- Email: [email protected]
Fluvoxamine maleate normalizes striatal neuronal inflammatory cytokine activity in a Parkinsonian rat model associated with depression
Behavioural Brain Research 316 (2017) 189–196
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Fluvoxamine maleate normalizes striatal neuronal inflammatory cytokine activity in a Parkinsonian rat model associated with depression Ernest Dallé, Willie M.U. Daniels, Musa V. Mabandla ∗ School of Laboratory Medicine and Medical Sciences, College of Health Sciences, University of KwaZulu-Natal, Durban 4000, South Africa
h i g h l i g h t s • Early maternal separation caused anhedonia and exacerbated the effects of 6-OHDA in lesioned rats. • Fluvoxamine reversed the effects of 6-OHDA lesion by modulating cytokine gene expression in the striatum of treated rats. • Fluvoxamine normalized pro- and anti-inflammatory cytokine expression in the striatum of treated rat.
a r t i c l e
i n f o
Article history: Received 8 June 2016 Received in revised form 1 August 2016 Accepted 3 August 2016 Available online 25 August 2016 Keywords: Fluvoxamine maleate Depression Inflammatory cytokines Striatum Parkinson’s disease
a b s t r a c t Cytokine dysfunction is associated with both depression and Parkinson’s disease (PD) pathophysiology. Inflammatory cytokines in neural and behavioral processes are involved in the production and/or maintenance of depression in PD. In this study we looked at how Fluvoxamine treatment regulates depressive-like signs, motor impairments and the expression of IL-1, IL-6, TNF-␣, TGF- and IL-10 cytokines in the striatum of a stressed Parkinsonian rat model. Early maternal separation was used to model stress and depressive-like signs in rats. Maternally separated adult rats were treated with Fluvoxamine for 30 days prior to 6-hydroxydopamine (6-OHDA) lesion. The sucrose preference test (SPT) and the limb-use asymmetry test (cylinder test) were used to evaluate anhedonia and motor impairments respectively. Lipid peroxidation and cytokine expression were measured in striatal tissue using ELISA and real-time PCR techniques respectively. Our results show that maternal separation resulted in anhedonia and exacerbated 6-OHDA lesion but Fluvoxamine treatment attenuated these effects. Lipid peroxidation, mRNA levels of IL-1, IL-6 and TNF-␣ were down-regulated while IL-10 and TGF- levels were up-regulated in the lesioned striatum of Fluvoxamine treated rats. This study shows that early treatment with Fluvoxamine may attenuate inflammation on injured striatal neurons by favoring antiinflammatory cytokine expression while decreasing pro-inflammatory cytokine release in the brain. This suggests a role of Fluvoxamine as a potential therapeutic intervention targeting neuronal inflammation associated with PD. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Early exposure to emotional stress such as maternal separation has been shown to cause long-term neurochemical and behavioral changes later in life [1]. These changes include depression, a psychiatric disorder commonly encountered non-motor features of Parkinson’s disease (PD) [2]. The estimated prevalence of depression in PD is between 40–50% in all PD cases [3]. This high
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (M.V. Mabandla). http://dx.doi.org/10.1016/j.bbr.2016.08.005 0166-4328/© 2016 Elsevier B.V. All rights reserved.
prevalence of depression in PD has prompted the idea that degenerated nigrostriatal system may play a key role in depression [4]. The pathophysiology of PD also includes the presence of ␣-synuclein-containing aggregates in the substantia nigra pars compacta (SNpc) which may suggest the activation of glial cells and dysfunction in pro and/or anti-inflammatory factor levels common in PD associated with depression [5,6]. For instance, the chronic release of pro-inflammatory cytokines by activated astrocytes and microglia (the resident innate immune cells) leads to the exacerbation of DA neuron degeneration in the SNpc [6,7]. Antiinflammatory cytokines may also inhibit microglial activation by reducing reactive oxygen species which can be evaluated via lipid
190
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
peroxidation levels [8]. Moreover, at a cellular level, cytokines are expressed in microglia and play a critical role on neuron-microglia interactions in the regulation of neuroinflammation in both depression and PD [6,9]. Studies have shown that there are high levels of pro-inflammatory cytokines (tumor necrosis factor (TNF)-␣, interleukin (IL)-1, IL-6) and lower levels of anti-inflammatory cytokines (transforming growth factor (TGF)-, IL-10) in the midbrain of patients with depression and PD [3,6,10]. This strongly suggests the involvement of these immune components in PD pathogenesis associated with depression. Studies have shown that in a 6-OHDA lesioned animal model of PD, cytokine dysfunction may result in increased DA cell death rate in the striatum [6,9,11]. However, a better understanding of the role of inflammation caused by any stressor and treated with an antidepressant is still lacking. An animal model that mimic depressive-like signs and motor deficits of PD may be useful in establishing effective therapeutic strategies on the pathological processes of the depression in PD. Fluvoxamine, a selective serotonin reuptake inhibitor (SSRI) is one of the antidepressants commonly used as first line treatment for major depressive disorders [12,13]. Studies have shown that antidepressants may possess potent anti-inflammatory effects which attenuate cytokine expression by inhibiting infiltration of peripheral immune cells, blocking glial activation to reduce oxidative stress [14,15]. However, little is known about the effects of Fluvoxamine in the central nervous system, especially in the nigrostriatal DA system in the context of PD associated with depression. In an animal model of PD, the generation of free radicals can suggest an increase in pro-inflammatory cytokines along with decreased anti-inflammatory molecules in the striatum [8,16,17]. These observations may suggest that depression in PD is similar to a psychoneuroimmunological disorder where the increase in neuronal pro-inflammatory cytokines is likely to result in adverse consequences on functional activity of the neurochemical system implicated in the symptoms of the disorder. Therefore, in this study, we aimed to investigate whether early exposure to maternal separation may exacerbate neuronal inflammation. We further looked at the effects of Fluvoxamine exerted in the expression of pro-inflammatory cytokines (neurotoxic factors) and anti-inflammatory cytokines (neuroprotective molecules) in a PD rat model.
2. Materials and methods The experimental protocol (Fig. A) used in this study was reviewed and approved by the Animal Research Ethics Committee of the University of KwaZulu-Natal (018/15/Animal). The sample size was set according to previous studies where the statistical power was shown [18–20]. A total of 40 male Sprague-Dawley (SD) rats obtained from the Biomedical Resource Unit of the University of KwaZulu-Natal were used in this study. They were housed in polypropylene cages (38 × 32 × 16 cm) under controlled temperature (21 ± 2 ◦ C) and humidity (55–60%). Food and water were freely available. The daily light/dark cycle was 07:00 to 19:00 [21]. On post-natal day (PND) 1, the rats were sexed and culled to 6 male pups per litter. The rats were randomly divided into two equal groups as follows: normally reared (NS) and maternally separated (MS). The rats were weaned on PND 21 after which they were kept 6 per cage [21]. On PND 29, the groups were subdivided into 2 groups as follows: (1) normally reared pre-lesion treated (NSF: treated with Fluvoxamine from PND 29 – 59) and (2) maternally separated pre-lesion treated (MSF: treated with Fluvoxamine from PND 29 – 59). Lesion refers to the intracerebral injection of the neurotoxin 6-hydroxydopamine (6-OHDA) on PND 60 in all groups. Anhedonia was assessed on PND 28, 58 and 74 using the sucrose preference
test (SPT) [22]. Limb-use asymmetry was assessed on PND 58 and 75 using the cylinder test [21]. All rats were sacrificed on PND 76. All experimental procedures were conducted between 09:00 to 16:00. The animals were weighed prior to all experiments and were brought to the experimental room 1 h before experimentation [1,21]. 2.1. Drugs and reagents The drug Fluvoxamine is manufactured by Pharmed Pharmaceuticals LTD (Rochdale Park, Durban, South Africa). Desipramine (D3900), atropine, pentobarbital and 6-OHDA-HCL were purchased from Sigma (St. Louis MO, USA). Temgesic and Biotane were obtained from Pharmed Pharmaceuticals LTD (Rochdale Park, Durban, South Africa). The lipid peroxidation (MDA) assay kit (K739-100) was obtained from BioVision (Mountain view, CA, USA). Real-time PCR kits were purchased from BioRad Laboratories (CA, USA). 2.2. Maternal separation Maternal separation took place from PND 2 – 14. The maternal separation stress protocol was based on previous studies [20,21,23]. Briefly, the pups were taken away from their dams and kept in a separate room for 3 h (09:00–12:00) once a day. All normally reared pups were left undisturbed with their dams. 2.3. Behavioral tests Behavioral tests were set to assess the effect of Fluvoxamine in attenuating depressive-like signs in a rat model of depression as well as to assess the effects of the drug on motor dysfunction in a Parkinsonian rat model. The behavioral tests included the sucrose preference test (SPT) and the limb-use asymmetry test (cylinder test). The tests were performed pre- as well as post-lesion with 6-OHDA. 2.4. The sucrose preference test (SPT) The SPT was conducted over a 24 h period (9:00 a.m. to 9:00 a.m.) on PND 28, 58 and 74. A day prior to the test, the rats were weighed and placed in separate cages for a 24 h training period. The training phase consisted of placing two bottles of water preweighed, on opposite sides of the cage [24,25]. After the 24 h had elapsed, one bottle was replaced with one containing 2.5% sucrose solution. For the test phase, the two bottles (one containing tap water and the other containing 2.5% sucrose solution) were placed such that the bottle containing tap water was on the left side and the sucrose containing on the right. After 24 h, the bottles were weighed to determine consumption in grams (converted to ml). The sucrose preference ratio was calculated as a volume of sucrose drunk over the total fluid consumed (sucrose + water). A decreased amount of sucrose solution drunk is suggestive of anhedonia thus of depressive-like behavior [22,24]. 2.5. The limb-use asymmetry test (cylinder test) The cylinder test device was similar to the one described by [21] that consists of a transparent plexiglass cylinder of 20 cm in diameter and 30 cm in height. The test was conducted on PND 59 and 75. For Limb-use during exploratory activity (touching the wall of the cylinder and landing), each animal was scored over a 5 min period. The test was video-recorded using a camera and manually analyzed by an evaluator blind to the study. The animals were assessed for percentage limb-use of the impaired (contralateral) limb by using the following equation: % limb use of impaired = [(impaired + ½
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
191
Table 1 Nucleotide sequence of forward and reverse primers for real-time-PCR. Target mRNA bases
Forward primer
Reverse primer
IL-1 IL-6 TNF-␣ IL-10 TGF- -actin
CCCTGCAGCTGGAGAGTGTGG CGAGCCCACCAGGAACGAAAGTC GACCCTCACACTCAGATCATCTTCT TGCTACGACGTGGGCTACG GCGAGCGAAGCGACGAGGAG CTGGAACGGTGAAGGTGACA
TGTGCTCTGCTTGAGAGGTGCT CTGGCTGGAAGTCTCTTGCGGAG TGCTACGACGTGGGCTACG TGCAGTCCAGTAGATGCCGGG TGGGCGGGATGGCATCAAGGTA GGGACTTCCTGTAACAATGCA
both)/(impaired + unimpaired + both)] × 100. Impaired refers to the limb contralateral to the lesioned hemisphere. Both, refers to the use of both the impaired and unimpaired limbs during exploratory activity [26]. As the intracerebral infusion of 6-OHDA was done in the left hemisphere, a successful model of Parkinsonism would result in a bias towards left forelimb use after lesion as compared to before lesion [21,26]. 2.6. Fluvoxamine treatment Prior to treatment, the animals were weighed and the volume of Fluvoxamine to be injected (1 ml/250 g of body weight) was calculated accordingly. Fluvoxamine was freshly prepared by dissolving in saline after which it was intraperitoneally (i.p) injected (25 mg/kg) [12,27]. 2.7. Hemiparkinsonian rat model (6-OHDA lesion) Thirty minutes prior to 6-OHDA HCl infusion, desipramine HCl (15 mg/kg, i.p) a norepinephrine reuptake blocker was injected to inhibit 6-OHDA uptake by noradrenergic neurons [19] and [28]. The rats were anaesthetized with sodium pentobarbital (60 mg/kg, i.p) followed by an atropine (0.2 mg/kg, i.p) injection to facilitate respiration while unconscious. The head of the animal was shaved and positioned firmly in the stereotaxic apparatus (David Kopf Instruments, Tujunga CA, USA). The skin covering the scalp was disinfected with Biotane and a midline incision was made to expose the skull. At the following coordinates: anterior-posterior (AP) = +4.7 mm anterior to lambda; medio-lateral (ML) = +1.6 mm from midline suture; and DV = −8.4 mm ventral to dura, a hole was drilled in the skull [29]. At these coordinates, a Hamilton syringe was used to inject a preclinical dose of 6-OHDA HCl (5 g/4 l) dissolved in 0.2% ascorbic acid into the left MFB over a period of 8 min. The needle was kept in the MFB for 1 min prior to the injection and for 2 min following the injection to maximize diffusion. The incision was sutured and cleaned and the animals were placed under a heating lamp to prevent hypothermia during recovery. Animals were thereafter injected with Temgesic (0.05 mg/kg subcutaneously) a post-operative analgesic before being returned to their home cages. 2.8. Decapitation and neurochemistry All rats were euthanized on PND 76 by guillotine. Striatal tissue dissected within a minute of decapitation was collected, weighed and placed in Eppendorf tubes prior to freezing in liquid nitrogen and storage at −80 ◦ C in a bio-freezer. 2.9. Lipid peroxidation Lipid peroxidation (Malondialdehyde) quantification as a measure of oxidative stress was evaluated in the striatum of all rats (n = 6/group) according to [30] and the manufacturer’s protocol. Briefly, striatal tissue was homogenized with a sonicator (CML-4, Fisher, USA) on ice in 300 l of the Malondialdehyde (MDA) lysis buffer then centrifuged at 13000 rpm for 10 min. The supernatant (200 l) from each homogenized sample was thereafter pipetted
Fig. 1. Sucrose preference in all rats assessed on PND 28. **(NS water vs NS sucrose, p = 0.0053), **(MS water vs MS sucrose, p = 0.0027) and ***(NS sucrose vs MS sucrose, p < 0.0001). Paired t-tests. Values are expressed as mean ± SEM (n = 20/group).
into a microcentrifuge tube. To prepare standards, 10 l of MDA standard was diluted with 407 l of bidistilled water to prepare a solution of 0.1 M of MDA, then 20 l of 0.1 M MDA solution was diluted with 980 l of bidistilled water to prepare a 2 mM MDA standard. Into standard and sample vials, 600 l of Thiobarbituric acid (TBA) solution was added and incubated for 1 h in a water bath at 95 ◦ C. Standards and control vials were allowed to cool at room temperature for 10 min and thereafter 200 l from each standard and sample was pipetted in duplicate into a 96-well microplate. Absorbance was read at 532 nm using a spectrophotometer (Spectrostar Nano BMG LABTECH, Germany). 2.10. Real-time PCR On the day of analysis, 60 mg of striatal tissue was weighed out (n = 6/group), homogenized and suspended in 400 l of lysis buffer (Zymo Research, USA). Thereafter, samples were manually homogenized using a sterile blade and total RNA isolation was carried out as per manufacturer’s protocol (ZR RNA MiniPrepTM , USA). Purification of RNA isolates were assessed using a NanoDrop. Purity of 1.8–2.01 was recommended for use in the construction of cDNA. The cDNA synthesis was carried out using the iScriptTM cDNA Synthesis Kit (BioRad, South Africa) and run through the Thermocycler according to conditions stipulated in the protocol. The Fast start SYBR green kit (Roche Diagnostics, USA) was used in accordance to the manufacturer’s guidelines. The primers (Table 1) used for all the assayed genes were designed by Inqaba Biotech (Pretoria, South Africa). Primer sequences were reconstituted in RNA nuclease free water according to the manufacturer’s report and were added to a master mix comprising of SYBR green dye, nuclease free H2 O and MgCl2 . Thereafter cDNA was added into glass capillaries and run in the Lightcycler 480 at optimized conditions. -actin gene was used as the internal control. 2.11. Statistical analysis All results are presented as mean ± SEM. The data was analyzed using the software program GraphPad Prism (version 5.0, San Diego, California, USA). The Shapiro-Wilk test was used to test for normality of distribution and where data met requirements,
192
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
Fig. 2. Effect of Fluvoxamine treatment on sucrose preference in all rats assessed on PND 58. ***(NS vs MS, p < 0.0001, paired t-test), ***(MS vs MSF, F (3, 36) = 15.61, p < 0.0001, one-way ANOVA). Values are expressed as mean ± SEM (n = 10/group).
parametric or non-parametric tests were used. The main factors in each analysis included stress and treatment. When measuring only one variable (stress versus non-stressed), paired t-test was used for analysis. One-way analysis of variance (ANOVA) was used on behavioral, lipid peroxidation and gene data analysis. In each analysis, significant main effect was followed by Newman-Keuls post hoc test. p < 0.05 was considered significant in all analysis.
Fig. A. Outline of experimental protocol. All stressed groups were maternally separated from PND 2–14. All groups were weaned on PND 21. The pre-lesion animals were treated from PND 29 – 59. The animals were assessed for anhedonia using the sucrose preference test (SPT) on PND 28, 58 and 74 and for motor impairments on PND 59 and 75. All animals were lesion on PND 60 and were sacrificed on PND 76.NS: normally reared. NSF: normally reared pre-lesion treated with FM. MS: maternally separated. MSF: maternally separated pre-lesion treated with FM. SPT: sucrose preference test.
Fig. 3. Effect of Fluvoxamine treatment on sucrose preference in 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 74. *(NS vs MS, p = 0.0125, paired t-test) and ***(MS vs MSF, F (3, 36) = 19.415, p < 0.0001, one-way ANOVA). Values are expressed as mean ± SEM (n = 10/group).
3.2. Cylinder test Asymmetry of in forelimb use was assessed in all rats on PND 58 and PND 75. Prior to 6-OHDA lesion (PND 58), no asymmetry was evident in all the rats (Data not shown). On PND 75, a stress effect was evident as 6-OHDA lesion in these rats resulted in decreased use of the right (impaired) forelimb
when touching the wall of the cylinder *(NS vs MS, p = 0.0398). A treatment effect was present as pre-lesion treatment with Fluvoxamine attenuated forelimb use asymmetry caused by the 6-OHDA lesion in both the non-stressed and maternally separated rats [F (3, 36) = 7.709, p = 0.0004]. Data presented in Fig. 4. Significant main effects of stress and Fluvoxamine treatment with respect to the use of the right (impaired) forelimb for landing was observed **(NS vs MS, p = 0.0085) and [F (3, 36) = 10.56, p < 0.0001]. Data presented in Fig. 5. 3.3. Lipid peroxidation
3. Results
A stress effect was evident in the maternally separated (MS) rats resulting in higher levels of lipid peroxidation *(NS vs MS,
3.1. Sucrose preference test (SPT) In the SPT conducted on PND 28, non-stressed (NS) rats favored drinking the sucrose solution (**p = 0.0053) than water. However, maternally separated (MS) rats preferred drinking tap water (**p = 0.0027) than the sucrose solution. Overall, there was a stress effect as maternally separated rats drunk less sucrose solution than non-stressed rats (***p < 0.0001). Data presented in Fig. 1. On PND 58, stressed rats showed less preference for sucrose than non-stressed rats ***(NS vs MS, p < 0.0001). A treatment effect in the MSF rats was evident ***(MS vs MSF, F (3, 56) = 15.61, p < 0.0001, one-way ANOVA). Data presented in Fig. 2. This was also the case on PND 74 where a stress effect *(NS vs MS, p = 0.0125) was evident. Fluvoxamine treatment resulted in greater sucrose consumption in the maternally separated rats ***(MS vs MSF (S), F (3, 36) = 19.415, p < 0.0001, one-way ANOVA). Data presented in Fig. 3.
Fig. 4. Number of times the rat used the impaired (right) forelimb to touch the wall of the cylinder expressed as a percentage of the total number of times it touched the wall of the cylinder on PND 75. All groups were lesioned with 6-OHDA on PND 60. *(NS vs MS, p = 0.0398, paired t-test) and [F (3, 36) = 7.709, p = 0.0004, one-way ANOVA]. Values are expressed as mean ± SEM (n = 10/group).
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
Fig. 5. Number of times the rat used the impaired (right) forelimb to land on the floor expressed as a percentage of the total number of times it landed on the floor of the cylinder on PND 75. All groups were lesioned with 6-OHDA on PND 60. **(NS vs MS, p = 0.0085, paired t-test) and [F (3, 36) = 10.56, p < 0.0001, one-way ANOVA]. Values are expressed as mean ± SEM (n = 10/group).
193
Fig. 8b). We also found a Fluvoxamine treatment effect in both nonstressed and maternally separated rats [F (3, 20) = 10.69, p = 0.0002, Fig. 8b]. The ratio of pro-inflammatory versus anti-inflammatory cytokine mRNA expression was assessed in the striatum of the rats (Fig. 9). Fig. 9a shows that the ratios of TNF-␣ to IL-10 in the striatum of maternally separated rats were higher than that of non-stressed rats but the pre-lesion treatment with Fluvoxamine reversed this effect. ***(MS TNF-␣ vs MS IL-10, p < 0.0001), **(NSF TNF-␣ vs NSF IL-10, p = 0.0031) and **(MSF TNF-␣ vs MSF IL-10, p = 0.0051). Similarly, in Fig. 9b, the ratios of IL-1 to IL-10 in the striatum of maternally separated rats were higher than that of the non-stressed rats and was reversed by the pre-lesion treatment with Fluvoxamine. ***(MS IL-1 vs MS IL-10, p = 0.0006), ***(NSF IL-1 vs NSF IL-10, p = 0.0003) and *(MSF IL-1 vs MSF IL-10, p = 0.0198).
4. Discussion
Fig. 6. Effect of Fluvoxamine treatment on striatal lipid peroxidation levels in 6OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. *(NS vs MS, p = 0.0370, paired t-test) and [F (3, 20) = 4.210, p = 0.0184, one-way ANOVA]. Values are expressed as mean ± SEM (n = 6/group).
p = 0.0370). Fluvoxamine treatment attenuated lipid peroxidation in the maternally separated rats [F (3, 20) = 4.210, p = 0.0184]. Data presented in Fig. 6. 3.4. Cytokine gene expression Pro-inflammatory cytokine mRNA expression is shown in Fig. 7. A stress effect on IL-1 mRNA expression was found as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls *(NS vs MS, p = 0.0249, Fig. 7a). A Fluvoxamine treatment effect was found as IL-1 mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 11.13, p = 0.0002, Fig. 7a]. We found a stress effect on IL-6 mRNA expression as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls **(NS vs MS, p = 0.0049, Fig. 7b). A Fluvoxamine treatment effect was found as IL-1 mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 21.53, p < 0.0001, Fig. 7b]. Similarly, a stress effect on TNF-␣ mRNA expression was found as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls ***(NS vs MS, p = 0.0001, Fig. 7c). A Fluvoxamine treatment effect was also found as TNF-␣ mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 15.00, p < 0.0001, Fig. 7c]. Anti-inflammatory cytokine mRNA expression is shown in Fig. 8. A stress effect on IL-10 mRNA expression was found as this cytokine expression was decreased in the striatum of maternally separated rats when compared to controls *(NS vs MS, p = 0.0236, Fig. 8a). A Fluvoxamine treatment effect was found in both non-stressed and maternally separated rats [F (3, 20) = 11.28, p = 0.0002, Fig. 8a]. Similarly, a stress effect on TGF- mRNA expression was found as this cytokine expression was decreased in the striatum of maternally separated rats when compared to controls **(NS vs MS, p = 0.0019,
In this study we investigated how early exposure to maternal separation leading to depressive-like signs may exacerbate 6-OHDA lesion. We further looked at the effect of Fluvoxamine treatment on pro- and anti-inflammatory cytokine gene expression and whether any effects present are mediated by the expression of these genes in a parkinsonian rat model. The SPT results showed that early maternal separation induced behavioral changes that may be regarded as depressive-like signs including reduction of preference for sucrose solution. On PND 28, 58 and 74, we found that maternally separated (MS) rats consumed less sucrose solution than non-stressed (NS) rats suggesting a prolonged stress effect. These results agreed with previous studies and confirmed that early stressful experience causes anhedonia (a core symptom of depression in rodent) and favor the development of depression later in life [31–34]. Our results also showed that pre-lesion treatment with Fluvoxamine increased sucrose preference in maternally separated rats in agreement with previous studies on the effects of antidepressants [35–37]. [38] have shown that depression can alter serotonergic, dopaminergic or noradrenergic neurotransmitters and that rats with depressive-like signs may use drug to self-medicate. We postulated that maternal separation reduced 5-hydroxytryptaminergic transmission which resulted in depressive-like signs [39]. To relieve depression, SSRI medications act by blocking serotonin transporter such that extracellular serotonin levels are increased thereby enhancing 5hydroxytryptaminergic transmission [39]. In our model, the rats were exposed to Fluvoxamine treatment for 30 days allowing the drug to reduce the stress effects while relieving depressive-like signs in a time dependent manner [34,36,39,40]. Besides the ameliorative effect of Fluvoxamine treatment on depressive-like signs, the induction of a 6-OHDA lesion exposed the neuroprotective capability of the drug in all rats. The cylinder test results before 6-OHDA injection did not show asymmetry in preferred forelimb use (Data not shown). However, post 6OHDA injection, our results showed a preference to use the right (impaired) forelimb in touching the plexiglass cylinder or in landing in non-stressed (NS) and maternally separated (MS) rats. These results suggest a 6-OHDA lesion effect in these rats in agreement with previous findings that showed that a unilateral 6-OHDA lesion causes forelimb use asymmetry [23,41,42]. Moreover, our results confirmed that 6-OHDA lesion is exacerbated by early maternal separation [20,23]. Interestingly, we also found a treatment effect in both non-stressed and stressed animals suggesting an amelioration of the 6-OHDA effect on impaired limb use. To our knowledge, this finding is the first that shows that Fluvoxamine treatment attenuates 6-OHDA lesion in a rat. However, since motor impairment usually results from an increase in tonic inhibition of the
194
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
neurons in the thalamocortical area of the brain, we postulated that Fluvoxamine may have attenuated the impairment by promoting adaptive changes in the substantia nigra [41,43,44]. It has been shown that in rat frontal cortex, adaptive changes caused by
Fluvoxamine may involve the functionality/sensitivity of serotonin auto-receptors and post-synaptic receptors [39]. Since it is possible that serotonin receptors activate dopamine receptors, in our rat model, the adaptive changes may have involved serotonin hyper-
Fig. 7. Effect of Fluvoxamine treatment on pro-inflammatory cytokines gene expression in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. The levels of IL-1, IL-6 and TNF-␣ mRNAs were determined using real-time PCR. a, b and c show normalized expression of each gene by the pre-lesion treatment with Fluvoxamine. In a, *(NS vs MS, p = 0.0249, paired t-test) and [F (3, 20) = 11.13, p = 0.0002, one-way ANOVA]. In b, **(NS vs MS, p = 0.0049, paired t-test) and [F (3,20) = 21.53, p < 0.0001, one-way ANOVA]. In c, ***(NS vs MS, p = 0.0001, paired t-test) and [F (3, 20) = 15.00, p < 0.0001,one-way ANOVA].Values are expressed as mean ± SEM (n = 6/group).
Fig. 8. Effect of Fluvoxamine treatment on anti-inflammatory cytokines gene expression in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. The levels of IL-10 and TGF- mRNAs were determined using Real-time PCR. a and b show normalized expression of each gene by the pre-lesion treatment with Fluvoxamine. In a, *(NS vs MS, p = 0.0236, paired t-test) and [F (3, 20) = 11.28, p = 0.0002, one-way ANOVA]. In b, **(NS vs MS, p = 0.0019, paired t-test) and [F (3, 20) = 10.69, p = 0.0002, one-way ANOVA]. Values are expressed as mean ± SEM (n = 6/group).
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
195
[3,10]. Similarly, mRNA levels of the anti-inflammatory cytokines IL-10 and TGF- were decreased in the striatum of maternally separated rats. This was also in agreement with previous studies [3,10]. In addition, we found that pre-lesion treatment with Fluvoxamine remarkably reversed the pro- and anti-inflammatory cytokine expression in the striatum of both non-stressed and stressed rats. Studies have shown that an imbalance in pro- and antiinflammatory cytokine expression in favor of pro-inflammatory is known to cause long-lasting changes in brain function and may be restored by antidepressant treatment [53,54]. A study on the effects of paroxetine in a MPTP-induced increase of inflammatory molecules in a model of PD showed potential to attenuate the neurotoxin effect through blockade of glial activation thus its neuroprotective capability [15]. The antidepressant paroxetine was able to modulate expression of inflammatory molecules within activated microglia after the neurotoxin injection thereby rescuing nigral dopamine neurons [15]. It is possible that the pre-lesion treatment with Fluvoxamine had similar effect, blocking microglial activation so as to provide protection against stress-induced free radical production thus the normalization of cytokine expression in pre-lesion treated rats. However, the normalization capability of Fluvoxamine is time dependent therefore may be optimized when the treatment is initiated as a prophylactic drug to prevent neuronal cell death in a neurodegenerative disease such as PD. 5. Conclusion Fig. 9. Effect of Fluvoxamine treatment on the ratios TNF-␣/IL-10 and IL-1/Il-10 in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats. In a, ***(MS TNF-␣ vs MS IL-10, p < 0.0001), **(NSF TNF-␣ vs NSF IL-10, p = 0.0031), and **(MSF TNF-␣ vs MSF IL-10, p = 0.0051). In b, ***(MS IL-1 vs MS IL-10, p = 0.0006), ***(NSF IL-1 vs NSF IL-10, p = 0.0003) and *(MSF IL-1 vs MSF IL-10, p = 0.0198). Paired t-tests. Values are expressed as mean ± SEM (n = 6/group).
innervation resulting in an attenuation of the effects of lesion [45]. Therefore, Fluvoxamine may have acted as an agonist drug that can increase neurons tonicity so as to relieve parkinsonian symptoms. A marker of lipid peroxidation (MDA) was measured in the striatum so as to assess an aspect of stress-associated production of reactive oxygen species [46]. Our results showed that maternally separated rats had higher lipid peroxidation levels than nonstressed (NS) rats. These results agreed with [47,48] who showed that chronic stress could elevate lipid peroxidation in the striatum due to catecholamine metabolism (DA, norepinephrine) that undergo auto-oxidation. However, we also found that pre-lesion treatment with Fluvoxamine reduced lipid peroxidation in maternally separated rats. Antidepressant drugs including Fluvoxamine have been reported to possess antioxidant capacity by decreasing circulating free radicals [49,50,51]. As 6-OHDA injection did not results in increased levels of lipid peroxidation, this suggests that pre-lesion treatment with Fluvoxamine may prevent loss of nigrostriatal neurons by inhibiting neural inflammation and/or oxidative stress thus indirectly acting as a neuroprotective drug. Furthermore, we postulated that Fluvoxamine treatment may have blocked the toxic effects of the lesion by inhibiting the activation of microglia in the striatum which usually results in increased reactive oxygen species production [46]. Microglial cells are known to be antigen-presenting cells that, when activated, secrete free radicals or reactive oxygen species that cause neuronal damage [52,53]. In this study, cytokine mRNA expression was to infer microglial activation commonly associated with PD pathogenesis [3]. Our results showed that mRNA levels of the pro-inflammatory cytokines IL-1, IL-6 and TNF-␣ were increased in the striatum of maternally separated rats. These results are consistent with previous studies that associated an increase in pro-inflammatory cytokine concentration with chronic stress
This study is consistent with a growing body of literature that implicates inflammatory cytokines in neural and behavioral processes. More importantly, it suggests that Fluvoxamine is a potential therapeutic intervention targeting neuronal inflammation associated with PD. The present study demonstrates that early treatment with Fluvoxamine prevents the occurrence of depressive-like signs and neuronal inflammation processes in lesioned rats. This study most importantly shows for the first time that Fluvoxamine treatment can prevent neuronal inflammation present in PD associated with depression by possibly regulating microglial activation in the striatum. Disclosure The authors report no conflicts of interest in this work. Acknowledgements The authors would like to thank the National Research Foundation of South Africa, the University of KwaZulu-Natal College of Health Sciences for financial support. We would also like to thank the staff of the Biomedical Resource Centre of the University of KwaZulu-Natal for the technical assistance provided. References [1] W.M. Daniels, C.Y. Pietersen, M.E. Carstens, D.J. Stein, Maternal separation in rats leads to anxiety-like behavior and a blunted ACTH response and altered neurotransmitter levels in response to a subsequent stressor, Metab. Brain Dis. 19 (2004) 3–14. [2] K.R. Chaudhuri, A.H. Schapira, Non-motor symptoms of Parkinson’s disease: dopaminergic pathophysiology and treatment, Lancet Neurol. 8 (2009) 464–474. [3] A.M. Hemmerle, J.P. Herman, K.B. Seroogy, Stress: depression and Parkinson’s disease, Exp. Neurol. 233 (2012) 79–86. [4] R.M. Santiago, J. Barbieiro, M.M.S. Lima, P.A. Dombrowski, R. Andreatini, M.A.B.F. Vital, Depressive-like behaviors alterations induced by intranigral MPTP, 6-OHDA, LPS and rotenone models of Parkinson’s disease are predominantly associated with serotonin and dopamine, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 34 (2010) 1104–1114. [5] W. Dauer, S. Przedborski, Parkinson’s disease: mechanisms and models, Neuron 39 (2003) 889–909.
196
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
[6] Q. Wang, Y. Liu, J. Zhou, Neuroinflammation in Parkinson’s disease and its potential as therapeutic target, Transl. Neurodegener. 4 (2015) 19. [7] L.J. Peterson, P.M. Flood, Oxidative stress and microglial cells in Parkinson’s disease, Mediators Inflamm. (2012) 401264. [8] K.E. Olson, H.E. Gendelman, Immunomodulation as a neuroprotective and therapeutic strategy for Parkinson’s disease, Curr. Opin. Pharmacol. 26 (2016) 87–95. [9] M.M. Pabon, A.D. Bachstetter, C.E. Hudson, C. Gemma, P.C. Bickford, CX3CL1 reduces neurotoxicity and microglial activation in a rat model of Parkinson’s disease, J. Neuroinflammation 8 (2011) 1742–2094. [10] Z. You, C. Luo, W. Zhang, Y. Chen, J. He, Q. Zhao, R. Zuo, Y. Wu, Pro- and anti-inflammatory cytokines expression in rat’s brain and spleen exposed to chronic mild stress: involvement in depression, Behav. Brain Res. 225 (2011) 135–141. [11] T. Nagatsu, M. Mogi, H. Ichinose, A. Togari, Cytokines in Parkinson’s disease, J. Neural Transm. (Suppl) (2000) 143–151. [12] D. Muck-Seler, N. Pivac, M. Diksic, Acute treatment with fluvoxamine elevates rat brain serotonin synthesis in some terminal regions: an autoradiographic study, Nucl. Med. Biol. 39 (2012) 1053–1057. [13] I.M. Omori, N. Watanabe, A. Nakagawa, A. Cipriani, C. Barbui, H. Mcguire, R. Churchill, T.A. Furukawa, Fluvoxamine versus other anti-depressive agents for depression, Cochr. Database Syst. Rev. (2010), CD006114–CD006114. [14] C.M. Lim, S.W. Kim, J.Y. Park, C. Kim, S.H. Yoon, J.K. Lee, Fluoxetine affords robust neuroprotection in the postischemic brain via its anti-inflammatory effect, J. Neurosci. Res. 87 (2009) 1037–1045. [15] Y.C. Chung, S.R. Kim, B.K. Jin, Paroxetine prevents loss of nigrostriatal dopaminergic neurons by inhibiting brain inflammation and oxidative stress in an experimental model of Parkinson’s disease, J. Immunol. 185 (2010) 1230–1237. [16] J.K. Barbiero, R.M. Santiago, D.S. Persike, D.A. Silva Fernandes, M.J. Tonin, F.S. DA Cunha, C. Lucio Boschen, S. Lima, M.M. Vital, Neuroprotective effects of peroxisome proliferator-activated receptor alpha and gamma agonists in model of Parkinsonism induced by intranigral 1-methyl-4-phenyl-1,2,3,6-tetrahyropyridine, Behav. Brain Res. 274 (2014) 390–399. [17] A. Pisanu, D. Lecca, G. Mulas, J. Wardas, G. Simbula, S. Spiga, A.R. Carta, Dynamic changes in pro- and anti-inflammatory cytokines in microglia after PPAR-gamma agonist neuroprotective treatment in the MPTPp mouse model of progressive Parkinson’s disease, Neurobiol. Dis. 71 (2014) 280–291. [18] J. Eng, Sample size estimation: how many individuals should be studied? Radiology 227 (2003) 309–313. [19] T. Mpofana, W.M.U. Daniels, M.V. Mabandla, Exposure to early life stress results in epigenetic changes in neurotrophic factor gene expression in a Parkinsonian rat model, Parkinson’s Dis. 2016 (2016) 7. [20] E. Dalle, W.M.U. Daniels, M.V. Mabandla, Anti-parkinsonian effects of fluvoxamine maleate in maternally separated rats, Int. J. Dev. Neurosci. 53 (2016) 26–34. [21] M.V. Mabandla, V.A. Russell, Voluntary exercise reduces the neurotoxic effects of 6-hydroxydopamine in maternally separated rats, Behav. Brain Res. 211 (2010) 16–22. [22] J. Maniam, M.J. Morris, Long-term postpartum anxiety and depression-like behavior in mother rats subjected to maternal separation are ameliorated by palatable high fat diet, Behav. Brain Res. 208 (2010) 72–79. [23] T. Mpofana, W.M. Daniels, M.V. Mabandla, Neuroprotective effects of caffeine on a maternally separated Parkinsonian rat model, J. Behav. Brain Sci. 4 (2014) 84–91. [24] D.A. Slattery, A. Markou, J.F. Cryan, Evaluation of reward processes in an animal model of depression, Psychopharmacology (Berl.) 190 (2007) 555–568. [25] R.M. Santiago, F.S. Tonin, J. Barbiero, T. Zaminelli, S.L. Boschen, R. Andreatini, C. DA Cunha, M.M. Lima, M.A. Vital, The nonsteroidal antiinflammatory drug piroxicam reverses the onset of depressive-like behavior in 6-OHDA animal model of Parkinson’s disease, Neuroscience 300 (2015) 246–253. [26] J.L. Tillerson, A.D. Cohen, J. Philhower, G.W. Miller, M.J. Zigmond, T. Schallert, Forced limb-use effects on the behavioral and neurochemical effects of 6-hydroxydopamine, J. Neurosci. 21 (2001) 4427–4435. [27] G. Gerstenberg, T. Aoshima, T. Fukasawa, K. Yoshida, H. Takahashi, H. Higuchi, Y. Murata, R. Shimoyama, T. Ohkubo, T. Shimizu, Relationship between clinical effects of fluvoxamine and the steady-state plasma concentrations of fluvoxamine and its major metabolite fluvoxamino acid in Japanese depressed patients, Psychopharmacology (Berl) 167 (2003) 443–448. [28] W.K. Goodman, L.H. Price, P.L. Delgado, J. Palumbo, J.H. Krystal, L.M. Nagy, S.A. Rasmussen, G.R. Heninger, D.S. Charney, Specificity of serotonin reuptake inhibitors in the treatment of obsessive-compulsive disorder. Comparison of fluvoxamine and desipramine, Arch. Gen. Psychiatry 47 (1990) 577–585. [29] G. Paxinos, C. Watson, Compact, in: The Rat Brain in Stereotaxic Coordinates, 3rd ed., Academic Press, Sydney, 1997. [30] E.D. Hall, J.M. Bosken, Measurement of oxygen radicals and lipid peroxidation in neural tissues, Curr. Protoc. Neurosci. 17 (2009) 1–51, Chapter 7, Unit 7.
[31] D. Sampson, P. Willner, R. Muscat, Reversal of antidepressant action by dopamine antagonists in an animal model of depression, Psychopharmacology (Berl.) 104 (1991) 491–495. [32] M.M. Sanchez, C.O. Ladd, P.M. Plotsky, Early adverse experience as a developmental risk factor for later psychopathology: evidence from rodent and primate models, Dev. Psychopathol. 13 (2001) 419–449. [33] M. Marmendal, C.J. Eriksson, C. Fahlke, Early deprivation increases exploration and locomotion in adult male Wistar offspring, Pharmacol. Biochem. Behav. 85 (2006) 535–544. [34] W.M.U. Daniels, J. DE Klerk Uys, P. Van Vuuren, D.J. Stein, The development of behavioral and endocrine abnormalities in rats after repeated exposure to direct and indirect stress, Neuropsychiatr. Dis. Treat. 4 (2008) 451–464. [35] R. Muscat, M. Papp, P. Willner, Reversal of stress-induced anhedonia by the atypical antidepressants, fluoxetine and maprotiline, Psychopharmacology (Berl.) 109 (1992) 433–438. [36] R.L. Huot, K.V. Thrivikraman, M.J. Meaney, P.M. Plotsky, Development of adult ethanol preference and anxiety as a consequence of neonatal maternal separation in Long Evans rats and reversal with antidepressant treatment, Psychopharmacology (Berl.) 158 (2001) 366–373. [37] M.N. Jayatissa, C. Bisgaard, A. Tingström, M. Papp, O. Wiborg, Hippocampal cytogenesis correlates to escitalopram-mediated recovery in a chronic mild stress rat model of depression, Neuropsychopharmacology 31 (2006) 2395–2404. [38] A. Markou, T.R. Kosten, G.F. Koob, Neurobiological similarities in depression and drug dependence: a self-medication hypothesis, Neuropsychopharmacology 18 (1998) 135–174. [39] M. Geldof, J.I. Freijer, L. Van Beijsterveldt, X. Langlois, M. Danhof, Pharmacokinetic–pharmacodynamic modelling of fluvoxamine 5-HT transporter occupancy in rat frontal cortex, Br. J. Pharmacol. 154 (2008) 1369–1378. [40] J. Irons, Fluvoxamine in the treatment of anxiety disorders, Neuropsychiatr. Dis. Treat. 1 (2005) 289. [41] M.V. Mabandla, M. Nyoka, W.M. Daniels, Early use of oleanolic acid provides protection against 6-hydroxydopamine induced dopamine neurodegeneration, Brain Res. 1622 (2015) 64–71. [42] M.E. Emborg, Evaluation of animal models of Parkinson’s disease for neuroprotective strategies, J. Neurosci. Methods 139 (2004) 121–143. [43] M. Olsson, G. Nikkhah, C. Bentlage, A. Bjorklund, Forelimb akinesia in the rat Parkinson model: differential effects of dopamine agonists and nigral transplants as assessed by a new stepping test, J. Neurosci. 15 (1995) 3863–3875. [44] L.R. Mcmahon, K.A. Cunningham, Role of 5-HT2A and 5-HT2B/2C receptors in the behavioral interactions between serotonin and catecholamine reuptake inhibitors, Neuropsychopharmacology 24 (2001) 319–329. [45] P. Huot, S.H. Fox, J.M. Brotchie, Monoamine reuptake inhibitors in parkinson’s disease, Parkinson’s Dis. 2015 (2015) 609428. [46] D.A. Tata, B.K. Yamamoto, Interactions between methamphetamine and environmental stress: role of oxidative stress: glutamate and mitochondrial dysfunction, Addiction 102 (2007) 49–60. [47] E. S¸ahin, S. Gümüs¸lü, Alterations in brain antioxidant status: protein oxidation and lipid peroxidation in response to different stress models, Behav. Brain Res. 155 (2004) 241–248. [48] N. Uysal, S. Gonenc, O. Acikgoz, C¸. Pekc¸etin, B.M. Kayatekin, A. Sonmez, I. Semin, Age-dependent effects of maternal deprivation on oxidative stress in infant rat brain, Neurosci. Lett. 384 (2005) 98–101. [49] H. Dursun, M. Bilici, F. Albayrak, C. Ozturk, M.B. Saglam, H.H. Alp, H. Suleyman, Antiulcer activity of fluvoxamine in rats and its effect on oxidant and antioxidant parameters in stomach tissue, BMC Gastroenterol. 9 (2009) 36. [50] A. Zafir, A. Ara, N. Banu, Invivo antioxidant status: a putative target of antidepressant action, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 33 (2009) 220–228. [51] C.-C. Chang, C.-T. Lee, T.-H. Lan, P.-C. Ju, Y.-H. Hsieh, T.-J. Lai, Effects of antidepressant treatment on total antioxidant capacity and free radical levels in patients with major depressive disorder, Psychiatry Res. 230 (2015) 575–580. [52] D.M. Thomas, P.D. Walker, J.A. Benjamins, T.J. Geddes, D.M. Kuhn, Methamphetamine neurotoxicity in dopamine nerve endings of the striatum is associated with microglial activation, J. Pharmacol. Exp. Ther. 311 (2004) 1–7. [53] S. Kobuchi, K. Fukushima, Y. Ito, N. Sugioka, K. Takada, Pharmacokinetics and distribution of fluvoxamine to the brain in rats under oxidative stress, Free Radic. Res. 46 (2012) 831–841. [54] S. Daniele, E. DA Pozzo, E. Zappelli, C. Martini, Trazodone treatment protects neuronal-like cells from inflammatory insult by inhibiting NF-B, p38 and JNK, Cell. Signal. 27 (2015) 1609–1629.
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Fluvoxamine maleate normalizes striatal neuronal inflammatory cytokine activity in a Parkinsonian rat model associated with depression Ernest Dallé, Willie M.U. Daniels, Musa V. Mabandla ∗ School of Laboratory Medicine and Medical Sciences, College of Health Sciences, University of KwaZulu-Natal, Durban 4000, South Africa
h i g h l i g h t s • Early maternal separation caused anhedonia and exacerbated the effects of 6-OHDA in lesioned rats. • Fluvoxamine reversed the effects of 6-OHDA lesion by modulating cytokine gene expression in the striatum of treated rats. • Fluvoxamine normalized pro- and anti-inflammatory cytokine expression in the striatum of treated rat.
a r t i c l e
i n f o
Article history: Received 8 June 2016 Received in revised form 1 August 2016 Accepted 3 August 2016 Available online 25 August 2016 Keywords: Fluvoxamine maleate Depression Inflammatory cytokines Striatum Parkinson’s disease
a b s t r a c t Cytokine dysfunction is associated with both depression and Parkinson’s disease (PD) pathophysiology. Inflammatory cytokines in neural and behavioral processes are involved in the production and/or maintenance of depression in PD. In this study we looked at how Fluvoxamine treatment regulates depressive-like signs, motor impairments and the expression of IL-1, IL-6, TNF-␣, TGF- and IL-10 cytokines in the striatum of a stressed Parkinsonian rat model. Early maternal separation was used to model stress and depressive-like signs in rats. Maternally separated adult rats were treated with Fluvoxamine for 30 days prior to 6-hydroxydopamine (6-OHDA) lesion. The sucrose preference test (SPT) and the limb-use asymmetry test (cylinder test) were used to evaluate anhedonia and motor impairments respectively. Lipid peroxidation and cytokine expression were measured in striatal tissue using ELISA and real-time PCR techniques respectively. Our results show that maternal separation resulted in anhedonia and exacerbated 6-OHDA lesion but Fluvoxamine treatment attenuated these effects. Lipid peroxidation, mRNA levels of IL-1, IL-6 and TNF-␣ were down-regulated while IL-10 and TGF- levels were up-regulated in the lesioned striatum of Fluvoxamine treated rats. This study shows that early treatment with Fluvoxamine may attenuate inflammation on injured striatal neurons by favoring antiinflammatory cytokine expression while decreasing pro-inflammatory cytokine release in the brain. This suggests a role of Fluvoxamine as a potential therapeutic intervention targeting neuronal inflammation associated with PD. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Early exposure to emotional stress such as maternal separation has been shown to cause long-term neurochemical and behavioral changes later in life [1]. These changes include depression, a psychiatric disorder commonly encountered non-motor features of Parkinson’s disease (PD) [2]. The estimated prevalence of depression in PD is between 40–50% in all PD cases [3]. This high
∗ Corresponding author. E-mail addresses: [email protected], [email protected] (M.V. Mabandla). http://dx.doi.org/10.1016/j.bbr.2016.08.005 0166-4328/© 2016 Elsevier B.V. All rights reserved.
prevalence of depression in PD has prompted the idea that degenerated nigrostriatal system may play a key role in depression [4]. The pathophysiology of PD also includes the presence of ␣-synuclein-containing aggregates in the substantia nigra pars compacta (SNpc) which may suggest the activation of glial cells and dysfunction in pro and/or anti-inflammatory factor levels common in PD associated with depression [5,6]. For instance, the chronic release of pro-inflammatory cytokines by activated astrocytes and microglia (the resident innate immune cells) leads to the exacerbation of DA neuron degeneration in the SNpc [6,7]. Antiinflammatory cytokines may also inhibit microglial activation by reducing reactive oxygen species which can be evaluated via lipid
190
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
peroxidation levels [8]. Moreover, at a cellular level, cytokines are expressed in microglia and play a critical role on neuron-microglia interactions in the regulation of neuroinflammation in both depression and PD [6,9]. Studies have shown that there are high levels of pro-inflammatory cytokines (tumor necrosis factor (TNF)-␣, interleukin (IL)-1, IL-6) and lower levels of anti-inflammatory cytokines (transforming growth factor (TGF)-, IL-10) in the midbrain of patients with depression and PD [3,6,10]. This strongly suggests the involvement of these immune components in PD pathogenesis associated with depression. Studies have shown that in a 6-OHDA lesioned animal model of PD, cytokine dysfunction may result in increased DA cell death rate in the striatum [6,9,11]. However, a better understanding of the role of inflammation caused by any stressor and treated with an antidepressant is still lacking. An animal model that mimic depressive-like signs and motor deficits of PD may be useful in establishing effective therapeutic strategies on the pathological processes of the depression in PD. Fluvoxamine, a selective serotonin reuptake inhibitor (SSRI) is one of the antidepressants commonly used as first line treatment for major depressive disorders [12,13]. Studies have shown that antidepressants may possess potent anti-inflammatory effects which attenuate cytokine expression by inhibiting infiltration of peripheral immune cells, blocking glial activation to reduce oxidative stress [14,15]. However, little is known about the effects of Fluvoxamine in the central nervous system, especially in the nigrostriatal DA system in the context of PD associated with depression. In an animal model of PD, the generation of free radicals can suggest an increase in pro-inflammatory cytokines along with decreased anti-inflammatory molecules in the striatum [8,16,17]. These observations may suggest that depression in PD is similar to a psychoneuroimmunological disorder where the increase in neuronal pro-inflammatory cytokines is likely to result in adverse consequences on functional activity of the neurochemical system implicated in the symptoms of the disorder. Therefore, in this study, we aimed to investigate whether early exposure to maternal separation may exacerbate neuronal inflammation. We further looked at the effects of Fluvoxamine exerted in the expression of pro-inflammatory cytokines (neurotoxic factors) and anti-inflammatory cytokines (neuroprotective molecules) in a PD rat model.
2. Materials and methods The experimental protocol (Fig. A) used in this study was reviewed and approved by the Animal Research Ethics Committee of the University of KwaZulu-Natal (018/15/Animal). The sample size was set according to previous studies where the statistical power was shown [18–20]. A total of 40 male Sprague-Dawley (SD) rats obtained from the Biomedical Resource Unit of the University of KwaZulu-Natal were used in this study. They were housed in polypropylene cages (38 × 32 × 16 cm) under controlled temperature (21 ± 2 ◦ C) and humidity (55–60%). Food and water were freely available. The daily light/dark cycle was 07:00 to 19:00 [21]. On post-natal day (PND) 1, the rats were sexed and culled to 6 male pups per litter. The rats were randomly divided into two equal groups as follows: normally reared (NS) and maternally separated (MS). The rats were weaned on PND 21 after which they were kept 6 per cage [21]. On PND 29, the groups were subdivided into 2 groups as follows: (1) normally reared pre-lesion treated (NSF: treated with Fluvoxamine from PND 29 – 59) and (2) maternally separated pre-lesion treated (MSF: treated with Fluvoxamine from PND 29 – 59). Lesion refers to the intracerebral injection of the neurotoxin 6-hydroxydopamine (6-OHDA) on PND 60 in all groups. Anhedonia was assessed on PND 28, 58 and 74 using the sucrose preference
test (SPT) [22]. Limb-use asymmetry was assessed on PND 58 and 75 using the cylinder test [21]. All rats were sacrificed on PND 76. All experimental procedures were conducted between 09:00 to 16:00. The animals were weighed prior to all experiments and were brought to the experimental room 1 h before experimentation [1,21]. 2.1. Drugs and reagents The drug Fluvoxamine is manufactured by Pharmed Pharmaceuticals LTD (Rochdale Park, Durban, South Africa). Desipramine (D3900), atropine, pentobarbital and 6-OHDA-HCL were purchased from Sigma (St. Louis MO, USA). Temgesic and Biotane were obtained from Pharmed Pharmaceuticals LTD (Rochdale Park, Durban, South Africa). The lipid peroxidation (MDA) assay kit (K739-100) was obtained from BioVision (Mountain view, CA, USA). Real-time PCR kits were purchased from BioRad Laboratories (CA, USA). 2.2. Maternal separation Maternal separation took place from PND 2 – 14. The maternal separation stress protocol was based on previous studies [20,21,23]. Briefly, the pups were taken away from their dams and kept in a separate room for 3 h (09:00–12:00) once a day. All normally reared pups were left undisturbed with their dams. 2.3. Behavioral tests Behavioral tests were set to assess the effect of Fluvoxamine in attenuating depressive-like signs in a rat model of depression as well as to assess the effects of the drug on motor dysfunction in a Parkinsonian rat model. The behavioral tests included the sucrose preference test (SPT) and the limb-use asymmetry test (cylinder test). The tests were performed pre- as well as post-lesion with 6-OHDA. 2.4. The sucrose preference test (SPT) The SPT was conducted over a 24 h period (9:00 a.m. to 9:00 a.m.) on PND 28, 58 and 74. A day prior to the test, the rats were weighed and placed in separate cages for a 24 h training period. The training phase consisted of placing two bottles of water preweighed, on opposite sides of the cage [24,25]. After the 24 h had elapsed, one bottle was replaced with one containing 2.5% sucrose solution. For the test phase, the two bottles (one containing tap water and the other containing 2.5% sucrose solution) were placed such that the bottle containing tap water was on the left side and the sucrose containing on the right. After 24 h, the bottles were weighed to determine consumption in grams (converted to ml). The sucrose preference ratio was calculated as a volume of sucrose drunk over the total fluid consumed (sucrose + water). A decreased amount of sucrose solution drunk is suggestive of anhedonia thus of depressive-like behavior [22,24]. 2.5. The limb-use asymmetry test (cylinder test) The cylinder test device was similar to the one described by [21] that consists of a transparent plexiglass cylinder of 20 cm in diameter and 30 cm in height. The test was conducted on PND 59 and 75. For Limb-use during exploratory activity (touching the wall of the cylinder and landing), each animal was scored over a 5 min period. The test was video-recorded using a camera and manually analyzed by an evaluator blind to the study. The animals were assessed for percentage limb-use of the impaired (contralateral) limb by using the following equation: % limb use of impaired = [(impaired + ½
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
191
Table 1 Nucleotide sequence of forward and reverse primers for real-time-PCR. Target mRNA bases
Forward primer
Reverse primer
IL-1 IL-6 TNF-␣ IL-10 TGF- -actin
CCCTGCAGCTGGAGAGTGTGG CGAGCCCACCAGGAACGAAAGTC GACCCTCACACTCAGATCATCTTCT TGCTACGACGTGGGCTACG GCGAGCGAAGCGACGAGGAG CTGGAACGGTGAAGGTGACA
TGTGCTCTGCTTGAGAGGTGCT CTGGCTGGAAGTCTCTTGCGGAG TGCTACGACGTGGGCTACG TGCAGTCCAGTAGATGCCGGG TGGGCGGGATGGCATCAAGGTA GGGACTTCCTGTAACAATGCA
both)/(impaired + unimpaired + both)] × 100. Impaired refers to the limb contralateral to the lesioned hemisphere. Both, refers to the use of both the impaired and unimpaired limbs during exploratory activity [26]. As the intracerebral infusion of 6-OHDA was done in the left hemisphere, a successful model of Parkinsonism would result in a bias towards left forelimb use after lesion as compared to before lesion [21,26]. 2.6. Fluvoxamine treatment Prior to treatment, the animals were weighed and the volume of Fluvoxamine to be injected (1 ml/250 g of body weight) was calculated accordingly. Fluvoxamine was freshly prepared by dissolving in saline after which it was intraperitoneally (i.p) injected (25 mg/kg) [12,27]. 2.7. Hemiparkinsonian rat model (6-OHDA lesion) Thirty minutes prior to 6-OHDA HCl infusion, desipramine HCl (15 mg/kg, i.p) a norepinephrine reuptake blocker was injected to inhibit 6-OHDA uptake by noradrenergic neurons [19] and [28]. The rats were anaesthetized with sodium pentobarbital (60 mg/kg, i.p) followed by an atropine (0.2 mg/kg, i.p) injection to facilitate respiration while unconscious. The head of the animal was shaved and positioned firmly in the stereotaxic apparatus (David Kopf Instruments, Tujunga CA, USA). The skin covering the scalp was disinfected with Biotane and a midline incision was made to expose the skull. At the following coordinates: anterior-posterior (AP) = +4.7 mm anterior to lambda; medio-lateral (ML) = +1.6 mm from midline suture; and DV = −8.4 mm ventral to dura, a hole was drilled in the skull [29]. At these coordinates, a Hamilton syringe was used to inject a preclinical dose of 6-OHDA HCl (5 g/4 l) dissolved in 0.2% ascorbic acid into the left MFB over a period of 8 min. The needle was kept in the MFB for 1 min prior to the injection and for 2 min following the injection to maximize diffusion. The incision was sutured and cleaned and the animals were placed under a heating lamp to prevent hypothermia during recovery. Animals were thereafter injected with Temgesic (0.05 mg/kg subcutaneously) a post-operative analgesic before being returned to their home cages. 2.8. Decapitation and neurochemistry All rats were euthanized on PND 76 by guillotine. Striatal tissue dissected within a minute of decapitation was collected, weighed and placed in Eppendorf tubes prior to freezing in liquid nitrogen and storage at −80 ◦ C in a bio-freezer. 2.9. Lipid peroxidation Lipid peroxidation (Malondialdehyde) quantification as a measure of oxidative stress was evaluated in the striatum of all rats (n = 6/group) according to [30] and the manufacturer’s protocol. Briefly, striatal tissue was homogenized with a sonicator (CML-4, Fisher, USA) on ice in 300 l of the Malondialdehyde (MDA) lysis buffer then centrifuged at 13000 rpm for 10 min. The supernatant (200 l) from each homogenized sample was thereafter pipetted
Fig. 1. Sucrose preference in all rats assessed on PND 28. **(NS water vs NS sucrose, p = 0.0053), **(MS water vs MS sucrose, p = 0.0027) and ***(NS sucrose vs MS sucrose, p < 0.0001). Paired t-tests. Values are expressed as mean ± SEM (n = 20/group).
into a microcentrifuge tube. To prepare standards, 10 l of MDA standard was diluted with 407 l of bidistilled water to prepare a solution of 0.1 M of MDA, then 20 l of 0.1 M MDA solution was diluted with 980 l of bidistilled water to prepare a 2 mM MDA standard. Into standard and sample vials, 600 l of Thiobarbituric acid (TBA) solution was added and incubated for 1 h in a water bath at 95 ◦ C. Standards and control vials were allowed to cool at room temperature for 10 min and thereafter 200 l from each standard and sample was pipetted in duplicate into a 96-well microplate. Absorbance was read at 532 nm using a spectrophotometer (Spectrostar Nano BMG LABTECH, Germany). 2.10. Real-time PCR On the day of analysis, 60 mg of striatal tissue was weighed out (n = 6/group), homogenized and suspended in 400 l of lysis buffer (Zymo Research, USA). Thereafter, samples were manually homogenized using a sterile blade and total RNA isolation was carried out as per manufacturer’s protocol (ZR RNA MiniPrepTM , USA). Purification of RNA isolates were assessed using a NanoDrop. Purity of 1.8–2.01 was recommended for use in the construction of cDNA. The cDNA synthesis was carried out using the iScriptTM cDNA Synthesis Kit (BioRad, South Africa) and run through the Thermocycler according to conditions stipulated in the protocol. The Fast start SYBR green kit (Roche Diagnostics, USA) was used in accordance to the manufacturer’s guidelines. The primers (Table 1) used for all the assayed genes were designed by Inqaba Biotech (Pretoria, South Africa). Primer sequences were reconstituted in RNA nuclease free water according to the manufacturer’s report and were added to a master mix comprising of SYBR green dye, nuclease free H2 O and MgCl2 . Thereafter cDNA was added into glass capillaries and run in the Lightcycler 480 at optimized conditions. -actin gene was used as the internal control. 2.11. Statistical analysis All results are presented as mean ± SEM. The data was analyzed using the software program GraphPad Prism (version 5.0, San Diego, California, USA). The Shapiro-Wilk test was used to test for normality of distribution and where data met requirements,
192
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
Fig. 2. Effect of Fluvoxamine treatment on sucrose preference in all rats assessed on PND 58. ***(NS vs MS, p < 0.0001, paired t-test), ***(MS vs MSF, F (3, 36) = 15.61, p < 0.0001, one-way ANOVA). Values are expressed as mean ± SEM (n = 10/group).
parametric or non-parametric tests were used. The main factors in each analysis included stress and treatment. When measuring only one variable (stress versus non-stressed), paired t-test was used for analysis. One-way analysis of variance (ANOVA) was used on behavioral, lipid peroxidation and gene data analysis. In each analysis, significant main effect was followed by Newman-Keuls post hoc test. p < 0.05 was considered significant in all analysis.
Fig. A. Outline of experimental protocol. All stressed groups were maternally separated from PND 2–14. All groups were weaned on PND 21. The pre-lesion animals were treated from PND 29 – 59. The animals were assessed for anhedonia using the sucrose preference test (SPT) on PND 28, 58 and 74 and for motor impairments on PND 59 and 75. All animals were lesion on PND 60 and were sacrificed on PND 76.NS: normally reared. NSF: normally reared pre-lesion treated with FM. MS: maternally separated. MSF: maternally separated pre-lesion treated with FM. SPT: sucrose preference test.
Fig. 3. Effect of Fluvoxamine treatment on sucrose preference in 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 74. *(NS vs MS, p = 0.0125, paired t-test) and ***(MS vs MSF, F (3, 36) = 19.415, p < 0.0001, one-way ANOVA). Values are expressed as mean ± SEM (n = 10/group).
3.2. Cylinder test Asymmetry of in forelimb use was assessed in all rats on PND 58 and PND 75. Prior to 6-OHDA lesion (PND 58), no asymmetry was evident in all the rats (Data not shown). On PND 75, a stress effect was evident as 6-OHDA lesion in these rats resulted in decreased use of the right (impaired) forelimb
when touching the wall of the cylinder *(NS vs MS, p = 0.0398). A treatment effect was present as pre-lesion treatment with Fluvoxamine attenuated forelimb use asymmetry caused by the 6-OHDA lesion in both the non-stressed and maternally separated rats [F (3, 36) = 7.709, p = 0.0004]. Data presented in Fig. 4. Significant main effects of stress and Fluvoxamine treatment with respect to the use of the right (impaired) forelimb for landing was observed **(NS vs MS, p = 0.0085) and [F (3, 36) = 10.56, p < 0.0001]. Data presented in Fig. 5. 3.3. Lipid peroxidation
3. Results
A stress effect was evident in the maternally separated (MS) rats resulting in higher levels of lipid peroxidation *(NS vs MS,
3.1. Sucrose preference test (SPT) In the SPT conducted on PND 28, non-stressed (NS) rats favored drinking the sucrose solution (**p = 0.0053) than water. However, maternally separated (MS) rats preferred drinking tap water (**p = 0.0027) than the sucrose solution. Overall, there was a stress effect as maternally separated rats drunk less sucrose solution than non-stressed rats (***p < 0.0001). Data presented in Fig. 1. On PND 58, stressed rats showed less preference for sucrose than non-stressed rats ***(NS vs MS, p < 0.0001). A treatment effect in the MSF rats was evident ***(MS vs MSF, F (3, 56) = 15.61, p < 0.0001, one-way ANOVA). Data presented in Fig. 2. This was also the case on PND 74 where a stress effect *(NS vs MS, p = 0.0125) was evident. Fluvoxamine treatment resulted in greater sucrose consumption in the maternally separated rats ***(MS vs MSF (S), F (3, 36) = 19.415, p < 0.0001, one-way ANOVA). Data presented in Fig. 3.
Fig. 4. Number of times the rat used the impaired (right) forelimb to touch the wall of the cylinder expressed as a percentage of the total number of times it touched the wall of the cylinder on PND 75. All groups were lesioned with 6-OHDA on PND 60. *(NS vs MS, p = 0.0398, paired t-test) and [F (3, 36) = 7.709, p = 0.0004, one-way ANOVA]. Values are expressed as mean ± SEM (n = 10/group).
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
Fig. 5. Number of times the rat used the impaired (right) forelimb to land on the floor expressed as a percentage of the total number of times it landed on the floor of the cylinder on PND 75. All groups were lesioned with 6-OHDA on PND 60. **(NS vs MS, p = 0.0085, paired t-test) and [F (3, 36) = 10.56, p < 0.0001, one-way ANOVA]. Values are expressed as mean ± SEM (n = 10/group).
193
Fig. 8b). We also found a Fluvoxamine treatment effect in both nonstressed and maternally separated rats [F (3, 20) = 10.69, p = 0.0002, Fig. 8b]. The ratio of pro-inflammatory versus anti-inflammatory cytokine mRNA expression was assessed in the striatum of the rats (Fig. 9). Fig. 9a shows that the ratios of TNF-␣ to IL-10 in the striatum of maternally separated rats were higher than that of non-stressed rats but the pre-lesion treatment with Fluvoxamine reversed this effect. ***(MS TNF-␣ vs MS IL-10, p < 0.0001), **(NSF TNF-␣ vs NSF IL-10, p = 0.0031) and **(MSF TNF-␣ vs MSF IL-10, p = 0.0051). Similarly, in Fig. 9b, the ratios of IL-1 to IL-10 in the striatum of maternally separated rats were higher than that of the non-stressed rats and was reversed by the pre-lesion treatment with Fluvoxamine. ***(MS IL-1 vs MS IL-10, p = 0.0006), ***(NSF IL-1 vs NSF IL-10, p = 0.0003) and *(MSF IL-1 vs MSF IL-10, p = 0.0198).
4. Discussion
Fig. 6. Effect of Fluvoxamine treatment on striatal lipid peroxidation levels in 6OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. *(NS vs MS, p = 0.0370, paired t-test) and [F (3, 20) = 4.210, p = 0.0184, one-way ANOVA]. Values are expressed as mean ± SEM (n = 6/group).
p = 0.0370). Fluvoxamine treatment attenuated lipid peroxidation in the maternally separated rats [F (3, 20) = 4.210, p = 0.0184]. Data presented in Fig. 6. 3.4. Cytokine gene expression Pro-inflammatory cytokine mRNA expression is shown in Fig. 7. A stress effect on IL-1 mRNA expression was found as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls *(NS vs MS, p = 0.0249, Fig. 7a). A Fluvoxamine treatment effect was found as IL-1 mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 11.13, p = 0.0002, Fig. 7a]. We found a stress effect on IL-6 mRNA expression as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls **(NS vs MS, p = 0.0049, Fig. 7b). A Fluvoxamine treatment effect was found as IL-1 mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 21.53, p < 0.0001, Fig. 7b]. Similarly, a stress effect on TNF-␣ mRNA expression was found as the expression of this cytokine was increased in the striatum of maternally separated (MS) rats when compared to controls ***(NS vs MS, p = 0.0001, Fig. 7c). A Fluvoxamine treatment effect was also found as TNF-␣ mRNA expression was reduced in both non-stressed and maternally separated rats [F (3, 20) = 15.00, p < 0.0001, Fig. 7c]. Anti-inflammatory cytokine mRNA expression is shown in Fig. 8. A stress effect on IL-10 mRNA expression was found as this cytokine expression was decreased in the striatum of maternally separated rats when compared to controls *(NS vs MS, p = 0.0236, Fig. 8a). A Fluvoxamine treatment effect was found in both non-stressed and maternally separated rats [F (3, 20) = 11.28, p = 0.0002, Fig. 8a]. Similarly, a stress effect on TGF- mRNA expression was found as this cytokine expression was decreased in the striatum of maternally separated rats when compared to controls **(NS vs MS, p = 0.0019,
In this study we investigated how early exposure to maternal separation leading to depressive-like signs may exacerbate 6-OHDA lesion. We further looked at the effect of Fluvoxamine treatment on pro- and anti-inflammatory cytokine gene expression and whether any effects present are mediated by the expression of these genes in a parkinsonian rat model. The SPT results showed that early maternal separation induced behavioral changes that may be regarded as depressive-like signs including reduction of preference for sucrose solution. On PND 28, 58 and 74, we found that maternally separated (MS) rats consumed less sucrose solution than non-stressed (NS) rats suggesting a prolonged stress effect. These results agreed with previous studies and confirmed that early stressful experience causes anhedonia (a core symptom of depression in rodent) and favor the development of depression later in life [31–34]. Our results also showed that pre-lesion treatment with Fluvoxamine increased sucrose preference in maternally separated rats in agreement with previous studies on the effects of antidepressants [35–37]. [38] have shown that depression can alter serotonergic, dopaminergic or noradrenergic neurotransmitters and that rats with depressive-like signs may use drug to self-medicate. We postulated that maternal separation reduced 5-hydroxytryptaminergic transmission which resulted in depressive-like signs [39]. To relieve depression, SSRI medications act by blocking serotonin transporter such that extracellular serotonin levels are increased thereby enhancing 5hydroxytryptaminergic transmission [39]. In our model, the rats were exposed to Fluvoxamine treatment for 30 days allowing the drug to reduce the stress effects while relieving depressive-like signs in a time dependent manner [34,36,39,40]. Besides the ameliorative effect of Fluvoxamine treatment on depressive-like signs, the induction of a 6-OHDA lesion exposed the neuroprotective capability of the drug in all rats. The cylinder test results before 6-OHDA injection did not show asymmetry in preferred forelimb use (Data not shown). However, post 6OHDA injection, our results showed a preference to use the right (impaired) forelimb in touching the plexiglass cylinder or in landing in non-stressed (NS) and maternally separated (MS) rats. These results suggest a 6-OHDA lesion effect in these rats in agreement with previous findings that showed that a unilateral 6-OHDA lesion causes forelimb use asymmetry [23,41,42]. Moreover, our results confirmed that 6-OHDA lesion is exacerbated by early maternal separation [20,23]. Interestingly, we also found a treatment effect in both non-stressed and stressed animals suggesting an amelioration of the 6-OHDA effect on impaired limb use. To our knowledge, this finding is the first that shows that Fluvoxamine treatment attenuates 6-OHDA lesion in a rat. However, since motor impairment usually results from an increase in tonic inhibition of the
194
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
neurons in the thalamocortical area of the brain, we postulated that Fluvoxamine may have attenuated the impairment by promoting adaptive changes in the substantia nigra [41,43,44]. It has been shown that in rat frontal cortex, adaptive changes caused by
Fluvoxamine may involve the functionality/sensitivity of serotonin auto-receptors and post-synaptic receptors [39]. Since it is possible that serotonin receptors activate dopamine receptors, in our rat model, the adaptive changes may have involved serotonin hyper-
Fig. 7. Effect of Fluvoxamine treatment on pro-inflammatory cytokines gene expression in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. The levels of IL-1, IL-6 and TNF-␣ mRNAs were determined using real-time PCR. a, b and c show normalized expression of each gene by the pre-lesion treatment with Fluvoxamine. In a, *(NS vs MS, p = 0.0249, paired t-test) and [F (3, 20) = 11.13, p = 0.0002, one-way ANOVA]. In b, **(NS vs MS, p = 0.0049, paired t-test) and [F (3,20) = 21.53, p < 0.0001, one-way ANOVA]. In c, ***(NS vs MS, p = 0.0001, paired t-test) and [F (3, 20) = 15.00, p < 0.0001,one-way ANOVA].Values are expressed as mean ± SEM (n = 6/group).
Fig. 8. Effect of Fluvoxamine treatment on anti-inflammatory cytokines gene expression in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats assessed on PND 76. The levels of IL-10 and TGF- mRNAs were determined using Real-time PCR. a and b show normalized expression of each gene by the pre-lesion treatment with Fluvoxamine. In a, *(NS vs MS, p = 0.0236, paired t-test) and [F (3, 20) = 11.28, p = 0.0002, one-way ANOVA]. In b, **(NS vs MS, p = 0.0019, paired t-test) and [F (3, 20) = 10.69, p = 0.0002, one-way ANOVA]. Values are expressed as mean ± SEM (n = 6/group).
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
195
[3,10]. Similarly, mRNA levels of the anti-inflammatory cytokines IL-10 and TGF- were decreased in the striatum of maternally separated rats. This was also in agreement with previous studies [3,10]. In addition, we found that pre-lesion treatment with Fluvoxamine remarkably reversed the pro- and anti-inflammatory cytokine expression in the striatum of both non-stressed and stressed rats. Studies have shown that an imbalance in pro- and antiinflammatory cytokine expression in favor of pro-inflammatory is known to cause long-lasting changes in brain function and may be restored by antidepressant treatment [53,54]. A study on the effects of paroxetine in a MPTP-induced increase of inflammatory molecules in a model of PD showed potential to attenuate the neurotoxin effect through blockade of glial activation thus its neuroprotective capability [15]. The antidepressant paroxetine was able to modulate expression of inflammatory molecules within activated microglia after the neurotoxin injection thereby rescuing nigral dopamine neurons [15]. It is possible that the pre-lesion treatment with Fluvoxamine had similar effect, blocking microglial activation so as to provide protection against stress-induced free radical production thus the normalization of cytokine expression in pre-lesion treated rats. However, the normalization capability of Fluvoxamine is time dependent therefore may be optimized when the treatment is initiated as a prophylactic drug to prevent neuronal cell death in a neurodegenerative disease such as PD. 5. Conclusion Fig. 9. Effect of Fluvoxamine treatment on the ratios TNF-␣/IL-10 and IL-1/Il-10 in the striatum of 6-OHDA lesioned, non-stressed (NS, NSF) and maternally separated (MS, MSF) rats. In a, ***(MS TNF-␣ vs MS IL-10, p < 0.0001), **(NSF TNF-␣ vs NSF IL-10, p = 0.0031), and **(MSF TNF-␣ vs MSF IL-10, p = 0.0051). In b, ***(MS IL-1 vs MS IL-10, p = 0.0006), ***(NSF IL-1 vs NSF IL-10, p = 0.0003) and *(MSF IL-1 vs MSF IL-10, p = 0.0198). Paired t-tests. Values are expressed as mean ± SEM (n = 6/group).
innervation resulting in an attenuation of the effects of lesion [45]. Therefore, Fluvoxamine may have acted as an agonist drug that can increase neurons tonicity so as to relieve parkinsonian symptoms. A marker of lipid peroxidation (MDA) was measured in the striatum so as to assess an aspect of stress-associated production of reactive oxygen species [46]. Our results showed that maternally separated rats had higher lipid peroxidation levels than nonstressed (NS) rats. These results agreed with [47,48] who showed that chronic stress could elevate lipid peroxidation in the striatum due to catecholamine metabolism (DA, norepinephrine) that undergo auto-oxidation. However, we also found that pre-lesion treatment with Fluvoxamine reduced lipid peroxidation in maternally separated rats. Antidepressant drugs including Fluvoxamine have been reported to possess antioxidant capacity by decreasing circulating free radicals [49,50,51]. As 6-OHDA injection did not results in increased levels of lipid peroxidation, this suggests that pre-lesion treatment with Fluvoxamine may prevent loss of nigrostriatal neurons by inhibiting neural inflammation and/or oxidative stress thus indirectly acting as a neuroprotective drug. Furthermore, we postulated that Fluvoxamine treatment may have blocked the toxic effects of the lesion by inhibiting the activation of microglia in the striatum which usually results in increased reactive oxygen species production [46]. Microglial cells are known to be antigen-presenting cells that, when activated, secrete free radicals or reactive oxygen species that cause neuronal damage [52,53]. In this study, cytokine mRNA expression was to infer microglial activation commonly associated with PD pathogenesis [3]. Our results showed that mRNA levels of the pro-inflammatory cytokines IL-1, IL-6 and TNF-␣ were increased in the striatum of maternally separated rats. These results are consistent with previous studies that associated an increase in pro-inflammatory cytokine concentration with chronic stress
This study is consistent with a growing body of literature that implicates inflammatory cytokines in neural and behavioral processes. More importantly, it suggests that Fluvoxamine is a potential therapeutic intervention targeting neuronal inflammation associated with PD. The present study demonstrates that early treatment with Fluvoxamine prevents the occurrence of depressive-like signs and neuronal inflammation processes in lesioned rats. This study most importantly shows for the first time that Fluvoxamine treatment can prevent neuronal inflammation present in PD associated with depression by possibly regulating microglial activation in the striatum. Disclosure The authors report no conflicts of interest in this work. Acknowledgements The authors would like to thank the National Research Foundation of South Africa, the University of KwaZulu-Natal College of Health Sciences for financial support. We would also like to thank the staff of the Biomedical Resource Centre of the University of KwaZulu-Natal for the technical assistance provided. References [1] W.M. Daniels, C.Y. Pietersen, M.E. Carstens, D.J. Stein, Maternal separation in rats leads to anxiety-like behavior and a blunted ACTH response and altered neurotransmitter levels in response to a subsequent stressor, Metab. Brain Dis. 19 (2004) 3–14. [2] K.R. Chaudhuri, A.H. Schapira, Non-motor symptoms of Parkinson’s disease: dopaminergic pathophysiology and treatment, Lancet Neurol. 8 (2009) 464–474. [3] A.M. Hemmerle, J.P. Herman, K.B. Seroogy, Stress: depression and Parkinson’s disease, Exp. Neurol. 233 (2012) 79–86. [4] R.M. Santiago, J. Barbieiro, M.M.S. Lima, P.A. Dombrowski, R. Andreatini, M.A.B.F. Vital, Depressive-like behaviors alterations induced by intranigral MPTP, 6-OHDA, LPS and rotenone models of Parkinson’s disease are predominantly associated with serotonin and dopamine, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 34 (2010) 1104–1114. [5] W. Dauer, S. Przedborski, Parkinson’s disease: mechanisms and models, Neuron 39 (2003) 889–909.
196
E. Dallé et al. / Behavioural Brain Research 316 (2017) 189–196
[6] Q. Wang, Y. Liu, J. Zhou, Neuroinflammation in Parkinson’s disease and its potential as therapeutic target, Transl. Neurodegener. 4 (2015) 19. [7] L.J. Peterson, P.M. Flood, Oxidative stress and microglial cells in Parkinson’s disease, Mediators Inflamm. (2012) 401264. [8] K.E. Olson, H.E. Gendelman, Immunomodulation as a neuroprotective and therapeutic strategy for Parkinson’s disease, Curr. Opin. Pharmacol. 26 (2016) 87–95. [9] M.M. Pabon, A.D. Bachstetter, C.E. Hudson, C. Gemma, P.C. Bickford, CX3CL1 reduces neurotoxicity and microglial activation in a rat model of Parkinson’s disease, J. Neuroinflammation 8 (2011) 1742–2094. [10] Z. You, C. Luo, W. Zhang, Y. Chen, J. He, Q. Zhao, R. Zuo, Y. Wu, Pro- and anti-inflammatory cytokines expression in rat’s brain and spleen exposed to chronic mild stress: involvement in depression, Behav. Brain Res. 225 (2011) 135–141. [11] T. Nagatsu, M. Mogi, H. Ichinose, A. Togari, Cytokines in Parkinson’s disease, J. Neural Transm. (Suppl) (2000) 143–151. [12] D. Muck-Seler, N. Pivac, M. Diksic, Acute treatment with fluvoxamine elevates rat brain serotonin synthesis in some terminal regions: an autoradiographic study, Nucl. Med. Biol. 39 (2012) 1053–1057. [13] I.M. Omori, N. Watanabe, A. Nakagawa, A. Cipriani, C. Barbui, H. Mcguire, R. Churchill, T.A. Furukawa, Fluvoxamine versus other anti-depressive agents for depression, Cochr. Database Syst. Rev. (2010), CD006114–CD006114. [14] C.M. Lim, S.W. Kim, J.Y. Park, C. Kim, S.H. Yoon, J.K. Lee, Fluoxetine affords robust neuroprotection in the postischemic brain via its anti-inflammatory effect, J. Neurosci. Res. 87 (2009) 1037–1045. [15] Y.C. Chung, S.R. Kim, B.K. Jin, Paroxetine prevents loss of nigrostriatal dopaminergic neurons by inhibiting brain inflammation and oxidative stress in an experimental model of Parkinson’s disease, J. Immunol. 185 (2010) 1230–1237. [16] J.K. Barbiero, R.M. Santiago, D.S. Persike, D.A. Silva Fernandes, M.J. Tonin, F.S. DA Cunha, C. Lucio Boschen, S. Lima, M.M. Vital, Neuroprotective effects of peroxisome proliferator-activated receptor alpha and gamma agonists in model of Parkinsonism induced by intranigral 1-methyl-4-phenyl-1,2,3,6-tetrahyropyridine, Behav. Brain Res. 274 (2014) 390–399. [17] A. Pisanu, D. Lecca, G. Mulas, J. Wardas, G. Simbula, S. Spiga, A.R. Carta, Dynamic changes in pro- and anti-inflammatory cytokines in microglia after PPAR-gamma agonist neuroprotective treatment in the MPTPp mouse model of progressive Parkinson’s disease, Neurobiol. Dis. 71 (2014) 280–291. [18] J. Eng, Sample size estimation: how many individuals should be studied? Radiology 227 (2003) 309–313. [19] T. Mpofana, W.M.U. Daniels, M.V. Mabandla, Exposure to early life stress results in epigenetic changes in neurotrophic factor gene expression in a Parkinsonian rat model, Parkinson’s Dis. 2016 (2016) 7. [20] E. Dalle, W.M.U. Daniels, M.V. Mabandla, Anti-parkinsonian effects of fluvoxamine maleate in maternally separated rats, Int. J. Dev. Neurosci. 53 (2016) 26–34. [21] M.V. Mabandla, V.A. Russell, Voluntary exercise reduces the neurotoxic effects of 6-hydroxydopamine in maternally separated rats, Behav. Brain Res. 211 (2010) 16–22. [22] J. Maniam, M.J. Morris, Long-term postpartum anxiety and depression-like behavior in mother rats subjected to maternal separation are ameliorated by palatable high fat diet, Behav. Brain Res. 208 (2010) 72–79. [23] T. Mpofana, W.M. Daniels, M.V. Mabandla, Neuroprotective effects of caffeine on a maternally separated Parkinsonian rat model, J. Behav. Brain Sci. 4 (2014) 84–91. [24] D.A. Slattery, A. Markou, J.F. Cryan, Evaluation of reward processes in an animal model of depression, Psychopharmacology (Berl.) 190 (2007) 555–568. [25] R.M. Santiago, F.S. Tonin, J. Barbiero, T. Zaminelli, S.L. Boschen, R. Andreatini, C. DA Cunha, M.M. Lima, M.A. Vital, The nonsteroidal antiinflammatory drug piroxicam reverses the onset of depressive-like behavior in 6-OHDA animal model of Parkinson’s disease, Neuroscience 300 (2015) 246–253. [26] J.L. Tillerson, A.D. Cohen, J. Philhower, G.W. Miller, M.J. Zigmond, T. Schallert, Forced limb-use effects on the behavioral and neurochemical effects of 6-hydroxydopamine, J. Neurosci. 21 (2001) 4427–4435. [27] G. Gerstenberg, T. Aoshima, T. Fukasawa, K. Yoshida, H. Takahashi, H. Higuchi, Y. Murata, R. Shimoyama, T. Ohkubo, T. Shimizu, Relationship between clinical effects of fluvoxamine and the steady-state plasma concentrations of fluvoxamine and its major metabolite fluvoxamino acid in Japanese depressed patients, Psychopharmacology (Berl) 167 (2003) 443–448. [28] W.K. Goodman, L.H. Price, P.L. Delgado, J. Palumbo, J.H. Krystal, L.M. Nagy, S.A. Rasmussen, G.R. Heninger, D.S. Charney, Specificity of serotonin reuptake inhibitors in the treatment of obsessive-compulsive disorder. Comparison of fluvoxamine and desipramine, Arch. Gen. Psychiatry 47 (1990) 577–585. [29] G. Paxinos, C. Watson, Compact, in: The Rat Brain in Stereotaxic Coordinates, 3rd ed., Academic Press, Sydney, 1997. [30] E.D. Hall, J.M. Bosken, Measurement of oxygen radicals and lipid peroxidation in neural tissues, Curr. Protoc. Neurosci. 17 (2009) 1–51, Chapter 7, Unit 7.
[31] D. Sampson, P. Willner, R. Muscat, Reversal of antidepressant action by dopamine antagonists in an animal model of depression, Psychopharmacology (Berl.) 104 (1991) 491–495. [32] M.M. Sanchez, C.O. Ladd, P.M. Plotsky, Early adverse experience as a developmental risk factor for later psychopathology: evidence from rodent and primate models, Dev. Psychopathol. 13 (2001) 419–449. [33] M. Marmendal, C.J. Eriksson, C. Fahlke, Early deprivation increases exploration and locomotion in adult male Wistar offspring, Pharmacol. Biochem. Behav. 85 (2006) 535–544. [34] W.M.U. Daniels, J. DE Klerk Uys, P. Van Vuuren, D.J. Stein, The development of behavioral and endocrine abnormalities in rats after repeated exposure to direct and indirect stress, Neuropsychiatr. Dis. Treat. 4 (2008) 451–464. [35] R. Muscat, M. Papp, P. Willner, Reversal of stress-induced anhedonia by the atypical antidepressants, fluoxetine and maprotiline, Psychopharmacology (Berl.) 109 (1992) 433–438. [36] R.L. Huot, K.V. Thrivikraman, M.J. Meaney, P.M. Plotsky, Development of adult ethanol preference and anxiety as a consequence of neonatal maternal separation in Long Evans rats and reversal with antidepressant treatment, Psychopharmacology (Berl.) 158 (2001) 366–373. [37] M.N. Jayatissa, C. Bisgaard, A. Tingström, M. Papp, O. Wiborg, Hippocampal cytogenesis correlates to escitalopram-mediated recovery in a chronic mild stress rat model of depression, Neuropsychopharmacology 31 (2006) 2395–2404. [38] A. Markou, T.R. Kosten, G.F. Koob, Neurobiological similarities in depression and drug dependence: a self-medication hypothesis, Neuropsychopharmacology 18 (1998) 135–174. [39] M. Geldof, J.I. Freijer, L. Van Beijsterveldt, X. Langlois, M. Danhof, Pharmacokinetic–pharmacodynamic modelling of fluvoxamine 5-HT transporter occupancy in rat frontal cortex, Br. J. Pharmacol. 154 (2008) 1369–1378. [40] J. Irons, Fluvoxamine in the treatment of anxiety disorders, Neuropsychiatr. Dis. Treat. 1 (2005) 289. [41] M.V. Mabandla, M. Nyoka, W.M. Daniels, Early use of oleanolic acid provides protection against 6-hydroxydopamine induced dopamine neurodegeneration, Brain Res. 1622 (2015) 64–71. [42] M.E. Emborg, Evaluation of animal models of Parkinson’s disease for neuroprotective strategies, J. Neurosci. Methods 139 (2004) 121–143. [43] M. Olsson, G. Nikkhah, C. Bentlage, A. Bjorklund, Forelimb akinesia in the rat Parkinson model: differential effects of dopamine agonists and nigral transplants as assessed by a new stepping test, J. Neurosci. 15 (1995) 3863–3875. [44] L.R. Mcmahon, K.A. Cunningham, Role of 5-HT2A and 5-HT2B/2C receptors in the behavioral interactions between serotonin and catecholamine reuptake inhibitors, Neuropsychopharmacology 24 (2001) 319–329. [45] P. Huot, S.H. Fox, J.M. Brotchie, Monoamine reuptake inhibitors in parkinson’s disease, Parkinson’s Dis. 2015 (2015) 609428. [46] D.A. Tata, B.K. Yamamoto, Interactions between methamphetamine and environmental stress: role of oxidative stress: glutamate and mitochondrial dysfunction, Addiction 102 (2007) 49–60. [47] E. S¸ahin, S. Gümüs¸lü, Alterations in brain antioxidant status: protein oxidation and lipid peroxidation in response to different stress models, Behav. Brain Res. 155 (2004) 241–248. [48] N. Uysal, S. Gonenc, O. Acikgoz, C¸. Pekc¸etin, B.M. Kayatekin, A. Sonmez, I. Semin, Age-dependent effects of maternal deprivation on oxidative stress in infant rat brain, Neurosci. Lett. 384 (2005) 98–101. [49] H. Dursun, M. Bilici, F. Albayrak, C. Ozturk, M.B. Saglam, H.H. Alp, H. Suleyman, Antiulcer activity of fluvoxamine in rats and its effect on oxidant and antioxidant parameters in stomach tissue, BMC Gastroenterol. 9 (2009) 36. [50] A. Zafir, A. Ara, N. Banu, Invivo antioxidant status: a putative target of antidepressant action, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 33 (2009) 220–228. [51] C.-C. Chang, C.-T. Lee, T.-H. Lan, P.-C. Ju, Y.-H. Hsieh, T.-J. Lai, Effects of antidepressant treatment on total antioxidant capacity and free radical levels in patients with major depressive disorder, Psychiatry Res. 230 (2015) 575–580. [52] D.M. Thomas, P.D. Walker, J.A. Benjamins, T.J. Geddes, D.M. Kuhn, Methamphetamine neurotoxicity in dopamine nerve endings of the striatum is associated with microglial activation, J. Pharmacol. Exp. Ther. 311 (2004) 1–7. [53] S. Kobuchi, K. Fukushima, Y. Ito, N. Sugioka, K. Takada, Pharmacokinetics and distribution of fluvoxamine to the brain in rats under oxidative stress, Free Radic. Res. 46 (2012) 831–841. [54] S. Daniele, E. DA Pozzo, E. Zappelli, C. Martini, Trazodone treatment protects neuronal-like cells from inflammatory insult by inhibiting NF-B, p38 and JNK, Cell. Signal. 27 (2015) 1609–1629.