial cell culture
144
Primary microglia cells were prepared from the whole brains of 1–2-day-old SD rat. Briefly, the whole brain were chopped and dissociated by mechanical disruption using a nylon mesh. The cells were seeded in poly-Dlysine-coated flasks. After in vitro culture for 14 days, microglia cells were isolated from mixed glia cultures by mild trypsinization. The prepared primary microglia cultures were more than 95% pure, as determined by CD11b immunocytochemical staining (data not shown). Cells were cultured for 24 h before drug treatment. The experimental protocol was carried out in accordance with the European Communities Council Directive of 24 November 1986 and we spared no efforts to minimize the number of animals used and their suffering.
145
Cell viability assay
159
Cell viability was determined by the tetrazolium salt 3-[4, 5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma–Aldrich, USA) assay. Microglia cells were plated into 96-well culture plates at a density of 5 104 cells/ml with 200-ml culture medium per well. Following treatment with different concentrations (1, 10, 20, 40, 60, 80, and 100 lM) of fluoxetine or S-citalopram for 24 h, 5 mg/ml MTT solution was added to each well and incubated at 37 °C for 4 h. The medium was aspirated and 200-ml dimethyl sulfoxide was added. The absorbance value was measured using
160
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
124 125 126 127 128 129 130 131 132
135 136 137 138 139 140 141 142 143
146 147 148 149 150 151 152 153 154 155 156 157 158
161 162 163 164 165 166 167 168 169 170
NSC 16083
No. of Pages 9
28 February 2015
3
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
172
a multi-well spectrophotometer (Bio-Rad, USA) at 490 nm.
173
MATERIALS AND METHODS
174
The experiment was conducted on both the BV2 cells and primary microglia cells with the same procedure. 20 or 60 lM SSRIs (fluoxetine or S-citalopram) were added to the cells in the presence of 200 ng/ml LPS + 20 ng/ml INF-c or 10 ng/ml IL4, with three replicates for each concentration and three replicates for each plate. In order to align with the approach commonly used by other research groups investigating the effects of antidepressants on microglia activation, cells were then returned to the incubator for a further 24-h period (Hashioka and et al., 2007; Horikawa and et al., 2010; Liu and et al., 2011; Tynan and et al., 2012). Post-incubation, cells and cell culture supernatants were harvested for subsequent analysis by RT-PCR, enzyme-linked immunosorbent assay (ELISA) and Western blot.
171
175 176 177 178 179 180 181 182 183 184 185 186 187 188
189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211
212 213 214 215 216 217 218 219 220
221 222 223 224 225
The measurement for the mRNA expressions of IL-1b, IL-6, TNFa, iNOS and IL-10 by real-time PCR Total RNA was extracted from induced cell cultures using the Trizol reagent (Invitrogen, USA) according to the manufacturer’s instructions. Identical amounts of RNA (1 mg) were reverse transcribed into cDNA by using a commercial RT-PCR kit (Takara, China) according to the manufacturer’s instructions. cDNA was subsequently amplified by PCR with specific primers (TNFa forward, GATCGGTCCCCAAAGGGATG; TNFa reverse, CCTC CACTTGGTGGTTTGTG; IL-1b forward, TGCCACCTT TTGACAG TGATG; IL-1b reverse, TGATGTGCTGC TGCGAGATT; IL-6 forward, GTGGCTA AGGACCAAG ACCA; IL-6 reverse, TTCCAAGAAACCATCTGGCTA; iNOS forward, CCTTGGTGAAGGGACTGAGC; iNOS reverse, CAACGTTCTCCGTTC TCTTGC; IL-10forward, GGCGCTG TCATCGATTTCTC; IL-10 reverse, ATG GCC TTGTAGACACCTTGG;18s forward, CAGCCAC CCGAGATTGAGCA;18s reverse, TAGTA CGACG GGCGGTGTG). Gene expression was calculated relative to the endogenous control samples (18s) and to the control sample to give a relative quantification (RQ) value. ELISA measurements for IL-1b, TNFa and IL-10 concentrations IL-1b, TNFa and IL-10 concentrations were measured using commercially available ELISA kits (R&D Systems, USA). Assays were performed according to the manufacturers’ instructions and absorbance read at 450 nm using a micro-plate reader. Absorbance was then calculated as a concentration using a standard curve. Western blot analysis for CD86 and CD206 expressions To confirm changes in CD86 and CD206 levels, cells were collected for Western blot analysis at designated times. In brief, cells were lysed in lysis buffer (Beyotime,
China). Protein concentrations in cell lysates were determined using a protein assay kit (Biyuntian, China). An equal amount of protein from each sample was separated by SDS–polyacrylamide gel electrophoresis (10% gel) and transferred to Trans-Blot SD membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1 h, followed by incubation overnight with primary anti-bodies (Santa, USA, 1:1000). Immunoreactive bands were detected using a peroxidase-linked anti-rabbit or anti-mouse IgG (Kelian, China, 1:5000). Immunoreactive bands were detected by enhanced chemiluminescence (ECL) plus detection reagent (Pierce, USA), and analyzed using an Omega 16ic Chemiluminescence Imaging System (Ultra-Lum, USA).
226
Statistical analysis
240
All results were expressed as mean ± SEM. Statistical analysis of data was done by a one-way ANOVA using LSD (least significant difference) or Dunnett’s test in multiple comparisons of means. Differences were considered statistically significant if the p value <0.05.
241
RESULTS
246
227 228 229 230 231 232 233 234 235 236 237 238 239
242 243 244 245
Cell viability
247
As compared to untreated cells, no significant differences were found in the viability of cells after treating with different concentrations of fluoxetine or S-citalopram (in both cases p > 0.05, data not shown).
248
Effects of antidepressants on LPS + INFc-induced gene expressions of pro-inflammatory cytokines and iNOS in microglia cells
252
The results indicated significant effects of antidepressant treatment on the gene expressions in microglia cells, which included those of IL-1b (F = 34.105, p < 0.001), IL-6 (F = 51.747, p < 0.001), TNFa (F = 136.616, p < 0.001) and iNOS (F = 192.342, p < 0.001) in BV2 cells, and those of IL-1b (F = 66.806, p < 0.001), IL-6 (F = 117.296, p < 0.001), TNFa (F = 55.636, p < 0.001) and iNOS (F = 334.422, p < 0.001) in primary cells. As shown in Fig. 1, LPS + INFc significantly increased the mRNA expressions of all inflammation indexes with an exception of IL-6 in BV2 cells (p < 0.05 in all cases). Furthermore, fluoxetine (both 20 and 60 lM) significantly reduced the IL-1b mRNA expression in BV2 cells (p < 0.001 in both cases), while 60 lM fluoxetine and 60 lM S-citalopram significantly reduced the IL-1b mRNA expression in primary cells (p = 0.017, p < 0.001, respectively). Fluoxetine and S-citalopram (both in 20 and 60 lM) significantly reduced the gene expression of IL-6 and iNOS in BV2 cells and primary cells (p < 0.05 in all cases), without the effect of 20 lM S-citalopram in BV2 cells (p = 0.374, p = 1.000, respectively). The two concentrations of fluoxetine and 60 lM S-citalopram significantly decreased the TNFa mRNA expression in BV2 cells (p = 0.022, p < 0.001, p = 0.015, respectively), while only the antidepressants at the higher concentration significantly reduced TNFa mRNA
255
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
249 250 251
253 254
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281
NSC 16083
No. of Pages 9
28 February 2015
4
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 1. Effects of antidepressants on LPS + INFc-induced gene expressions of pro-inflammatory cytokines and iNOS in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control groupvehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60– 60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The mRNA expressions were measured by real-time PCR. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
Fig. 2. Effects of antidepressants on LPS + INFc-induced productions of pro-inflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The cytokine productions were measured by ELISA. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
282 283
284 285 286 287 288 289
expression in primary cells (p = 0.027, p = 0.026, respectively). Effects of antidepressants on LPS + INFc-induced pro-inflammatory cytokines concentrations in microglia cells The results indicated significant effects of antidepressant treatment on the cytokine productions in microglia cells, which included those of IL-1b (F = 220.824, p < 0.001)
and TNFa (F = 41.969, p < 0.001) in BV2 cell, and those of IL-1b (F = 83.800, p < 0.001) and TNFa (F = 3.744, p = 0.048) in primary cells. As illustrated in Fig. 2, LPS + INFc significantly induced the production of IL-1b in both BV2 cells and microglia primary cells (p < 0.001 in both cases). Furthermore, both antidepressants, at both concentrations, significantly inhibited the IL-1b production (p < 0.05 in all cases) without the effect of 20 lM S-citalopram in BV2 cells (p = 0.288). For TNFa, LPS + INFc significantly
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
290 291 292 293 294 295 296 297 298 299
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 3. Effects of antidepressants on LPS + INFc-induced expression of M1 activation markers in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with LPS + INFc in the presence or absence of an antidepressant for 24 h: control groupvehicle treated; model group-treated with 200 ng/ml LPS and 20 ng/ ml INFc; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The protein expressions were measured by Western blot. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄ p < 0.001 vs. model group alone.
300 301 302 303 304
305 306 307 308 309 310 311 312 313 314 315 316
317 318 319 320 321 322 323 324 325 326 327 328
induced the production from BV2 cells but failed to have any significant effect on the primary cells (p = 0.036, p = 0.963, respectively). Both antidepressants, at both concentrations, had no significant effect on TNFa production (p > 0.05 in all cases). Effects of antidepressants on LPS + INFc-induced expressions of M1-activation markers in microglia cells
5
Fig. 4. Effects of antidepressants on IL4-induced gene expression of anti-inflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20- incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The mRNA expressions were measured by real-time PCR. Data represent the mean ± SEM of three independent experiments. ⁄ p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
S-citalopram significantly up-regulated the expression of IL-10 mRNA in primary cells (p < 0.001 in both cases).
329
Effects of antidepressants on IL4-induced production of anti-inflammatory cytokines in microglia cells
331
The results indicated significant effects of antidepressant treatment on IL-10 productions both in BV2 cells (F = 34.510, p < 0.001) and primary microglia cells (F = 71.620, p < 0.001). As shown in Fig. 5, IL-4 significantly enhanced the IL-10 production both in BV2 cells and primary cells (p < 0.05 in both cases).
333
The results indicated significant effects of antidepressant treatment on CD86 expressions in microglia cells either in BV2 cells (F = 249.965, p < 0.001) or in primary cells (F = 437.921, p < 0.001). As shown in Fig. 3, LPS + INFc significantly enhanced CD86 expression in both BV2 cells and primary cells (p < 0.001 in both cases). Furthermore, both antidepressants at both concentrations significantly decreased CD86 expression (p < 0.001 in all cases).
Effects of antidepressants on IL4-induced gene expression of anti-inflammatory cytokine in microglia cells The results indicated significant effects of antidepressant treatment on IL-10 mRNA expressions both in BV2 cells (F = 57.590, p < 0.001) and primary microglia cells (F = 1132.230, p < 0.001). As illustrated in Fig. 4, IL-4 significantly improved the expression of IL-10 mRNA both in the BV2 cells and primary cells (p < 0.05 in both cases). Furthermore, 60 lM fluoxetine significantly enhanced the expression of IL-10 mRNA in BV2 cells (p = 0.013), and both 60 lM fluoxetine and 60 lM
Fig. 5. Effects of antidepressants on IL4-induced production of antiinflammatory cytokines in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20–20 lmmol/L S-citalopram; CIT60–60 lmmol/L Scitalopram. The cytokine productions were measured by ELISA. Data represent the mean ± SEM of three independent experiments. ⁄ p < 0.05, ⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
330
332
334 335 336 337 338
NSC 16083
No. of Pages 9
28 February 2015
6 339 340 341 342 343
344 345
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
Furthermore, both concentrations of fluoxetine and 60 lM S-citalopram significantly increased the IL-10 production either in BV2 cells or in primary cells (p < 0.05 in all cases), while 20 lM S-citalopram significantly reduced the production of IL-10 by primary cells (p = 0.003). Effects of antidepressants on IL4-induced expression of M2 activation markers in microglia cells
356
The results indicated significant effects of antidepressant treatment on CD206 expressions both in BV2 cells (F = 43.054, p < 0.001) and primary microglia cells (F = 208.710, p < 0.001). As shown in Fig. 6, IL-4 significantly improved the expression of CD206 in primary cells (p < 0.001) but failed to have any significant effect on BV2 cells (p = 0.132). Furthermore, fluoxetine at both concentrations and 60 lM Scitalopram significantly increased the expressions of CD206 in both BV2 cells and primary cells (p < 0.05 in all cases).
357
DISCUSSION
358
The present study demonstrated that both fluoxetine and S-citalopram significantly reduced the gene expression and protein production of pro-inflammatory mediators in both BV2 cells and primary microglia cells. This implies that the inhibitory effects of M1 activation of microglia may be a common mechanism of SSRIs to exert their antidepressant action. Furthermore, the study firstly reported that both fluoxetine and S-citalopram significantly promoted the M2 activation of microglia. This is a very significant finding as it suggests that the
346 347 348 349 350 351 352 353 354 355
359 360 361 362 363 364 365 366 367
Fig. 6. Effects of antidepressants on IL4-induced expression of M2 activation markers in microglia cells. Both BV2 cells and microglia primary cells were co-incubated with IL4 in the presence or absence of an antidepressant for 24 h: control group-vehicle treated; model group-treated with 10 ng/ml IL4; FLX20-incubated simultaneously with 20 lmmol/L fluoxetine; FLX60–60 lmmol/L fluoxetine; CIT20– 20 lmmol/L S-citalopram; CIT60–60 lmmol/L S-citalopram. The marker expressions were measured by Western blot. Data represent the mean ± SEM of three independent experiments. ⁄p < 0.05, ⁄⁄ p < 0.01, and ⁄⁄⁄p < 0.001 vs. model group alone.
SSRIs affect the immune system in CNS via inhibiting the M1 activation as well as via promoting the M2 activation of microglia. Just as mentioned above, in order to keep the comparability with previous studies investigating the effects of SSRIs on microglia activation, both mRNA and protein levels of microglia were tested after costimulation with SSRI and LPS + IFN-c or IL-4 for 24 h. But for cytokines like IL-1b, TNFa and IL-10, gene and protein levels were measured at the same time point and the temporal effect of treatment on gene and protein expression should be taken into consideration. It is proven that the gene level of inflammatory factors changed during the 24 h after stimulation. They generally reached peak at about 6 to 12 h, and then decreased gradually. And according to our study, the mRNA levels of most factors could maintain a significantly higher level compared to the treated group after 24 h. Universally activation maker expressions and cytokine secretions generally increased from 3 to 24 h and reached peak from 6 to 24 h after stimulation. Consequently, it is reasonable to make measurement at 24 h when the variance of both protein and mRNA could be observed. Microglia, the brain-specific macrophage, play a crucial role in inflammation modulation in the CNS, and microglia dysfunction is believed to result in CNS immune disorder (Saijo and Glass, 2011). Recently, the role of microglia in some ‘non-primary inflammatory’ disease has gained attention. For cerebrovascular disease, such as ischemia stroke and intracerebral hemorrhage, microglia cells may contribute to injury and yet are crucial for remodeling and repair. Therapies that inhibit M1 activation or augment M2 activation would be beneficial for recovery (Taylor and Sansing, 2013). For neurodegenerative diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD), the switch from M2 to M1 microglial activation is believed to play an important role in disease progression. Therefore, the best treatment for these diseases should involve anti-inflammatory components (Rogers and et al., 2007; Varnum and Ikezu, 2012). For depression, the investigations of microglia are in the beginning and therefore the demonstration of a pathogenic role for microglial activation in depression is actually difficult. However, some indirect but converging evidence has already begun to emerge (Steiner and et al., 2011; Torres-Platas and et al., 2014). Steiner and et al. (2011) demonstrated an increased density of microglia positive for quinolinic acid, an N-methyl-D-aspartate (NMDA) glutamate receptor agonist produced and released by activated microglia in the brain by comparing depressed patients who committed suicide to healthy controls. Additionally, the ratio of primed over ramified (‘‘resting’’) microglia were proved to be significantly increased in the brain from depressed suicides (Torres-Platas and et al., 2014). These data implied that in depressed patients, the immune system seems to be over-activated, and this contributes to the development of depression (Miller et al., 2009; Krishnadas and Cavanagh, 2012), which may, at least in part, result from the massive M1 activation of microglia. The antidepressant efficacy of
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489
minocycline (Miyaoka and et al., 2012; Hinwood and et al., 2012; Arakawa and et al., 2012), which is suggested to selectively inhibit microglial M1, but not M2 activation (Kobayashi and et al., 2013), further supports the idea that microglia activation dysfunction plays an important role in the etiology of depression. However, up to date, the imbalance of microglial activation (M1 vs. M2) has not been examined in models of depression (Burke and et al., 2014). In addition, SSRIs have been shown to affect the immune system (Tuglu and et al., 2003; Basterzi and et al., 2005), and their modulating effect on microglia activation has recently gained attention. Consistent with most of previous studies, the present study demonstrated that both fluoxetine and S-citalopram can significantly reduce the expression and release of the pro-inflammation index of microglia (Hashioka and et al., 2007; Lim and et al., 2009; Horikawa and et al., 2010; Liu and et al., 2011; Lee and et al., 2011; Du et al., 2014). It also provided evidence for the anti-inflammation properties of SSRIs and suggested that SSRIs may exert neuro-protective ability by inhibiting the M1 activation of microglia. However, contrary results have also been presented in other studies. Ha et al. (2006) demonstrated that 1 lM fluoxetine significantly improved the release of NO and iNOS mRNA expression of ‘resting’ BV2 cells, which might indicate that fluoxetine could be responsible for the promotion effect on the M1 activation of microglia. However, in their experiment, the concentration of fluoxetine was much lower than the putative level of the SSRIs within brain tissue following therapeutic administration. Furthermore, in a diseased brain with an immune disorder, microglia are more likely to be activated rather than resting. Altogether, our experiments seem more comparable with the modulatory effect of SSRIs on microglia during their administration in depression. However, Ha et al.’s study may indicate that the regulating effect of fluoxetine on activation of microglia is concentration-dependent. The study of Tynan et al. also supported this idea (Tynan and et al., 2012). According to their results, fluoxetine, citalopram, sertraline, paroxetine and fluvoxamine at concentrations lower than 5 lM all significantly improved the production of TNFa in M1-activated microglia. Taken together, the immune modulation effects of SSRIs may be concentration-dependent, but in the process of treating depression, they may inhibit the M1 activation of microglia in CNS. These data suggest that the anti-inflammatory properties of SSRIs may partially mediate their neuro-protective and anti-depressant ability. M2-activated microglia are considered to reduce the damage to healthy tissues during the inflammation phase by playing an anti-inflammatory role. Additionally, M2-activated microglia also produce various growth factors to promote tissue repair (Colton and Wilcock, 2010). Accordingly, in a diseased brain, the enhancement of the M2 activation of microglia would be beneficial for recovery, and this has been proven in numerous diseases (Rogers and et al., 2007; Salemi and et al., 2011; Varnum and Ikezu, 2012; Taylor and Sansing, 2013; Rizzo and et al., 2014). For depression, no direct evidence supports a relationship between disease process and M2-activated
7
microglia, but a recent study gives some indication that this relationship may exist. Burke et al. proved that the antidepressant efficacy of minocycline is accomplished by the improvement of M2 activation of microglia in certain brain regions (Burke and et al., 2014). This finding implies that the promotion of M2 activation of microglia may be beneficial for recovery from depression. In the current study, we firstly demonstrated that fluoxetine and S-citalopram can both improve the M2 activation of microglia, especially at higher concentrations (60 lM). This finding indicates that the immune modulation effect of SSRIs also involves the improvement of M2 activation of microglia and that the immune modulation effect may also mediate the neuro-protective and antidepressant role of SSRIs. The cellular mechanism of how SSRIs affected the microglia activation was beyond the present study, but the changes of inflammatory agents could give us some implications. M1 stimuli such as LPS and IFN-c induce the activation of the transcription factors NF-jB (p65 and p50), activator protein 1 (AP-1), interferon regulatory factor 3 (IRF3) and signal transducers and activators of transcription 1 (STAT1) through the Tolllike receptor 4 (TLR4) and receptors for IFN, which leads to the transcription of genes of IL12p40, TNF, IL1b and IL-6 during M1-activating process. Fluoxetine and S-citalopram significantly inhibited LPS and IFN-c induced IL-1b secretion, but failed to decrease TNF-a expression. These results indicated that LPS and IFN-c induce IL-1b and TNF-a secretion from microglia through different pathways, while SSRIs may only block IL-1b production. Therefore, exploring the molecular mechanism of microglia activation, especially in the cytokine release could be helpful in understanding the anti-inflammatory effects of SSRIs. Meanwhile, fluoxetine and S-citalopram displayed different modulation effects on microglia activation and it is assumed that different SSRIs affect the M1 activation of microglia via the different cell signaling pathways, for example by elevating intracellular Ca2+ (Horikawa and et al., 2010), inhibiting inhibitory subunit of NF-kB (IkBa) degradation, restraining nuclear factor kB (NF-kB) Liu and et al., 2011, blocking protein kinase A (PKA) function Hashioka and et al., 2007 and up-regulating b-arrestin 2 expression (Du et al., 2014). And the differences were speculated to result from the different chemical structures of SSRIs. While for M2 activation, as the present study firstly investigated the effects of SSRIs on microglia M2 activation, the underlying mechanism is totally ill-defined so far. It is proven that M2 stimuli such as IL-4 and IL13 signals through IL-4 receptor-a to activate STAT6, which regulates the expressions of M2-activation genes such as suppressor of cytokine signaling 3 (SOCS3) and IL10. In addition to STAT pathway, a variety of other signaling molecules are important in regulating IL-4-induced anti-inflammation, such as SOCS-1, Fes tyrosine kinase and a number of phosphatases including SH2-containing inositol phosphatase (SHIP), SHP-1, and SHP-2 (Jiang et al., 2000). Moreover, IL-4 induced expression of peroxisome proliferator-activated receptor (PPAR)gamma, an important anti-inflammatory receptor was pro-
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550
NSC 16083
No. of Pages 9
28 February 2015
8
F. Su et al. / Neuroscience xxx (2015) xxx–xxx
592
ven in microglia (Kitamura and et al., 2000). Thus a complex interaction of signaling pathways and regulators was involved in the IL-4 induced microglia M2 activation and exploring the effects of SSRIs on these pathways may contribute to a better understanding of the pharmacological mechanism of SSRIs. However, it should be noted that several questions remain unsolved in this study. Firstly, even though it is reasonable to make measurement at 24 h when the variance of both protein and mRNA could be observed and a better comparability of the results could be gained at this time point, the temporal effect of treatment on gene and protein expression still needed to be paid great attention. And to better identify the effects of SSRIs on microglia activation, these indexes of inflammation should be tested at several time points in the future studies and the gene measurement should be done ahead of protein measurement. Secondly, the finding regarding TNFa release of primary microglia cells conflicted with previous studies, as we demonstrated that LPS + INFc did not significantly increase the TNFa production. In previous studies, LPS and INFc both significantly enhanced TNFa release (Colton and Wilcock, 2010), but they were generally used separately to induce the activation. In our study, the combination of LPS and INFc resulted in more intensive activation, and the rise of TNFa release may continue only a short time. Testing the inflammation indexes at several time points could also give a solution to this issue. Thirdly, differences of inflammatory indexes expressions also existed between the BV2 cells and primary microglia cells. This finding may imply that the cell properties changed and that they may not be an accurate model. Therefore, in vivo studies are needed to test the effect of SSRIs on microglia activation. Lastly and perhaps most importantly, the effects of SSRIs at different concentrations varied substantially, especially for M2 activation. We do not fully understand the meaning of this phenomenon, as the level of the SSRIs within brain tissue after successful treatment is still a matter of debate (Horikawa and et al., 2010). Pharmacokinetic experiments should give us more detailed information.
593
CONCLUSION
594
600
In summary, the SSRIs inhibited the LPS + INFcinduced M1 activation of microglia and promoted the IL4-induced M2 activation of microglia, suggesting that the therapeutic effects of SSRIs may be partially mediated by their effects of immune modulation, which involve in either in M1 inhibition or in M2 promotion effects.
601
CONFLICT OF INTEREST
551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591
595 596 597 598 599
602
The authors have no conflict of interests.
603
Acknowledgments—This work was supported by the National Nature Science Finding of China (31371074), National Science and Technology Major Projects (2012ZX09506-001-009), Clinical Medicine Science and Technology Project of Jiangsu Province (BL2013025, BL2014077), China Postdoctoral Science Founda-
604 605 606 607
tion (2103M531257) and Strategic Priority Research Program of Chinese Academy of Science (XDB02020002).
608
REFERENCES
610
Aloisi F (2001) Immune function of microglia. Glia 36(2):165–179. Arakawa S et al. (2012) Minocycline produced antidepressant-like effects on the learned helplessness rats with alterations in levels of monoamine in the amygdala and no changes in BDNF levels in the hippocampus at baseline. Pharmacol Biochem Behav 100(3):601–606. Barrientos RM et al. (2003) Brain-derived neurotrophic factor mRNA downregulation produced by social isolation is blocked by intrahippocampal interleukin-1 receptor antagonist. Neuroscience 121(4):847–853. Basterzi AD et al. (2005) IL-6 levels decrease with SSRI treatment in patients with major depression. Hum Psychopharmacol 20(7):473–476. Ben MO et al. (2008) Intrahippocampal transplantation of transgenic neural precursor cells overexpressing interleukin-1 receptor antagonist blocks chronic isolation-induced impairment in memory and neurogenesis. Neuropsychopharmacology 33(9):2251–2262. Burke NN et al. (2014) Minocycline modulates neuropathic pain behaviour and cortical M1–M2 microglial gene expression in a rat model of depression. Brain Behav Immun 42:147–156. Capuron L, Miller AH (2011) Immune system to brain signaling: neuropsychopharmacological implications. Pharmacol Ther 130(2):226–238. Colton C, Wilcock DM (2010) Assessing activation states in microglia. CNS Neurol Disord: Drug Targets 9(2):174–191. Dahl J et al. (2014) The plasma levels of various cytokines are increased during ongoing depression and are reduced to normal levels after recovery. Psychoneuroendocrinology 45:77–86. Dowlati Y et al. (2010) A meta-analysis of cytokines in major depression. Biol Psychiatry 67(5):446–457. Du RW, Du RH, Bu WG (2014) Beta-arrestin 2 mediates the antiinflammatory effects of fluoxetine in lipopolysaccharide-stimulated microglial cells. J Neuroimmune Pharmacol 9(4):582–590. Eyre HA, Stuart MJ, Baune BT (2014) A phase-specific neuroimmune model of clinical depression. Prog Neuropsychopharmacol Biol Psychiatry 54:265–274. Fujigaki H et al. (2006) The signal transducer and activator of transcription 1alpha and interferon regulatory factor 1 are not essential for the induction of indoleamine 2,3-dioxygenase by lipopolysaccharide: involvement of p38 mitogen-activated protein kinase and nuclear factor-kappaB pathways, and synergistic effect of several proinflammatory cytokines. J Biochem 139(4):655–662. Ha E et al. (2006) Fluoxetine increases the nitric oxide production via nuclear factor kappa B-mediated pathway in BV2 murine microglial cells. Neurosci Lett 397(3):185–189. Hannestad J, DellaGioia N, Bloch M (2011) The effect of antidepressant medication treatment on serum levels of inflammatory cytokines: a meta-analysis. Neuropsychopharmacology 36(12):2452–2459. Hashioka S et al. (2007) Antidepressants inhibit interferon-gammainduced microglial production of IL-6 and nitric oxide. Exp Neurol 206(1):33–42. Hinwood M et al. (2012) Evidence that microglia mediate the neurobiological effects of chronic psychological stress on the medial prefrontal cortex. Cereb Cortex 22(6):1442–1454. Horikawa H et al. (2010) Inhibitory effects of SSRIs on IFN-gamma induced microglial activation through the regulation of intracellular calcium. Prog Neuropsychopharmacol Biol Psychiatry 34(7):1306–1316. Hu F, Pace TW, Miller AH (2009) Interferon-alpha inhibits glucocorticoid receptor-mediated gene transcription via STAT5
611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
609
NSC 16083
No. of Pages 9
28 February 2015
F. Su et al. / Neuroscience xxx (2015) xxx–xxx 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 762 763 764
activation in mouse HT22 cells. Brain Behav Immun 23(4):455–463. Iosif RE et al. (2006) Tumor necrosis factor receptor 1 is a negative regulator of progenitor proliferation in adult hippocampal neurogenesis. J Neurosci 26(38):9703–9712. Jiang H, Harris MB, Rothman P (2000) IL-4/IL-13 signaling beyond JAK/STAT. J Allergy Clin Immunol 105(6 Pt. 1):1063–1070. Kettenmann H et al. (2011) Physiology of microglia. Physiol Rev 91(2):461–553. Kitamura Y et al. (2000) Interleukin-4-inhibited mRNA expression in mixed rat glial and in isolated microglial cultures. J Neuroimmunol 106(1–2):95–104. Kobayashi K et al. (2013) Minocycline selectively inhibits M1 polarization of microglia. Cell Death Dis 4:e525. Krishnadas R, Cavanagh J (2012) Depression: an inflammatory illness? J Neurol Neurosurg Psychiatry 83(5):495–502. Lee CH et al. (2011) Pre- and post-treatments with escitalopram protect against experimental ischemic neuronal damage via regulation of BDNF expression and oxidative stress. Exp Neurol 229(2):450–459. Lim CM et al. (2009) Fluoxetine affords robust neuroprotection in the postischemic brain via its anti-inflammatory effect. J Neurosci Res 87(4):1037–1045. Liu D et al. (2011) Anti-inflammatory effects of fluoxetine in lipopolysaccharide (LPS)-stimulated microglial cells. Neuropharmacology 61(4):592–599. Lo FS et al. (2010) Outcome of psychiatric symptoms presenting at onset of multiple sclerosis: a retrospective study. Mult Scler 16(6):742–748. Miller AH, Pariante CM, Pearce BD (1999) Effects of cytokines on glucocorticoid receptor expression and function. Glucocorticoid resistance and relevance to depression. Adv Exp Med Biol 461:107–116. Miller AH, Maletic V, Raison CL (2009) Inflammation and its discontents: the role of cytokines in the pathophysiology of major depression. Biol Psychiatry 65(9):732–741. Miyaoka T et al. (2012) Minocycline as adjunctive therapy for patients with unipolar psychotic depression: an open-label study. Prog Neuropsychopharmacol Biol Psychiatry 37(2):222–226. Nimmerjahn A, Kirchhoff F, Helmchen F (2005) Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 308(5726):1314–1318. Raison CL, Miller AH (2011) Is depression an inflammatory disorder? Curr Psychiatry Rep 13(6):467–475.
9
Rizzo F et al. (2014) Cellular therapy to target neuroinflammation in amyotrophic lateral sclerosis. Cell Mol Life Sci 71(6):999–1015. Rogers J et al. (2007) Neuroinflammation in Alzheimer’s disease and Parkinson’s disease: are microglia pathogenic in either disorder? Int Rev Neurobiol 82:235–246. Roumestan C et al. (2007) Anti-inflammatory properties of desipramine and fluoxetine. Respir Res 8:35. Saijo K, Glass CK (2011) Microglial cell origin and phenotypes in health and disease. Nat Rev Immunol 11(11):775–787. Salemi J et al. (2011) Flipping the switches: CD40 and CD45 modulation of microglial activation states in HIV associated dementia (HAD). Mol Neurodegener 6(1):3. Steiner J et al. (2011) Severe depression is associated with increased microglial quinolinic acid in subregions of the anterior cingulate gyrus: evidence for an immune-modulated glutamatergic neurotransmission? J Neuroinflammation 8:94. Taylor RA, Sansing LH (2013) Microglial responses after ischemic stroke and intracerebral hemorrhage. Clin Dev Immunol 2013:746068. Torres-Platas SG et al. (2014) Evidence for increased microglial priming and macrophage recruitment in the dorsal anterior cingulate white matter of depressed suicides. Brain Behav Immun 42:50–59. Tuglu C et al. (2003) Increased serum tumor necrosis factor-alpha levels and treatment response in major depressive disorder. Psychopharmacology 170(4):429–433. Tynan RJ et al. (2012) A comparative examination of the antiinflammatory effects of SSRI and SNRI antidepressants on LPS stimulated microglia. Brain Behav Immun 26(3):469–479. Varnum MM, Ikezu T (2012) The classification of microglial activation phenotypes on neurodegeneration and regeneration in Alzheimer’s disease brain. Arch Immunol Ther Exp (Warsz) 60(4):251–266. Wichers M, Maes M (2002) The psychoneuroimmunopathophysiology of cytokine-induced depression in humans. Int J Neuropsychopharmacol 5(4):375–388. Yang W et al. (2004) Altered RNA editing of serotonin 5-HT2C receptor induced by interferon: implications for depression associated with cytokine therapy. Brain Res Mol Brain Res 124(1):70–78. Zhu CB, Blakely RD, Hewlett WA (2006) The proinflammatory cytokines interleukin-1beta and tumor necrosis factor-alpha activate serotonin transporters. Neuropsychopharmacology 31(10):2121–2131.
(Accepted 13 February 2015) (Available online xxxx)
Please cite this article in press as: Su F et al. Fluoxetine and S-citalopram inhibit M1 activation and promote M2 activation of microglia in vitro. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.02.028
718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761