- Email: [email protected]
PS1 transgenic mice
Available online at www.sciencedirect.com
ScienceDirect Journal of Nutritional Biochemistry xx (2015) xxx – xxx
Folic acid administration inhibits amyloid β-peptide accumulation in APP/PS1 transgenic mice Wen Li a , Huan Liu a , Min Yu a , Xumei Zhang a , Meilin Zhang a , John X. Wilson b , Guowei Huang a,⁎ b
a Department of Nutrition and Food Science, School of Public Health, Tianjin Medical University, Tianjin, China Department of Exercise and Nutrition Sciences, School of Public Health and Health Professions, University at Buffalo, Buffalo, NY, USA
Received 9 September 2014; received in revised form 24 February 2015; accepted 31 March 2015
Abstract Alzheimer's disease (AD) is associated with malnutrition, altered one-carbon metabolism and increased hippocampal amyloid-β peptide (Aβ) accumulation. Aberrant DNA methylation may be an epigenetic mechanism that underlies AD pathogenesis. We hypothesized that folic acid acts through an epigenetic gene silencing mechanism to lower Aβ levels in the APP/PS1 transgenic mouse model of AD. APP/PS1 mice were fed either folate-deficient or control diets and gavaged daily with 120 μg/kg folic acid, 13.3 mg/kg S-adenosylmethionine (SAM) or both. Examination of the mice after 60 days of treatment showed that serum folate concentration increased with intake of folic acid but not SAM. Folate deficiency lowered endogenous SAM concentration, whereas neither intervention altered S-adenosylhomocysteine concentration. DNA methyltransferase (DNMT) activity increased with intake of folic acid raised DNMT activity in folate-deficient mice. DNA methylation rate was stimulated by folic acid in the amyloid precursor protein (APP) promoter and in the presenilin 1 (PS1) promoter. Folate deficiency elevated hippocampal APP, PS1 and Aβ protein levels, and these rises were prevented by folic acid. In conclusion, these findings are consistent with a mechanism in which folic acid increases methylation potential and DNMT activity, modifies DNA methylation and ultimately decreases APP, PS1 and Aβ protein levels. © 2015 Elsevier Inc. All rights reserved. Keywords: Alzheimer's disease; Amyloid β-peptide; DNA methylation; Folic acid; S-adenosylmethionine
1. Introduction Alzheimer’s disease (AD) is a neurodegenerative disease resulting in progressive dementia and is a principal cause of dementia among older adults. It may be triggered, at least in part, by accumulation in the brain’s gray matter of amyloid plaques that contain extracellular deposits of amyloid-β peptides (Aβ) [1]. Aβ also may be transported within neurons and cause axonal deficits there [2]. AD has a non-Mendelian etiology that eventually may be explained by epigenetic modifications acting to mediate the disease’s onset and progression [3]. DNA methylation is an example of epigenetic modification for which a role in AD is beginning to be elucidated [4,5]. For instance, it has been reported that an age-specific epigenetic
Abbreviations: Aβ, amyloid β-peptide; AD, Alzheimer’s disease; APP, amyloid precursor protein; APP/PS1 mice, mice with APPswe/PS1ΔE9 mutations; DNMT, DNA methyltransferase; HCY, homocysteine; IOD, integrated optical density; OD, optical density; ORF, open reading frame; PBS, phosphate-buffered saline; PS1, presenilin 1; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; UTR, untranslated region. ⁎ Corresponding author at: Department of Nutrition and Food Science, School of Public Health, Tianjin Medical University, 22 Qixiangtai Road, Heping District, Tianjin 300070, China. Tel.: +86 22 83336606; fax: +86 22 83336603. E-mail address: [email protected] (G. Huang). http://dx.doi.org/10.1016/j.jnutbio.2015.03.009 0955-2863/© 2015 Elsevier Inc. All rights reserved.
drift occurs in late-onset AD [6]. Further, there are DNA methylation differences between late-onset AD and cognitively normal controls in human frontal cortex [7]. In particular, the PS1 gene is a specific locus of demethylation in AD patients. Since gene expression and silencing may depend on DNA methylation in promoter regions, it is possible that aberrant DNA methylation may underlie AD pathogenesis [3]. DNA methylation is catalyzed by DNA methyltransferase (DNMT). The methyl donor for DNMT reactions is S-adenosylmethionine (SAM), which is the precursor of S-adenosylhomocysteine (SAH) [8]. SAM stimulates and SAH inhibits the transfer by DNMT of methyl groups on the cytosine residues of DNA. Folate is integral to one-carbon metabolism [i.e., the homocysteine (HCY) cycle], which is a biochemical pathway wherein SAM is an intermediate [3]. There is currently no cure for AD. However, because malnutrition is a well-established risk factor for cognitive impairment, there is a strong rationale to search for nutritional interventions for AD and to understand their molecular mechanisms of action [9–12]. In particular, preclinical research is needed to discover how nutrients modulate Aβ accumulation in AD models. A recent meta-analysis found that supplementation with combinations of folic acid and vitamin B12 had no significant effect on age-related cognitive decline (i.e., cognitive aging) in older adult participants [13]. However, the randomized controlled trial that supplemented older adults with folic acid alone (without vitamin B12) found that folic acid conferred significant protection against cognitive aging [14]. Furthermore,
2
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Chan et al. reported that a nutriceutical formulation that contained folic acid, SAM, vitamin B12, vitamin E, N-acety-L-cysteine and acetylL-carnitine holds promise for treatment of early-stage AD prior to and/ or as a supplement for pharmacological approaches [15]. In the present study, we hypothesized that folic acid acts through an epigenetic gene silencing mechanism to lower Aβ levels in the APP/ PS1 transgenic mouse model of AD, and exogenous SAM in mice which intake control diet had no more effect then folic acid. 2. Materials and methods 2.1. Mice and diets The Tianjin Medical University Animal Ethics Committee approved the experimental protocols in this study (number TMUaMEC 2012016). Male mice with APPswe/ PS1ΔE9 mutations (APP/PS1), backcrossed to C57Bl6/J, were obtained from the Chinese Academy of Medical Sciences Institute of Laboratory. These double transgenic mice are models of AD because they express a chimeric mouse/human amyloid precursor protein (Mo/HuAPP695swe) and a mutant human presenilin 1 (PS1-dE9), both directed to central nervous system neurons under the control of independent mouse prion protein promoter elements; consequently, young adult APP/PS1 mice have Aβ-containing neuritic plaques that are absent in age-matched wild-type mice. After genotyping, the AD transgenic mice were maintained on the control diet until age 7 months and then were assigned in equal numbers to five groups for 60 days: (a) folate-deficient diet plus daily gavage with water (Def), (b) control diet (normal folic acid content) plus daily gavage with water (Con), (c) control diet plus daily gavage with 13.3 mg/kg SAM (Con+SAM), (d) control diet plus daily gavage with 120 μg/kg folic acid (Con+FA) and (e) control diet plus daily gavage with both 120 μg/kg folic acid and 13.3 mg/kg SAM (Con+FA+SAM). The folate-deficient diet (containing folic acid 0.2 mg/kg diet) and the control diet (folic acid 2.1 mg/kg diet) were purchased from TestDiet (St. Louis, MO. USA). All mice received food and drinking water ad libitum. At the conclusion of the experiment, the mice were anesthetized by intraperitoneal injection of 7% chloral hydrate (5 ml/kg) and perfused transcardially with phosphate-buffered saline (PBS). The thorax was opened to collect ventricular blood by cardiac puncture after anesthetizing. Brains were removed, bisected in the sagittal plane and stored at −80°C. The left tissue was used for immunofluorescence staining, and the right tissue was used for other assays, as described below. Livers were also removed and stored at −80°C until analysis. 2.2. Serum folate Serum folate levels were determined using a competitive protein-binding assay with chemiluminescent detection in an automated chemiluminescence system (Immulite 1000; Siemens, Berlin, Germany) according to the manufacturer’s instructions. The automated chemiluminescence system would detect all types of folate including folic acid, dihydrofolate and tetrahydrofolate [16]. A high-folic-acid standard and a low-folic-acid standard provided in the kit were used to correct the automated chemiluminescence system. Because the examination area of this system is 1–24 ng/ml and serum folate level of mice was higher, serum samples were diluted two times by 0.9% saline. 2.3. Real-time polymerase chain reaction (PCR) Gene expression was quantified by real-time PCR. Total RNA of brain hippocampus tissues [homogenate by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland)] was extracted using Trizol according to the instructions of the manufacturer. First-strand cDNA was synthesized from 2 μg total RNA using MMLV reverse transcriptase. The 20-μl reaction volume was incubated for 60 min at 42°C and 10 min at 70°C, and held at −20°C. Real-time PCR was performed using a LightCycler 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). The 20-μl PCR mixture included 10 μl of PCR Master, 5 μl of cDNA, 1 μl of forward primer, 1 μl of reverse primer and 3 μl of water (PCR grade). The reaction mixtures were incubated at 95°C for 5 min, followed by 45 amplification cycles (denaturation, 95°C for 10 s; annealing, 59°C for APP and 63°C for PS1 for 10 s; extension, 72°C for 10 s). Primers were specific for APP (forward, GGCAACAGGAACTTTGA; reverse, CTGCTGTCGGGGAAGTTTA) and PS1 (forward, CCCCA GAGTAACTCAAG ACA; reverse, CCGGGTATAGAAGCTGACTGA). The assay was performed using the Roche LightCycler 480 sequence detector (Roche, Mannheim, Germany). The expression of each gene was normalized to β-actin (forward, AATGTGTCCGTCGTG GATCT; reverse, GGTCCTCAGTGTAGCCCAA G) in order to calculate relative levels of transcripts. 2.4. Western blot analysis Protein expression of APP, PS1 and Aβ was assessed by Western blot analysis. The brain hippocampus tissues [homogenate by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland)] were washed with ice-cold PBS and lysed with TNE-NP40 buffer. Proteins were separated on 10% sodium dodecyl sulfate polyacrylamide gel by electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat milk and incubated with
primary antibodies [anti-APP (for detecting APP695, APP770 and APP751), 1:1000, CST (Danvers, MA, USA); anti-PS1, 1:1000, Abcam (Cambridge, UK); anti-Aβ antibody (Bam-10), 1:1000 (Sigma Aldrich; St. Louis, MO, USA)] overnight at 4°C, followed with appropriate secondary antibodies (IgG-horseradish peroxidase; Zhongshan Goldbridge Biotechnology, Beijing, China) for l h at room temperature. Proteins were detected by chemiluminescence assay and then quantified by densitometric analysis using NIH Image software (version 1.61). The intensity of each protein band was normalized to the respective β-actin band. 2.5. Immunohistochemistry The left brains were removed and postfixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at 4°C overnight. The brains were cut coronally into 4-μmthick sections with a vibratome. Free-floating sections were incubated with 4% bovine serum albumin in PBS for 1 h and then reacted with mouse monoclonal anti-Aβ antibody (Bam-10), 1:200 (Sigma Aldrich; St. Louis, MO, USA); anti-APP, 1:100 (Cell Signaling Technology, Danver, MA, USA); or anti-PS1, 1:1000, Abcam (Cambridge, UK) at 4°C overnight. The Bam-10 antibody recognizes the epitope for the N-terminus (1–12 amino acid residues) of Aβ (1–42) and Aβ (1–40) and specifically stains amyloid plaques in the brains of AD mouse models. The anti-APP antibody detects APP695, APP770 and APP751. The sections were washed with PBS and reacted with biotinylated secondary antibodies diluted 1:200 in PBS and visualized using ABC Elite kit (Vector Laboratories, Burlingame, CA, USA). The images were obtained with a microscope (Olympus, Tokyo, Japan), and the integrated optical density (IOD) of each was determined with Image-Pro Plus Version 6.0 image analysis software. 2.6. Pyrosequencing Methylation levels of CpG sites in APP and PS1 promoter regions were determined by pyrosequencing using the Pyromark Q24 Reagent (QIAGEN Ltd., Crawley, UK) according to the manufacturer’s protocol. Tissues were digested with 100 μg/ml proteinase K at 50°C overnight, followed by phenol/chloroform extraction and ethanol precipitation of DNA. Then, incubation of the DNA with sodium bisulfite converted unmethylated cytosine residues into uracil while leaving methylated cytosines unchanged. Real-time PCR was performed using a LightCycler 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). The 25-μl PCR mixture included 12.5 μl of Pyromark PCR Master, 2.5 μl of coralload concentrate, 1 μl of DNA, 2.5 μl of forward primer, 2.5 μl of reverse primer and 4 μl of water (PCR grade). The reaction mixtures were incubated at 95°C for 15 min, followed by 45 amplification cycles (94°C for 30 s, 56°C for 30 s, 72°C for 30 s). Primers were specific for APP (forward, TGATTTGGGTTAGGGAGAGG; reverse, AACCTTAACTCCTCAACCA CATTTA) and PS1 (forward, GGGGTTGGAGTTGGTTTAA; reverse, AAACCCATCC TTTCCTACAA). 2.7. DNMT activity assay Nuclear extracts of right hippocampal tissue were isolated using the nuclear extraction kit (Merck KGaA, Darmstadt, Germany). DNMT activity was measured using a DNMT activity/inhibition assay kit according to the manufacturer’s instructions (Active Motif, Carlsbad, CA, USA). A lot-specific standard curve was created with the DNMT1 provided in the kit. Optical density (OD) was measured on a microplate reader at 450 nm, and DNMT activity [(OD/(h·mg)]was calculated according to the following formula: DNMT activity ðOD=h=mgÞ ¼
ðaverage sample OD−average blank ODÞ 1000 protein amountðgÞ h
⁎ Protein amount added into the reaction. ⁎⁎ Incubation time used for the reaction. 2.8. Methylation potential assay SAM, SAH and the SAM:SAH ratio (i.e., methylation potential) were determined in liver and brain tissue samples that were stored at −80°C and then thawed for analysis. The liver and brain tissue samples were homogenized by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland) and kept on ice. Onehundred-milligram extracts of liver tissue or brain tissue were removed to new tube and resuspended in 300 μl 0.4 mol/L ice-cold perchloric acid. Liver cytosolic protein was obtained using a water bath sonicator (Bioruptor UCD-200, Diagenode). Homogenates were centrifuged at 20,000 g for 10 min at 4°C, and supernatant were collected. The supernatant of each sample was filtered through 0.45 μm (Millipore, Billerica, MA, USA) and then was loaded into a Venusil MP-C18 column (250 mm×4.6 mm, 5-μm particle; Agela Technologies, Wilmington, DE, USA) fitted with a matched guard column, run by a Waters HPLC system (Milford, MA, USA) and connected to an ultraviolet detector. Absorption of eluted compounds was monitored at λ=254 nm. A two-buffer elution system was used: mobile phase A and B; both contain 10 mmol/L ammonium formate and 4 mmol/L 1-heptanesulfonic acid (pH=4). Mobile phase B contains
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
50% acentonitrile by volume. Elution of SAM and SAH was achieved at a flow rate of 1 ml/min with the following parameters: 0–0.5 min, 100% A; 0.5–20 min, linear gradient to 75% A and 25% B; 20–30 min, 25% B; 30–45 min, 100% A. Chromatograms were recorded by a Hewlett-Packard HP3394 integrator with its quantification accomplished by automatic peak area integration. SAM and SAH standards were used to identify the elution peaks [17]. 2.9. Statistical analysis The data were expressed as mean±S.D. and analyzed using the SPSS (Chicago, IL, USA) 13.0 software package. One-way analysis of variance and the Student–Newman– Keuls test for multiple comparisons were used to determine significant differences among the experimental groups. The criterion for statistical significance was Pb.05.
3. Results 3.1. Body weight and serum folate concentration All mice gained weight and had no detectable morbidity. There were no between-group differences in body weight. The final body weights for the Def, Con, Con+SAM, Con+FA and Con+FA+SAM goups were 35.8± 3.4 g, 34.7±3.0 g, 35.0±3.7 g, 34.9±2.8 g and 35.6±3.4 g, respectively. The serum folate concentration at the end of 60 days of diet and gavage treatments was lower in the folate-deficient diet group of mice than in the control group (compare Def to Con in Fig. 1). Supplementation by folic acid gavage raised the serum folate concentration (compare Con to Con+FA in Fig. 1). In contrast, gavaging with SAM had no effect on serum folate (compare Con to Con+SAM, and Con+FA to Con+FA+SAM in Fig. 1). 3.2. APP and PS1 expression Immunohistochemical analysis of hippocampal sections showed that the levels of APP and PS1 proteins were elevated in the folatedeficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these proteins (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease APP and PS1 protein levels significantly in the control group (compare Con to Con+SAM in Figs. 2–3). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). Real-time PCR showed that APP and PS1 gene expression levels were elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these genes (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease PS1 gene expression significantly in the control group (compare Con to Con+SAM in Fig. 3C); however, SAM gavage decreased APP gene expression significantly in the control group (compare Con to Con+SAM in Fig. 2C). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). Western blot analysis showed that the protein expression of APP and PS1 was elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these proteins (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease PS1 protein expression significantly in the control group (compare Con to Con+SAM in Figs. 2–3); however, SAM gavage decreased APP protein expression significantly in the control group (compare Con to Con+SAM in Figs. 2–3). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). 3.3. Aβ expression Immunohistochemical analysis of hippocampal sections showed that the levels of Aβ protein were elevated in the folate-deficient diet
3
group relative to the control group (compare Def to Con in Fig. 4A, B). Conversely, folic acid gavage decreased the expression of Aβ protein (compare Con to Con+FA in Fig. 4A, B). SAM gavage did not decrease Aβ protein levels significantly in the control group (compare Con to Con+SAM in Fig. 4A, B). The effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 4A, B). Western blot analysis also showed that the protein expression of Aβ was elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Fig. 4C, D). Folic acid gavage decreased the expression of Aβ protein; however, SAM gavage did not decrease this protein expression significantly in the control group (compare Con to Con+FA or Con+SAM in Fig. 4C, D). The effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 4C, D). 3.4. DNA methylation Pyrosequencing assay data were evaluated by dividing the APP and PS1 promoters into 13 and 10 CpG sites, respectively (Fig. 5A, C). DNA methylation rate was lower in the folate-deficient diet group of mice than the control group at the 10th and 13th CpG sites in APP and also at the 6th, 8th and 10th sites in PS1 (compare Def to Con in Fig. 5B, D). Relative to the folate-deficient diet plus water gavage, the control diet plus folic acid gavage led to higher DNA methylation rates at the 10th and 13th sites in APP and the 6th, 8th, 9th and 10th sites in PS1 (compare Def to Con+FA in Fig. 5B, D). In mice fed the control diet, folic acid gavage increased the DNA methylation rate at the 13th site in APP (compare Con to Con+FA in Fig. 5B). However, SAM gavage did not elevate DNA methylation rate at one CpG site in the PS1 promoter and APP promoter significantly in the control diet (compare Con to Con+SAM in Fig. 5B, D). The effect of gavaging with both folic acid and SAM increased the DNA methylation rate at the 13th site in APP and 8th site in PS1 (compare Con to Con+FA+SAM in Fig. 5B, D). 3.5. DNMT activity DNMT activity was lowest for the folate-deficient diet group (Def), intermediate for the control group (Con) and highest for the group in which folic acid was supplied by both diet and gavage (Con+FA)
Fig. 1. Responses of serum folate concentration to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated for 60 days with folate-deficient diet plus daily gavage with water (Def); control diet plus daily gavage with water (Con); control diet plus daily gavage with 13.3 mg/kg SAM (Con+SAM); control diet plus daily gavage with 120 μg/kg folic acid (Con+FA); and control diet plus daily gavage with 120 μg/kg folic acid and 13.3 mg/kg SAM (Con+FA+SAM). Plotted are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
4
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Fig. 2. Folic acid modulates the expression of APP in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and APP was detected by immunohistochemistry. (B) Summary of APP expression levels shows mean±S.D. for IOD of immunoreactive APP (n=5 mice/group). (C) Gene expression levels of APP in brains of APP/PS1 mice (n=5 mice/group). (D) Representative Western blots of APP and actin proteins in APP/PS1 mice. (E) Summaries of densitometric analyses of Western blots of APP protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
(Fig. 6). SAM gavage did not increase DNMT activity more in the folate-control diet group (compare Con to Con+SAM and Con+FA to Con+FA+SAM in Fig. 6). 3.6. Methylation potential SAM and SAH concentrations were detected in mouse livers and brains. Analysis of mouse livers showed that SAH concentration was not affected by any of the interventions tested (Fig. 7B). However, folate deficiency decreased SAM concentration and methylation potential (compare Def to Con in Fig. 7A, C). Conversely, gavaging
with SAM, folic acid or both did not alter SAM concentration and methylation potential in mice fed the control diet (compare Con to Con+SAM, Con+FA and Con+FA+SAM in Fig. 7A, C). Analysis of mouse brains showed that folate deficiency could decrease SAM concentration, increase SAH concentration and consequently decrease methylation potential (compare Def to Con in Fig. 7D–F). Conversely, gavaging with folic acid increased SAM concentration, decreased SAH concentration and consequently increased methylation potential in mice fed the control diet (compare Con to Con+FA in Fig. 7D–F). SAM gavage did not increase SAM concentration in mice brain tissue; however, SAM gavage decreased
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
5
Fig. 3. Folic acid modulates the expression of PS1 in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and PS1 was detected by immunohistochemistry. (B) Summary of PS1 expression levels shows mean±S.D. for IOD of immunoreactive PS1 (n=5 mice/group). (C) Gene expression levels of PS1 in brains of APP/PS1 mice (n=5 mice/group). (D) Representative Western blots of PS1 and actin proteins in APP/PS1 mice. (E) Summaries of densitometric analyses of Western blots of PS1 protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
SAH concentration and increased methylation potential in mice brain tissue significantly in the control group (compare Con to Con+SAM in Fig. 7D–F). However, the effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 7D–F).
4. Discussion The present study found that folic acid decreased the abundance of APP, PS1 and Aβ in the hippocampus of AD transgenic mice. This inhibitory effect of folic acid was associated with increased methylation potential and DNMT activity as well as with altered DNA methylation in APP and PS1 promoters.
It is plausible that the folate- and SAM-induced decreases in Aβ accumulation were the consequences of decreased Aβ production. The present findings support the hypothesis that inhibition by folic acid of Aβ accumulation is mediated by an epigenetic mechanism because DNA methylation rate in the APP and PS1 promoters increased with amount of folic acid ingested from diet and gavage. The increased DNA methylation rates may have silenced APP and PS1 gene expression, as indicated by the decreased levels of APP and PS1 proteins in the mice that received folic acid and/or SAM. Aβ production depends on APP and PS1 because PS1 is a component of the enzyme that cleaves APP to produce various Aβ isoforms [1]. Taken together, these findings are consistent with a mechanism in which folic acid inhibits Aβ production through increases in methylation potential, DNMT activity, DNA methylation rate in APP and PS1 promoters, and gene silencing of APP and PS1.
6
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Fig. 4. Folic acid modulates the expression of Aβ in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and Aβ was detected by immunohistochemistry. (B) Summary of Aβ expression levels shows mean±S.D. for IOD of immunoreactive Aβ (n=5 mice/group). (C) Representative Western blots of Aβ and actin proteins in APP/PS1 mice. (D) Summaries of densitometric analyses of Western blots of Aβ protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
In contrast to the effectiveness of folic acid, SAM supplementation failed to significantly stimulate DNMT activity and methylation potential, or inhibit APP, PS1 and Aβ levels, in mice that received the control diet or the combination of control diet and folic acid gavage. The probable reason of failure to observe more effects of exogenous SAM in mice which intake control diet was even mice intake control diet which contained normal folate would have responded to SAM supplementation if the dose of SAM had been higher. The study of Chan et al. reported that a nutriceutical formulation which consisted of folic acid, SAM, vitamin B12, vitamin E, N-acety-L-cysteine and acetyl-L-carnitine holds promise for treatment of early-stage AD prior to and/or as a supplement for pharmacological approaches [15]. Patients with AD have been administered a higher amount of SAM per kilogram of body weight than was given daily to the mice of the present study. So there needs further investigation. The present study adds to mounting evidence of an essential role of folate-modulated DNA methylation in the prevention of experimental AD progression [18]. In the TgCRND8 mouse model of AD, for example, feeding a diet deficient in folate, vitamin B6 and vitamin B12 led to decreased methylation potential, DNMT activity and PS1 promoter DNA methylation rate; conversely, the deficient diet increased PS1 expression, Aβ accumulation and cognitive impairment [3,19]. One-carbon metabolism was further implication by the finding that supplementation with SAM (maximal effective dose was 400 μg/mouse/day) largely
abolished these effects of the multivitamin-deficient diet [3,19]. Similarly, in the 3xTg-AD mouse model of AD, SAM supplementation lowered hippocampal Aβ accumulation and improved cognitive performance [20]. A limitation of the present study arises from its focus on interventions to lessen Aβ accumulation. Although Aβ accumulation is an early component in the pathogenesis of AD, it may be less important in later stages of the disease. The strongest correlation between amyloid plaques and cognition is observed in early stages of human AD [21]. The transient nature of Aβ’s role in AD pathogenesis is underlined by recent phase 3 trials in which a humanized antiamyloid-beta monoclonal antibody failed to improve clinical outcomes in patients with AD [22]. Folic acid may support other therapeutic mechanisms in AD besides prevention of Aβ accumulation. For instance, low B vitamin levels and high HCY levels are common in patients with AD [23]. Hyperhomocysteinemia may be a cause of elevated SAH concentration in the brains of AD patients [24]. The excessive SAH may inhibit DNMT and thereby contribute to hypomethylation of DNA [24,25]. Also, elevated HCY concentration is associated with memory impairment in mouse models of AD [26] and the induction of cytotoxicity and inhibited cell proliferation in neural stem cells [27]. Folate may confer neuroprotection because it acts as a cofactor in the elimination of HCY by the latter’s remethylation [3]. Another potentially neuroprotective
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
7
Fig. 5. Responses of DNA methylation levels in APP and PS1 genes to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated as described in Fig. 1. (A) Schematic diagram of APP. The transcripts were composed of 5’-untranslated region (UTR) with internal promoter activity, open reading frame (ORF) and a 3’-UTR. PCR primers were designed on the basis of the reverse complementary strands of these fragments. (B) Mean methylation levels of CpG sites in APP gene as determined by pyrosequencing in brain tissue. Numbers refer to the locations of CpG sites. (C) Schematic diagram of PS1. (D) Mean methylation levels of CpG sites in PS1 gene as determined by pyrosequencing in brain tissue. The plotted values are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
effect is that folate acts through DNMT to modulate DNA methylation and stimulate neural stem cell proliferation [28,29]. A second limitation of the present study is its use of a preclinical model, namely, the APP/PS1 mouse, which is an imperfect model of the molecular and cognitive changes observed in human AD [21]. For
Fig. 6. Responses of DNMT activity to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated as described in Fig. 1. The plotted values are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
example, blood–brain barrier changes and deficits in alternation tasks of working memory, which are common in human AD, reportedly do not occur in the APP/PS1 mouse [21,30]. However, the strength of using this AD model is that the cognitive deficits that occur across its lifespan have been well characterized. The number of cognitive deficits increases from age 3 months to 12 months [21]. Nevertheless, it remains uncertain which stages of human AD correspond most closely to those in the 7–9-month-old APP/PS1 mice of the present study. A third limitation of our study is that all parameters were measured at a single time point. The temporal order in which responses to diet and supplementation first occurred is therefore uncertain, and this creates caveats about our interpretations of the observed associations. For instance, we cannot absolutely exclude the possibility that changes in DNA methylation rate could be regulated by Aβ rather than regulate the protein’s accumulation. However, we observed changes in serum folate, methylation potential, DNMT activity, APP and PS1 promoter methylation, and APP and PS1 protein levels that are consistent with the hypothesized causal mechanism for Aβ regulation. In conclusion, the present study found that supplementation with folic acid and/or SAM increases methylation potential and DNMT activity, modifies DNA methylation and ultimately decreases APP, PS1 and Aβ protein levels in APP/PS1 mice. Because these findings are largely consistent with the theoretical mechanisms of action of folic acid and SAM, they may stimulate reinvestigation of folic acid and SAM supplementation as treatments for patients with AD; however, we
8
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
A
80 70
*
*
D 125
50 40 30 20
*#
*#
100
60
SAM (nmol/g)
SAM (nmol/g)
*
*
*
*
75 50 25
10 0
B
0
E
35
16
* *#
12
25
SAH (nmol/g)
SAH (nmol/g)
30
20 15 10
*#
*#
8
4
5 0
C
0
F
3.0
*
*
*
*# *#
10
2.0 1.5 1.0
*#
8
* 6 4
0.5 0.0
14 12
SAM/SAH
SAM/SAH
2.5
*
2 Def
Con
Con+SAM
Con+FA
Con+FA+SAM
0
Def
Con
Con+SAM
Con+FA
Con+FA+SAM
Fig. 7. Responses of SAM, SAH and methylation potential to folate-deficient diet and folic acid and SAM supplements in liver and brain tissue. APP/PS1 mice were treated as described in Fig. 1. (A–C) SAM concentration, SAH concentration and methylation potential (SAM:SAH ratio) in liver (n=5 mice/group). (D–F) SAM concentration, SAH concentration and methylation potential (SAM:SAH ratio) in brain (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
recommend against the administration of SAM supplements to human patients with AD.
Acknowledgments The authors state that they have nothing to disclose and that there are no potential conflicts of interest. This research was supported by a grant from the National Natural Science Foundation of China (No. 81130053).
References [1] De Strooper B, Iwatsubo T, Wolfe MS. Presenilins and γ-secretase: structure, function, and role in Alzheimer disease. Cold Spring Harb Perspect Med 2012; 2(1):a006304. http://dx.doi.org/10.1101/cshperspect.a006304. [2] Christensen DZ, Huettenrauch M, Mitkovski M, Pradier L, Wirths O. Axonal degeneration in an Alzheimer mouse model is PS1 gene dose dependent and linked to intraneuronal Aβ accumulation. Front Aging Neurosci 2014;6:139. http://dx.doi.org/10.3389/fnagi.2014.00139. eCollection 2014. [3] Fuso A. The 'golden age' of DNA methylation in neurodegenerative diseases. Clin Chem Lab Med 2013;51(3):523–34. http://dx.doi.org/10.1515/cclm-2012-0618.
[4] Bennett DA, Yu L, Yang J, Srivastava GP, Aubin C, De Jager PL. Epigenomics of Alzheimer's disease. Transl Res 2014;16. http://dx.doi.org/10.1016/j.trsl.2014.05. 006 [pii: S1931-5244(14)00169-8]. [5] Lunnon K, Mill J. Epigenetic studies in Alzheimer's disease: current findings, caveats, and considerations for future studies. Am J Med Genet B Neuropsychiatr Genet 2013;162B(8):789–99. http://dx.doi.org/10.1002/ajmg.b.32201. [6] Wang SC, Oelze B, Schumacher A. Age-specific epigenetic drift in late-onset Alzheimer’s disease. PLoS One 2008;3(7):e2698. http://dx.doi.org/10.1371/ journal.pone.0002698. [7] Bakulski KM, Dolinoy DC, Sartor MA, Paulson HL, Konen JR, Lieberman AP, et al. Genome-wide DNA methylation differences between late-onset Alzheimer’s disease and cognitively normal controls in human frontal cortex. J Alzheimers Dis 2012;29(3):571–88. http://dx.doi.org/10.3233/JAD-2012-111223. [8] Mandaviya PR, Stolk L, Heil SG. Homocysteine and DNA methylation: a review of animal and human literature. Mol Genet Metab 2014;113(4):243–52. http://dx. doi.org/10.1016/j.ymgme.2014.10.006. [9] Engelborghs S, Gilles C, Ivanoiu A, Vandewoude M. Rationale and clinical data supporting nutritional intervention in Alzheimer's disease. Acta Clin Belg 2014; 69(1):17–24. http://dx.doi.org/10.1179/0001551213Z.0000000006. [10] Jansen D, Zerbi V, Arnoldussen IA, Wiesmann M, Rijpma A, Fang XT, et al. Effects of specific multi-nutrient enriched diets on cerebral metabolism, cognition and neuropathology in AβPPswe-PS1dE9 mice. PLoS One 2013;8(9):e75393. http:// dx.doi.org/10.1371/journal.pone.0075393 [eCollection 2013]. [11] Moore EM, Ames D, Mander AG, Carne RP, Brodaty H, Woodward MC, et al. Among vitamin B12 deficient older people, high folate levels are associated with worse cognitive function: combined data from three cohorts. J Alzheimers Dis 2014; 39(3):661–8. http://dx.doi.org/10.3233/JAD-131265.
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
[12] Thaipisuttikul P, Galvin JE. Use of medical foods and nutritional approaches in the treatment of Alzheimer's disease. Clin Pract (Lond) 2012;9(2):199–209. [13] Clarke R, Bennett D, Parish S, Lewington S, Skeaff M, Eussen SJ, et al. Effects of homocysteine lowering with B vitamins on cognitive aging: meta-analysis of 11 trials with cognitive data on 22,000 individuals. Am J Clin Nutr 2014;100(2): 657–66. [14] Durga J, van Boxtel MP, Schouten EG, Kok FJ, Jolles J, Katan MB, et al. Effect of 3-year folic acid supplementation on cognitive function in older adults in the FACIT trial: a randomised, double blind, controlled trial. Lancet 2007;369(9557):208–16. [15] Chan A, Paskavitz J, Remington R, Rasmussen S, Shea TB. Efficacy of a vitamin/ nutriceutical formulation for early-stage Alzheimer's disease: a 1-year, open-label pilot study with an 16-month caregiver extension. Am J Alzheimers Dis Other Demen 2008;23(6):571–85. http://dx.doi.org/10.1177/1533317508325093. [16] Strain JJ, Dowey L, Ward M, Pentieva K, McNulty H. B-vitamins, homocysteine metabolism and CVD. Proc Nutr Soc 2004;63(4):597–603. [17] Song Z, Zhou Z, Song M, Uriarte S, Chen T, Deaciuc I, et al. Alcohol-induced S-adenosylhomocysteine accumulation in the liver sensitizes to TNF hepatotoxicity: possible involvement of mitochondrial S-adenosylmethionine transport. Biochem Pharmacol 2007;74(3):521–31. [18] Mastroeni D, Grover A, Delvaux E, Whiteside C, Coleman PD, Rogers J. Epigenetic mechanisms in Alzheimer’s disease. Neurobiol Aging 2011;32(7):1161–80. http://dx.doi.org/10.1016/j.neurobiolaging.2010.08.017. [19] Fuso A, Nicolia V, Ricceri L, Cavallaro RA, Isopi E, Mangia F, et al. S-adenosylmethionine reduces the progress of the Alzheimer-like features induced by B-vitamin deficiency in mice. Neurobiol Aging 2012;33(7):1482.e1–1482.e16. http://dx.doi.org/10.1016/j. neurobiolaging.2011.12.013. [20] Lee S, Lemere CA, Frost JL, Shea TB. Dietary supplementation with S-adenosyl methionine delayed amyloid-β and tau pathology in 3xTg-AD mice. J Alzheimers Dis 2012;28(2):423–31. http://dx.doi.org/10.3233/JAD-2011-111025. [21] Webster SJ, Bachstetter AD, Nelson PT, Schmitt FA, Van Eldik LJ. Using mice to model Alzheimer's dementia: an overview of the clinical disease and the preclinical behavioral changes in 10 mouse models. Front Genet 2014;5:88. http://dx.doi.org/10.3389/fgene.2014.00088. eCollection 2014.
9
[22] Salloway S, Sperling R, Fox NC, Blennow K, Klunk W, Raskind M, et al. Two phase 3 trials of bapineuzumab in mild-to-moderate Alzheimer's disease. N Engl J Med 2014;370(4):322–33. http://dx.doi.org/10.1056/NEJMoa1304839. [23] Faux NG, Ellis KA, Porter L, Fowler CJ, Laws SM, Martins RN, et al. Homocysteine, vitamin B12, and folic acid levels in Alzheimer's disease, mild cognitive impairment, and healthy elderly: baseline characteristics in subjects of the Australian Imaging Biomarker Lifestyle study. J Alzheimers Dis 2011;27(4): 909–22. http://dx.doi.org/10.3233/JAD-2011-110752. [24] Kennedy BP, Bottiglieri T, Arning E, Ziegler MG, Hansen LA, Masliah E. Elevated S-adenosylhomocysteine in Alzheimer brain: influence on methyltransferases and cognitive function. J Neural Transm 2004;111(4):547–67. [25] Chouliaras L, Mastroeni D, Delvaux E, Grover A, Kenis G, Hof PR, et al. Consistent decrease in global DNA methylation and hydroxymethylation in the hippocampus of Alzheimer's disease patients. Neurobiol Aging 2013;34(9):2091–9. http://dx. doi.org/10.1016/j.neurobiolaging.2013.02.021. [26] Sudduth TL, Weekman EM, Brothers HM, Braun K, Wilcock DM. β-Amyloid deposition is shifted to the vasculature and memory impairment is exacerbated when hyperhomocysteinemia is induced in APP/PS1 transgenic mice. Alzheimers Res Ther 2014;6(3):32. http://dx.doi.org/10.1186/alzrt262. eCollection 2014. [27] Lin N, Qin S, Luo S, Cui S, Huang G, Zhang X. Homocysteine induces cytotoxicity and proliferation inhibition in neural stem cells via DNA methylation in vitro. FEBS J 2014;281(8):2088–96. http://dx.doi.org/10.1111/febs.12764. [28] Li W, Yu M, Luo S, Liu H, Gao Y, Wilson JX, et al. DNA methyltransferase mediates dose-dependent stimulation of neural stem cell proliferation by folate. J Nutr Biochem 2013;24(7):1295–301. http://dx.doi.org/10.1016/j.jnutbio.2012.11.001. [29] Yu M, Li W, Luo S, Zhang Y, Liu H, Gao Y, et al. Folic acid stimulation of neural stem cell proliferation is associated with altered methylation profile of PI3K/Akt/CREB. J Nutr Biochem 2014;25(4):496–502. http://dx.doi.org/10.1016/j.jnutbio.2013.12.010. [30] Do TM, Alata W, Dodacki A, Traversy MT, Chacun H, Pradier L, et al. Altered cerebral vascular volumes and solute transport at the blood-brain barriers of two transgenic mouse models of Alzheimer's disease. Neuropharmacology 2014;81: 311–7. http://dx.doi.org/10.1016/j.neuropharm.2014.02.010.
ScienceDirect Journal of Nutritional Biochemistry xx (2015) xxx – xxx
Folic acid administration inhibits amyloid β-peptide accumulation in APP/PS1 transgenic mice Wen Li a , Huan Liu a , Min Yu a , Xumei Zhang a , Meilin Zhang a , John X. Wilson b , Guowei Huang a,⁎ b
a Department of Nutrition and Food Science, School of Public Health, Tianjin Medical University, Tianjin, China Department of Exercise and Nutrition Sciences, School of Public Health and Health Professions, University at Buffalo, Buffalo, NY, USA
Received 9 September 2014; received in revised form 24 February 2015; accepted 31 March 2015
Abstract Alzheimer's disease (AD) is associated with malnutrition, altered one-carbon metabolism and increased hippocampal amyloid-β peptide (Aβ) accumulation. Aberrant DNA methylation may be an epigenetic mechanism that underlies AD pathogenesis. We hypothesized that folic acid acts through an epigenetic gene silencing mechanism to lower Aβ levels in the APP/PS1 transgenic mouse model of AD. APP/PS1 mice were fed either folate-deficient or control diets and gavaged daily with 120 μg/kg folic acid, 13.3 mg/kg S-adenosylmethionine (SAM) or both. Examination of the mice after 60 days of treatment showed that serum folate concentration increased with intake of folic acid but not SAM. Folate deficiency lowered endogenous SAM concentration, whereas neither intervention altered S-adenosylhomocysteine concentration. DNA methyltransferase (DNMT) activity increased with intake of folic acid raised DNMT activity in folate-deficient mice. DNA methylation rate was stimulated by folic acid in the amyloid precursor protein (APP) promoter and in the presenilin 1 (PS1) promoter. Folate deficiency elevated hippocampal APP, PS1 and Aβ protein levels, and these rises were prevented by folic acid. In conclusion, these findings are consistent with a mechanism in which folic acid increases methylation potential and DNMT activity, modifies DNA methylation and ultimately decreases APP, PS1 and Aβ protein levels. © 2015 Elsevier Inc. All rights reserved. Keywords: Alzheimer's disease; Amyloid β-peptide; DNA methylation; Folic acid; S-adenosylmethionine
1. Introduction Alzheimer’s disease (AD) is a neurodegenerative disease resulting in progressive dementia and is a principal cause of dementia among older adults. It may be triggered, at least in part, by accumulation in the brain’s gray matter of amyloid plaques that contain extracellular deposits of amyloid-β peptides (Aβ) [1]. Aβ also may be transported within neurons and cause axonal deficits there [2]. AD has a non-Mendelian etiology that eventually may be explained by epigenetic modifications acting to mediate the disease’s onset and progression [3]. DNA methylation is an example of epigenetic modification for which a role in AD is beginning to be elucidated [4,5]. For instance, it has been reported that an age-specific epigenetic
Abbreviations: Aβ, amyloid β-peptide; AD, Alzheimer’s disease; APP, amyloid precursor protein; APP/PS1 mice, mice with APPswe/PS1ΔE9 mutations; DNMT, DNA methyltransferase; HCY, homocysteine; IOD, integrated optical density; OD, optical density; ORF, open reading frame; PBS, phosphate-buffered saline; PS1, presenilin 1; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; UTR, untranslated region. ⁎ Corresponding author at: Department of Nutrition and Food Science, School of Public Health, Tianjin Medical University, 22 Qixiangtai Road, Heping District, Tianjin 300070, China. Tel.: +86 22 83336606; fax: +86 22 83336603. E-mail address: [email protected] (G. Huang). http://dx.doi.org/10.1016/j.jnutbio.2015.03.009 0955-2863/© 2015 Elsevier Inc. All rights reserved.
drift occurs in late-onset AD [6]. Further, there are DNA methylation differences between late-onset AD and cognitively normal controls in human frontal cortex [7]. In particular, the PS1 gene is a specific locus of demethylation in AD patients. Since gene expression and silencing may depend on DNA methylation in promoter regions, it is possible that aberrant DNA methylation may underlie AD pathogenesis [3]. DNA methylation is catalyzed by DNA methyltransferase (DNMT). The methyl donor for DNMT reactions is S-adenosylmethionine (SAM), which is the precursor of S-adenosylhomocysteine (SAH) [8]. SAM stimulates and SAH inhibits the transfer by DNMT of methyl groups on the cytosine residues of DNA. Folate is integral to one-carbon metabolism [i.e., the homocysteine (HCY) cycle], which is a biochemical pathway wherein SAM is an intermediate [3]. There is currently no cure for AD. However, because malnutrition is a well-established risk factor for cognitive impairment, there is a strong rationale to search for nutritional interventions for AD and to understand their molecular mechanisms of action [9–12]. In particular, preclinical research is needed to discover how nutrients modulate Aβ accumulation in AD models. A recent meta-analysis found that supplementation with combinations of folic acid and vitamin B12 had no significant effect on age-related cognitive decline (i.e., cognitive aging) in older adult participants [13]. However, the randomized controlled trial that supplemented older adults with folic acid alone (without vitamin B12) found that folic acid conferred significant protection against cognitive aging [14]. Furthermore,
2
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Chan et al. reported that a nutriceutical formulation that contained folic acid, SAM, vitamin B12, vitamin E, N-acety-L-cysteine and acetylL-carnitine holds promise for treatment of early-stage AD prior to and/ or as a supplement for pharmacological approaches [15]. In the present study, we hypothesized that folic acid acts through an epigenetic gene silencing mechanism to lower Aβ levels in the APP/ PS1 transgenic mouse model of AD, and exogenous SAM in mice which intake control diet had no more effect then folic acid. 2. Materials and methods 2.1. Mice and diets The Tianjin Medical University Animal Ethics Committee approved the experimental protocols in this study (number TMUaMEC 2012016). Male mice with APPswe/ PS1ΔE9 mutations (APP/PS1), backcrossed to C57Bl6/J, were obtained from the Chinese Academy of Medical Sciences Institute of Laboratory. These double transgenic mice are models of AD because they express a chimeric mouse/human amyloid precursor protein (Mo/HuAPP695swe) and a mutant human presenilin 1 (PS1-dE9), both directed to central nervous system neurons under the control of independent mouse prion protein promoter elements; consequently, young adult APP/PS1 mice have Aβ-containing neuritic plaques that are absent in age-matched wild-type mice. After genotyping, the AD transgenic mice were maintained on the control diet until age 7 months and then were assigned in equal numbers to five groups for 60 days: (a) folate-deficient diet plus daily gavage with water (Def), (b) control diet (normal folic acid content) plus daily gavage with water (Con), (c) control diet plus daily gavage with 13.3 mg/kg SAM (Con+SAM), (d) control diet plus daily gavage with 120 μg/kg folic acid (Con+FA) and (e) control diet plus daily gavage with both 120 μg/kg folic acid and 13.3 mg/kg SAM (Con+FA+SAM). The folate-deficient diet (containing folic acid 0.2 mg/kg diet) and the control diet (folic acid 2.1 mg/kg diet) were purchased from TestDiet (St. Louis, MO. USA). All mice received food and drinking water ad libitum. At the conclusion of the experiment, the mice were anesthetized by intraperitoneal injection of 7% chloral hydrate (5 ml/kg) and perfused transcardially with phosphate-buffered saline (PBS). The thorax was opened to collect ventricular blood by cardiac puncture after anesthetizing. Brains were removed, bisected in the sagittal plane and stored at −80°C. The left tissue was used for immunofluorescence staining, and the right tissue was used for other assays, as described below. Livers were also removed and stored at −80°C until analysis. 2.2. Serum folate Serum folate levels were determined using a competitive protein-binding assay with chemiluminescent detection in an automated chemiluminescence system (Immulite 1000; Siemens, Berlin, Germany) according to the manufacturer’s instructions. The automated chemiluminescence system would detect all types of folate including folic acid, dihydrofolate and tetrahydrofolate [16]. A high-folic-acid standard and a low-folic-acid standard provided in the kit were used to correct the automated chemiluminescence system. Because the examination area of this system is 1–24 ng/ml and serum folate level of mice was higher, serum samples were diluted two times by 0.9% saline. 2.3. Real-time polymerase chain reaction (PCR) Gene expression was quantified by real-time PCR. Total RNA of brain hippocampus tissues [homogenate by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland)] was extracted using Trizol according to the instructions of the manufacturer. First-strand cDNA was synthesized from 2 μg total RNA using MMLV reverse transcriptase. The 20-μl reaction volume was incubated for 60 min at 42°C and 10 min at 70°C, and held at −20°C. Real-time PCR was performed using a LightCycler 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). The 20-μl PCR mixture included 10 μl of PCR Master, 5 μl of cDNA, 1 μl of forward primer, 1 μl of reverse primer and 3 μl of water (PCR grade). The reaction mixtures were incubated at 95°C for 5 min, followed by 45 amplification cycles (denaturation, 95°C for 10 s; annealing, 59°C for APP and 63°C for PS1 for 10 s; extension, 72°C for 10 s). Primers were specific for APP (forward, GGCAACAGGAACTTTGA; reverse, CTGCTGTCGGGGAAGTTTA) and PS1 (forward, CCCCA GAGTAACTCAAG ACA; reverse, CCGGGTATAGAAGCTGACTGA). The assay was performed using the Roche LightCycler 480 sequence detector (Roche, Mannheim, Germany). The expression of each gene was normalized to β-actin (forward, AATGTGTCCGTCGTG GATCT; reverse, GGTCCTCAGTGTAGCCCAA G) in order to calculate relative levels of transcripts. 2.4. Western blot analysis Protein expression of APP, PS1 and Aβ was assessed by Western blot analysis. The brain hippocampus tissues [homogenate by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland)] were washed with ice-cold PBS and lysed with TNE-NP40 buffer. Proteins were separated on 10% sodium dodecyl sulfate polyacrylamide gel by electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat milk and incubated with
primary antibodies [anti-APP (for detecting APP695, APP770 and APP751), 1:1000, CST (Danvers, MA, USA); anti-PS1, 1:1000, Abcam (Cambridge, UK); anti-Aβ antibody (Bam-10), 1:1000 (Sigma Aldrich; St. Louis, MO, USA)] overnight at 4°C, followed with appropriate secondary antibodies (IgG-horseradish peroxidase; Zhongshan Goldbridge Biotechnology, Beijing, China) for l h at room temperature. Proteins were detected by chemiluminescence assay and then quantified by densitometric analysis using NIH Image software (version 1.61). The intensity of each protein band was normalized to the respective β-actin band. 2.5. Immunohistochemistry The left brains were removed and postfixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at 4°C overnight. The brains were cut coronally into 4-μmthick sections with a vibratome. Free-floating sections were incubated with 4% bovine serum albumin in PBS for 1 h and then reacted with mouse monoclonal anti-Aβ antibody (Bam-10), 1:200 (Sigma Aldrich; St. Louis, MO, USA); anti-APP, 1:100 (Cell Signaling Technology, Danver, MA, USA); or anti-PS1, 1:1000, Abcam (Cambridge, UK) at 4°C overnight. The Bam-10 antibody recognizes the epitope for the N-terminus (1–12 amino acid residues) of Aβ (1–42) and Aβ (1–40) and specifically stains amyloid plaques in the brains of AD mouse models. The anti-APP antibody detects APP695, APP770 and APP751. The sections were washed with PBS and reacted with biotinylated secondary antibodies diluted 1:200 in PBS and visualized using ABC Elite kit (Vector Laboratories, Burlingame, CA, USA). The images were obtained with a microscope (Olympus, Tokyo, Japan), and the integrated optical density (IOD) of each was determined with Image-Pro Plus Version 6.0 image analysis software. 2.6. Pyrosequencing Methylation levels of CpG sites in APP and PS1 promoter regions were determined by pyrosequencing using the Pyromark Q24 Reagent (QIAGEN Ltd., Crawley, UK) according to the manufacturer’s protocol. Tissues were digested with 100 μg/ml proteinase K at 50°C overnight, followed by phenol/chloroform extraction and ethanol precipitation of DNA. Then, incubation of the DNA with sodium bisulfite converted unmethylated cytosine residues into uracil while leaving methylated cytosines unchanged. Real-time PCR was performed using a LightCycler 480 SYBR Green I Master Kit (Roche, Mannheim, Germany). The 25-μl PCR mixture included 12.5 μl of Pyromark PCR Master, 2.5 μl of coralload concentrate, 1 μl of DNA, 2.5 μl of forward primer, 2.5 μl of reverse primer and 4 μl of water (PCR grade). The reaction mixtures were incubated at 95°C for 15 min, followed by 45 amplification cycles (94°C for 30 s, 56°C for 30 s, 72°C for 30 s). Primers were specific for APP (forward, TGATTTGGGTTAGGGAGAGG; reverse, AACCTTAACTCCTCAACCA CATTTA) and PS1 (forward, GGGGTTGGAGTTGGTTTAA; reverse, AAACCCATCC TTTCCTACAA). 2.7. DNMT activity assay Nuclear extracts of right hippocampal tissue were isolated using the nuclear extraction kit (Merck KGaA, Darmstadt, Germany). DNMT activity was measured using a DNMT activity/inhibition assay kit according to the manufacturer’s instructions (Active Motif, Carlsbad, CA, USA). A lot-specific standard curve was created with the DNMT1 provided in the kit. Optical density (OD) was measured on a microplate reader at 450 nm, and DNMT activity [(OD/(h·mg)]was calculated according to the following formula: DNMT activity ðOD=h=mgÞ ¼
ðaverage sample OD−average blank ODÞ 1000 protein amountðgÞ h
⁎ Protein amount added into the reaction. ⁎⁎ Incubation time used for the reaction. 2.8. Methylation potential assay SAM, SAH and the SAM:SAH ratio (i.e., methylation potential) were determined in liver and brain tissue samples that were stored at −80°C and then thawed for analysis. The liver and brain tissue samples were homogenized by a motor-driven tissue homogenizer (PT1200E; Kinematica, Lucerne, Switzerland) and kept on ice. Onehundred-milligram extracts of liver tissue or brain tissue were removed to new tube and resuspended in 300 μl 0.4 mol/L ice-cold perchloric acid. Liver cytosolic protein was obtained using a water bath sonicator (Bioruptor UCD-200, Diagenode). Homogenates were centrifuged at 20,000 g for 10 min at 4°C, and supernatant were collected. The supernatant of each sample was filtered through 0.45 μm (Millipore, Billerica, MA, USA) and then was loaded into a Venusil MP-C18 column (250 mm×4.6 mm, 5-μm particle; Agela Technologies, Wilmington, DE, USA) fitted with a matched guard column, run by a Waters HPLC system (Milford, MA, USA) and connected to an ultraviolet detector. Absorption of eluted compounds was monitored at λ=254 nm. A two-buffer elution system was used: mobile phase A and B; both contain 10 mmol/L ammonium formate and 4 mmol/L 1-heptanesulfonic acid (pH=4). Mobile phase B contains
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
50% acentonitrile by volume. Elution of SAM and SAH was achieved at a flow rate of 1 ml/min with the following parameters: 0–0.5 min, 100% A; 0.5–20 min, linear gradient to 75% A and 25% B; 20–30 min, 25% B; 30–45 min, 100% A. Chromatograms were recorded by a Hewlett-Packard HP3394 integrator with its quantification accomplished by automatic peak area integration. SAM and SAH standards were used to identify the elution peaks [17]. 2.9. Statistical analysis The data were expressed as mean±S.D. and analyzed using the SPSS (Chicago, IL, USA) 13.0 software package. One-way analysis of variance and the Student–Newman– Keuls test for multiple comparisons were used to determine significant differences among the experimental groups. The criterion for statistical significance was Pb.05.
3. Results 3.1. Body weight and serum folate concentration All mice gained weight and had no detectable morbidity. There were no between-group differences in body weight. The final body weights for the Def, Con, Con+SAM, Con+FA and Con+FA+SAM goups were 35.8± 3.4 g, 34.7±3.0 g, 35.0±3.7 g, 34.9±2.8 g and 35.6±3.4 g, respectively. The serum folate concentration at the end of 60 days of diet and gavage treatments was lower in the folate-deficient diet group of mice than in the control group (compare Def to Con in Fig. 1). Supplementation by folic acid gavage raised the serum folate concentration (compare Con to Con+FA in Fig. 1). In contrast, gavaging with SAM had no effect on serum folate (compare Con to Con+SAM, and Con+FA to Con+FA+SAM in Fig. 1). 3.2. APP and PS1 expression Immunohistochemical analysis of hippocampal sections showed that the levels of APP and PS1 proteins were elevated in the folatedeficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these proteins (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease APP and PS1 protein levels significantly in the control group (compare Con to Con+SAM in Figs. 2–3). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). Real-time PCR showed that APP and PS1 gene expression levels were elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these genes (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease PS1 gene expression significantly in the control group (compare Con to Con+SAM in Fig. 3C); however, SAM gavage decreased APP gene expression significantly in the control group (compare Con to Con+SAM in Fig. 2C). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). Western blot analysis showed that the protein expression of APP and PS1 was elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Figs. 2–3). Conversely, folic acid gavage decreased the expression of these proteins (compare Con to Con+FA in Figs. 2–3). SAM gavage did not decrease PS1 protein expression significantly in the control group (compare Con to Con+SAM in Figs. 2–3); however, SAM gavage decreased APP protein expression significantly in the control group (compare Con to Con+SAM in Figs. 2–3). The effect of gavaging with both folic acid and SAM did not differ significantly from gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Figs. 2–3). 3.3. Aβ expression Immunohistochemical analysis of hippocampal sections showed that the levels of Aβ protein were elevated in the folate-deficient diet
3
group relative to the control group (compare Def to Con in Fig. 4A, B). Conversely, folic acid gavage decreased the expression of Aβ protein (compare Con to Con+FA in Fig. 4A, B). SAM gavage did not decrease Aβ protein levels significantly in the control group (compare Con to Con+SAM in Fig. 4A, B). The effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 4A, B). Western blot analysis also showed that the protein expression of Aβ was elevated in the folate-deficient diet group relative to the control group (compare Def to Con in Fig. 4C, D). Folic acid gavage decreased the expression of Aβ protein; however, SAM gavage did not decrease this protein expression significantly in the control group (compare Con to Con+FA or Con+SAM in Fig. 4C, D). The effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 4C, D). 3.4. DNA methylation Pyrosequencing assay data were evaluated by dividing the APP and PS1 promoters into 13 and 10 CpG sites, respectively (Fig. 5A, C). DNA methylation rate was lower in the folate-deficient diet group of mice than the control group at the 10th and 13th CpG sites in APP and also at the 6th, 8th and 10th sites in PS1 (compare Def to Con in Fig. 5B, D). Relative to the folate-deficient diet plus water gavage, the control diet plus folic acid gavage led to higher DNA methylation rates at the 10th and 13th sites in APP and the 6th, 8th, 9th and 10th sites in PS1 (compare Def to Con+FA in Fig. 5B, D). In mice fed the control diet, folic acid gavage increased the DNA methylation rate at the 13th site in APP (compare Con to Con+FA in Fig. 5B). However, SAM gavage did not elevate DNA methylation rate at one CpG site in the PS1 promoter and APP promoter significantly in the control diet (compare Con to Con+SAM in Fig. 5B, D). The effect of gavaging with both folic acid and SAM increased the DNA methylation rate at the 13th site in APP and 8th site in PS1 (compare Con to Con+FA+SAM in Fig. 5B, D). 3.5. DNMT activity DNMT activity was lowest for the folate-deficient diet group (Def), intermediate for the control group (Con) and highest for the group in which folic acid was supplied by both diet and gavage (Con+FA)
Fig. 1. Responses of serum folate concentration to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated for 60 days with folate-deficient diet plus daily gavage with water (Def); control diet plus daily gavage with water (Con); control diet plus daily gavage with 13.3 mg/kg SAM (Con+SAM); control diet plus daily gavage with 120 μg/kg folic acid (Con+FA); and control diet plus daily gavage with 120 μg/kg folic acid and 13.3 mg/kg SAM (Con+FA+SAM). Plotted are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
4
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Fig. 2. Folic acid modulates the expression of APP in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and APP was detected by immunohistochemistry. (B) Summary of APP expression levels shows mean±S.D. for IOD of immunoreactive APP (n=5 mice/group). (C) Gene expression levels of APP in brains of APP/PS1 mice (n=5 mice/group). (D) Representative Western blots of APP and actin proteins in APP/PS1 mice. (E) Summaries of densitometric analyses of Western blots of APP protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
(Fig. 6). SAM gavage did not increase DNMT activity more in the folate-control diet group (compare Con to Con+SAM and Con+FA to Con+FA+SAM in Fig. 6). 3.6. Methylation potential SAM and SAH concentrations were detected in mouse livers and brains. Analysis of mouse livers showed that SAH concentration was not affected by any of the interventions tested (Fig. 7B). However, folate deficiency decreased SAM concentration and methylation potential (compare Def to Con in Fig. 7A, C). Conversely, gavaging
with SAM, folic acid or both did not alter SAM concentration and methylation potential in mice fed the control diet (compare Con to Con+SAM, Con+FA and Con+FA+SAM in Fig. 7A, C). Analysis of mouse brains showed that folate deficiency could decrease SAM concentration, increase SAH concentration and consequently decrease methylation potential (compare Def to Con in Fig. 7D–F). Conversely, gavaging with folic acid increased SAM concentration, decreased SAH concentration and consequently increased methylation potential in mice fed the control diet (compare Con to Con+FA in Fig. 7D–F). SAM gavage did not increase SAM concentration in mice brain tissue; however, SAM gavage decreased
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
5
Fig. 3. Folic acid modulates the expression of PS1 in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and PS1 was detected by immunohistochemistry. (B) Summary of PS1 expression levels shows mean±S.D. for IOD of immunoreactive PS1 (n=5 mice/group). (C) Gene expression levels of PS1 in brains of APP/PS1 mice (n=5 mice/group). (D) Representative Western blots of PS1 and actin proteins in APP/PS1 mice. (E) Summaries of densitometric analyses of Western blots of PS1 protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
SAH concentration and increased methylation potential in mice brain tissue significantly in the control group (compare Con to Con+SAM in Fig. 7D–F). However, the effect of gavaging with both folic acid and SAM did not differ significantly from that of gavaging with folic acid alone (compare Con+FA to Con+FA+SAM in Fig. 7D–F).
4. Discussion The present study found that folic acid decreased the abundance of APP, PS1 and Aβ in the hippocampus of AD transgenic mice. This inhibitory effect of folic acid was associated with increased methylation potential and DNMT activity as well as with altered DNA methylation in APP and PS1 promoters.
It is plausible that the folate- and SAM-induced decreases in Aβ accumulation were the consequences of decreased Aβ production. The present findings support the hypothesis that inhibition by folic acid of Aβ accumulation is mediated by an epigenetic mechanism because DNA methylation rate in the APP and PS1 promoters increased with amount of folic acid ingested from diet and gavage. The increased DNA methylation rates may have silenced APP and PS1 gene expression, as indicated by the decreased levels of APP and PS1 proteins in the mice that received folic acid and/or SAM. Aβ production depends on APP and PS1 because PS1 is a component of the enzyme that cleaves APP to produce various Aβ isoforms [1]. Taken together, these findings are consistent with a mechanism in which folic acid inhibits Aβ production through increases in methylation potential, DNMT activity, DNA methylation rate in APP and PS1 promoters, and gene silencing of APP and PS1.
6
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
Fig. 4. Folic acid modulates the expression of Aβ in APP/PS1 mice. APP/PS1 mice were treated as described in Fig. 1. (A) In hippocampal sections, cell nuclei were stained with Mayer's hemalaun solution (blue), and Aβ was detected by immunohistochemistry. (B) Summary of Aβ expression levels shows mean±S.D. for IOD of immunoreactive Aβ (n=5 mice/group). (C) Representative Western blots of Aβ and actin proteins in APP/PS1 mice. (D) Summaries of densitometric analyses of Western blots of Aβ protein in APP/PS1 mice (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
In contrast to the effectiveness of folic acid, SAM supplementation failed to significantly stimulate DNMT activity and methylation potential, or inhibit APP, PS1 and Aβ levels, in mice that received the control diet or the combination of control diet and folic acid gavage. The probable reason of failure to observe more effects of exogenous SAM in mice which intake control diet was even mice intake control diet which contained normal folate would have responded to SAM supplementation if the dose of SAM had been higher. The study of Chan et al. reported that a nutriceutical formulation which consisted of folic acid, SAM, vitamin B12, vitamin E, N-acety-L-cysteine and acetyl-L-carnitine holds promise for treatment of early-stage AD prior to and/or as a supplement for pharmacological approaches [15]. Patients with AD have been administered a higher amount of SAM per kilogram of body weight than was given daily to the mice of the present study. So there needs further investigation. The present study adds to mounting evidence of an essential role of folate-modulated DNA methylation in the prevention of experimental AD progression [18]. In the TgCRND8 mouse model of AD, for example, feeding a diet deficient in folate, vitamin B6 and vitamin B12 led to decreased methylation potential, DNMT activity and PS1 promoter DNA methylation rate; conversely, the deficient diet increased PS1 expression, Aβ accumulation and cognitive impairment [3,19]. One-carbon metabolism was further implication by the finding that supplementation with SAM (maximal effective dose was 400 μg/mouse/day) largely
abolished these effects of the multivitamin-deficient diet [3,19]. Similarly, in the 3xTg-AD mouse model of AD, SAM supplementation lowered hippocampal Aβ accumulation and improved cognitive performance [20]. A limitation of the present study arises from its focus on interventions to lessen Aβ accumulation. Although Aβ accumulation is an early component in the pathogenesis of AD, it may be less important in later stages of the disease. The strongest correlation between amyloid plaques and cognition is observed in early stages of human AD [21]. The transient nature of Aβ’s role in AD pathogenesis is underlined by recent phase 3 trials in which a humanized antiamyloid-beta monoclonal antibody failed to improve clinical outcomes in patients with AD [22]. Folic acid may support other therapeutic mechanisms in AD besides prevention of Aβ accumulation. For instance, low B vitamin levels and high HCY levels are common in patients with AD [23]. Hyperhomocysteinemia may be a cause of elevated SAH concentration in the brains of AD patients [24]. The excessive SAH may inhibit DNMT and thereby contribute to hypomethylation of DNA [24,25]. Also, elevated HCY concentration is associated with memory impairment in mouse models of AD [26] and the induction of cytotoxicity and inhibited cell proliferation in neural stem cells [27]. Folate may confer neuroprotection because it acts as a cofactor in the elimination of HCY by the latter’s remethylation [3]. Another potentially neuroprotective
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
7
Fig. 5. Responses of DNA methylation levels in APP and PS1 genes to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated as described in Fig. 1. (A) Schematic diagram of APP. The transcripts were composed of 5’-untranslated region (UTR) with internal promoter activity, open reading frame (ORF) and a 3’-UTR. PCR primers were designed on the basis of the reverse complementary strands of these fragments. (B) Mean methylation levels of CpG sites in APP gene as determined by pyrosequencing in brain tissue. Numbers refer to the locations of CpG sites. (C) Schematic diagram of PS1. (D) Mean methylation levels of CpG sites in PS1 gene as determined by pyrosequencing in brain tissue. The plotted values are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
effect is that folate acts through DNMT to modulate DNA methylation and stimulate neural stem cell proliferation [28,29]. A second limitation of the present study is its use of a preclinical model, namely, the APP/PS1 mouse, which is an imperfect model of the molecular and cognitive changes observed in human AD [21]. For
Fig. 6. Responses of DNMT activity to folate-deficient diet and folic acid and SAM supplements. APP/PS1 mice were treated as described in Fig. 1. The plotted values are mean±S.D. (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
example, blood–brain barrier changes and deficits in alternation tasks of working memory, which are common in human AD, reportedly do not occur in the APP/PS1 mouse [21,30]. However, the strength of using this AD model is that the cognitive deficits that occur across its lifespan have been well characterized. The number of cognitive deficits increases from age 3 months to 12 months [21]. Nevertheless, it remains uncertain which stages of human AD correspond most closely to those in the 7–9-month-old APP/PS1 mice of the present study. A third limitation of our study is that all parameters were measured at a single time point. The temporal order in which responses to diet and supplementation first occurred is therefore uncertain, and this creates caveats about our interpretations of the observed associations. For instance, we cannot absolutely exclude the possibility that changes in DNA methylation rate could be regulated by Aβ rather than regulate the protein’s accumulation. However, we observed changes in serum folate, methylation potential, DNMT activity, APP and PS1 promoter methylation, and APP and PS1 protein levels that are consistent with the hypothesized causal mechanism for Aβ regulation. In conclusion, the present study found that supplementation with folic acid and/or SAM increases methylation potential and DNMT activity, modifies DNA methylation and ultimately decreases APP, PS1 and Aβ protein levels in APP/PS1 mice. Because these findings are largely consistent with the theoretical mechanisms of action of folic acid and SAM, they may stimulate reinvestigation of folic acid and SAM supplementation as treatments for patients with AD; however, we
8
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
A
80 70
*
*
D 125
50 40 30 20
*#
*#
100
60
SAM (nmol/g)
SAM (nmol/g)
*
*
*
*
75 50 25
10 0
B
0
E
35
16
* *#
12
25
SAH (nmol/g)
SAH (nmol/g)
30
20 15 10
*#
*#
8
4
5 0
C
0
F
3.0
*
*
*
*# *#
10
2.0 1.5 1.0
*#
8
* 6 4
0.5 0.0
14 12
SAM/SAH
SAM/SAH
2.5
*
2 Def
Con
Con+SAM
Con+FA
Con+FA+SAM
0
Def
Con
Con+SAM
Con+FA
Con+FA+SAM
Fig. 7. Responses of SAM, SAH and methylation potential to folate-deficient diet and folic acid and SAM supplements in liver and brain tissue. APP/PS1 mice were treated as described in Fig. 1. (A–C) SAM concentration, SAH concentration and methylation potential (SAM:SAH ratio) in liver (n=5 mice/group). (D–F) SAM concentration, SAH concentration and methylation potential (SAM:SAH ratio) in brain (n=5 mice/group). *Pb.05 compared with the folic-acid-deficient diet (Def). #Pb.05 compared with the control diet (Con).
recommend against the administration of SAM supplements to human patients with AD.
Acknowledgments The authors state that they have nothing to disclose and that there are no potential conflicts of interest. This research was supported by a grant from the National Natural Science Foundation of China (No. 81130053).
References [1] De Strooper B, Iwatsubo T, Wolfe MS. Presenilins and γ-secretase: structure, function, and role in Alzheimer disease. Cold Spring Harb Perspect Med 2012; 2(1):a006304. http://dx.doi.org/10.1101/cshperspect.a006304. [2] Christensen DZ, Huettenrauch M, Mitkovski M, Pradier L, Wirths O. Axonal degeneration in an Alzheimer mouse model is PS1 gene dose dependent and linked to intraneuronal Aβ accumulation. Front Aging Neurosci 2014;6:139. http://dx.doi.org/10.3389/fnagi.2014.00139. eCollection 2014. [3] Fuso A. The 'golden age' of DNA methylation in neurodegenerative diseases. Clin Chem Lab Med 2013;51(3):523–34. http://dx.doi.org/10.1515/cclm-2012-0618.
[4] Bennett DA, Yu L, Yang J, Srivastava GP, Aubin C, De Jager PL. Epigenomics of Alzheimer's disease. Transl Res 2014;16. http://dx.doi.org/10.1016/j.trsl.2014.05. 006 [pii: S1931-5244(14)00169-8]. [5] Lunnon K, Mill J. Epigenetic studies in Alzheimer's disease: current findings, caveats, and considerations for future studies. Am J Med Genet B Neuropsychiatr Genet 2013;162B(8):789–99. http://dx.doi.org/10.1002/ajmg.b.32201. [6] Wang SC, Oelze B, Schumacher A. Age-specific epigenetic drift in late-onset Alzheimer’s disease. PLoS One 2008;3(7):e2698. http://dx.doi.org/10.1371/ journal.pone.0002698. [7] Bakulski KM, Dolinoy DC, Sartor MA, Paulson HL, Konen JR, Lieberman AP, et al. Genome-wide DNA methylation differences between late-onset Alzheimer’s disease and cognitively normal controls in human frontal cortex. J Alzheimers Dis 2012;29(3):571–88. http://dx.doi.org/10.3233/JAD-2012-111223. [8] Mandaviya PR, Stolk L, Heil SG. Homocysteine and DNA methylation: a review of animal and human literature. Mol Genet Metab 2014;113(4):243–52. http://dx. doi.org/10.1016/j.ymgme.2014.10.006. [9] Engelborghs S, Gilles C, Ivanoiu A, Vandewoude M. Rationale and clinical data supporting nutritional intervention in Alzheimer's disease. Acta Clin Belg 2014; 69(1):17–24. http://dx.doi.org/10.1179/0001551213Z.0000000006. [10] Jansen D, Zerbi V, Arnoldussen IA, Wiesmann M, Rijpma A, Fang XT, et al. Effects of specific multi-nutrient enriched diets on cerebral metabolism, cognition and neuropathology in AβPPswe-PS1dE9 mice. PLoS One 2013;8(9):e75393. http:// dx.doi.org/10.1371/journal.pone.0075393 [eCollection 2013]. [11] Moore EM, Ames D, Mander AG, Carne RP, Brodaty H, Woodward MC, et al. Among vitamin B12 deficient older people, high folate levels are associated with worse cognitive function: combined data from three cohorts. J Alzheimers Dis 2014; 39(3):661–8. http://dx.doi.org/10.3233/JAD-131265.
W. Li et al. / Journal of Nutritional Biochemistry xx (2015) xxx–xxx
[12] Thaipisuttikul P, Galvin JE. Use of medical foods and nutritional approaches in the treatment of Alzheimer's disease. Clin Pract (Lond) 2012;9(2):199–209. [13] Clarke R, Bennett D, Parish S, Lewington S, Skeaff M, Eussen SJ, et al. Effects of homocysteine lowering with B vitamins on cognitive aging: meta-analysis of 11 trials with cognitive data on 22,000 individuals. Am J Clin Nutr 2014;100(2): 657–66. [14] Durga J, van Boxtel MP, Schouten EG, Kok FJ, Jolles J, Katan MB, et al. Effect of 3-year folic acid supplementation on cognitive function in older adults in the FACIT trial: a randomised, double blind, controlled trial. Lancet 2007;369(9557):208–16. [15] Chan A, Paskavitz J, Remington R, Rasmussen S, Shea TB. Efficacy of a vitamin/ nutriceutical formulation for early-stage Alzheimer's disease: a 1-year, open-label pilot study with an 16-month caregiver extension. Am J Alzheimers Dis Other Demen 2008;23(6):571–85. http://dx.doi.org/10.1177/1533317508325093. [16] Strain JJ, Dowey L, Ward M, Pentieva K, McNulty H. B-vitamins, homocysteine metabolism and CVD. Proc Nutr Soc 2004;63(4):597–603. [17] Song Z, Zhou Z, Song M, Uriarte S, Chen T, Deaciuc I, et al. Alcohol-induced S-adenosylhomocysteine accumulation in the liver sensitizes to TNF hepatotoxicity: possible involvement of mitochondrial S-adenosylmethionine transport. Biochem Pharmacol 2007;74(3):521–31. [18] Mastroeni D, Grover A, Delvaux E, Whiteside C, Coleman PD, Rogers J. Epigenetic mechanisms in Alzheimer’s disease. Neurobiol Aging 2011;32(7):1161–80. http://dx.doi.org/10.1016/j.neurobiolaging.2010.08.017. [19] Fuso A, Nicolia V, Ricceri L, Cavallaro RA, Isopi E, Mangia F, et al. S-adenosylmethionine reduces the progress of the Alzheimer-like features induced by B-vitamin deficiency in mice. Neurobiol Aging 2012;33(7):1482.e1–1482.e16. http://dx.doi.org/10.1016/j. neurobiolaging.2011.12.013. [20] Lee S, Lemere CA, Frost JL, Shea TB. Dietary supplementation with S-adenosyl methionine delayed amyloid-β and tau pathology in 3xTg-AD mice. J Alzheimers Dis 2012;28(2):423–31. http://dx.doi.org/10.3233/JAD-2011-111025. [21] Webster SJ, Bachstetter AD, Nelson PT, Schmitt FA, Van Eldik LJ. Using mice to model Alzheimer's dementia: an overview of the clinical disease and the preclinical behavioral changes in 10 mouse models. Front Genet 2014;5:88. http://dx.doi.org/10.3389/fgene.2014.00088. eCollection 2014.
9
[22] Salloway S, Sperling R, Fox NC, Blennow K, Klunk W, Raskind M, et al. Two phase 3 trials of bapineuzumab in mild-to-moderate Alzheimer's disease. N Engl J Med 2014;370(4):322–33. http://dx.doi.org/10.1056/NEJMoa1304839. [23] Faux NG, Ellis KA, Porter L, Fowler CJ, Laws SM, Martins RN, et al. Homocysteine, vitamin B12, and folic acid levels in Alzheimer's disease, mild cognitive impairment, and healthy elderly: baseline characteristics in subjects of the Australian Imaging Biomarker Lifestyle study. J Alzheimers Dis 2011;27(4): 909–22. http://dx.doi.org/10.3233/JAD-2011-110752. [24] Kennedy BP, Bottiglieri T, Arning E, Ziegler MG, Hansen LA, Masliah E. Elevated S-adenosylhomocysteine in Alzheimer brain: influence on methyltransferases and cognitive function. J Neural Transm 2004;111(4):547–67. [25] Chouliaras L, Mastroeni D, Delvaux E, Grover A, Kenis G, Hof PR, et al. Consistent decrease in global DNA methylation and hydroxymethylation in the hippocampus of Alzheimer's disease patients. Neurobiol Aging 2013;34(9):2091–9. http://dx. doi.org/10.1016/j.neurobiolaging.2013.02.021. [26] Sudduth TL, Weekman EM, Brothers HM, Braun K, Wilcock DM. β-Amyloid deposition is shifted to the vasculature and memory impairment is exacerbated when hyperhomocysteinemia is induced in APP/PS1 transgenic mice. Alzheimers Res Ther 2014;6(3):32. http://dx.doi.org/10.1186/alzrt262. eCollection 2014. [27] Lin N, Qin S, Luo S, Cui S, Huang G, Zhang X. Homocysteine induces cytotoxicity and proliferation inhibition in neural stem cells via DNA methylation in vitro. FEBS J 2014;281(8):2088–96. http://dx.doi.org/10.1111/febs.12764. [28] Li W, Yu M, Luo S, Liu H, Gao Y, Wilson JX, et al. DNA methyltransferase mediates dose-dependent stimulation of neural stem cell proliferation by folate. J Nutr Biochem 2013;24(7):1295–301. http://dx.doi.org/10.1016/j.jnutbio.2012.11.001. [29] Yu M, Li W, Luo S, Zhang Y, Liu H, Gao Y, et al. Folic acid stimulation of neural stem cell proliferation is associated with altered methylation profile of PI3K/Akt/CREB. J Nutr Biochem 2014;25(4):496–502. http://dx.doi.org/10.1016/j.jnutbio.2013.12.010. [30] Do TM, Alata W, Dodacki A, Traversy MT, Chacun H, Pradier L, et al. Altered cerebral vascular volumes and solute transport at the blood-brain barriers of two transgenic mouse models of Alzheimer's disease. Neuropharmacology 2014;81: 311–7. http://dx.doi.org/10.1016/j.neuropharm.2014.02.010.