Follicle dynamics and granulosa cell differentiation in the turkey hen ovary

Follicle dynamics and granulosa cell differentiation in the turkey hen ovary Kahina Ghanem and A.L. Johnson1 Center for Reproductive Biology and Health, and the Department of Animal Science, The Pennsylvania State University, University Park, PA 16802, USA same treatment induced minimal STAR expression and no significant progesterone accumulation in GCs from 8 to 9 mm follicles (prior to the rapid growth phase). By comparison, dispersed GCs from 8 to 9 mm follicles pre-cultured for 18 h followed by a 3 h challenge with rhFSH resulted in significantly increased STAR expression plus progesterone production. Significantly, such cultured GCs pretreated for 15 min with transforming growth factor alpha (TGFα; 10 ng/mL) completely prevented both rhFSH-induced STAR expression and progesterone production. Culture of GCs from 8 to 9 mm follicles for 21 h with Bone Morphogenetic Protein 6 (BMP6) increased both cholesterol side-chain cleavage enzyme (CYP11A1) and FSH receptor mRNA (FSHR) expression. BMP6 also enhanced rhFSH-induced STAR expression, and this effect was blocked by TGFα. Collectively, these results support a conservation of mechanisms that maintain a hierarchy of follicles throughout development plus initiate FSH-responsiveness and GC differentiation as the recruited follicle enters the rapid growth phase in these closely related species.

ABSTRACT Similar to the domestic hen ovary, entry of a follicle into the preovulatory hierarchy in the turkey hen represents a process in which a single follicle initiates rapid growth and final maturation prior to ovulation. Published data derived from the laying hen support the proposal that differentiation of the follicle granulosa cell (GC) layer begins coincident with entry into the rapid growth phase and is characterized by the initial capacity for follicle stimulating hormone (FSH)-mediated cell signaling. The present studies were conducted with photostimulated B.U.T. Big 6 turkey hens to compare follicle dynamics and cellular mechanisms to those in the laying hen. The measurement and weights of turkey ovarian follicles greater than 1 mm in diameter revealed a discrete size hierarchy that was maintained throughout follicle development. GC layers collected from the single follicle initiating rapid growth (at the 11 to 13 mm stage of development) and incubated, in vitro, for 3 h with recombinant human (rh) FSH (10 ng/mL) responded with significantly increased steroidogenic acute regulatory protein (STAR) mRNA expression and progesterone production. The

Key words: turkey, ovary, granulosa, follicle stimulating hormone, STAR, progesterone 2018 Poultry Science 0:1–7 http://dx.doi.org/10.3382/ps/pey224

INTRODUCTION

We and others have previously provided data from the laying hen demonstrating that follicle granulosa cells (GCs) collected from 1 to 5 mm slow-growing (pre-recruitment) follicles express follicle-stimulating hormone receptor (FSHR) mRNA (You et al., 1996; Wakabayashi et al., 1997) and protein (Johnson, 2015), together with vasoactive intestinal peptide (VIP) receptor 2 mRNA (VPAC2; Kim and Johnson, 2016) yet each receptor fails to initiate a significant increase in cyclic adenosine monophosphate (cAMP) production following a 1 h or 3 h challenge, in vitro, with either FSH (Tilly et al., 1991a; Johnson and Lee, 2016) or VIP (Kim and Johnson, 2016). At the time of cyclic recruitment, the GC layer in one follicle from the 6 to 8 mm cohort initiates and sustains several critical processes within the steroidogenic pathway via protein kinase A/cAMP signaling, including transcription of steroidogenic acute regulatory protein (STAR) and cholesterol side-chain cleavage enzyme (CYP11A1) (Johnson, 2014b, 2015). In particular, STAR represents

The laying hen (Gallus gallus) and turkey hen (Melaegris gallopavo) represent related species grouped within the order Galliformes, family Phasianidae. As in the laying hen ovary, the process of cyclic recruitment in the domestic turkey represents the stage at which a single follicle enters a rapid growth phase (the preovulatory hierarchy) in preparation for ovulation. Some time prior to this, such follicles are activated from a dormant primordial follicle stage of development (initial recruitment) to undergo a slow-growth process, during which they emerge from the ovarian stroma and gradually increase in size from <1 mm to approximately 10 mm in diameter over a period of weeks (Hocking et al., 1987).

 C 2018 Poultry Science Association Inc. Received January 31, 2018. Accepted May 4, 2018. 1 Corresponding author: [email protected]

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

2

GHANEM AND JOHNSON

an early response gene that is increased significantly within 3 h in response to increased intracellular levels of cAMP (Balasubramanian et al., 1997; Johnson and Bridgham, 2001; Manna et al., 2009). Consequently, in the absence of receptor-mediated cAMP within the GC layer of slow growing (1 to 2 mm and 3 to 5 mm) and pre-recruitment (6 to 8 mm) laying hen follicles, both CYP11A1 and STAR are expressed at low to nondetectable levels (Tilly et al., 1991b; Johnson and Lee, 2016). There is also evidence from the laying hen that prior to follicle recruitment FSH-induced signaling via cAMP in 6 to 8 mm follicles is suppressed by tonic inhibitory signaling mediated, at least in part, by active mitogen activated protein kinase (MAPK) and protein kinase C signaling (Johnson and Bridgham, 2001; Woods and Johnson, 2005; Woods et al., 2007). Nevertheless, a role for such inhibitory signaling to regulate FSH-responsiveness in less developed, 1 to 5 mm diameter follicles has yet to be adequately investigated. Several bone morphogenetic proteins (BMPs), including BMP2 (Haugen and Johnson, 2010), BMP4 (Kim et al., 2013), BMP6 (Oc´ on-Grove et al., 2012), BMP3, -5, -7, and -10 (reviewed in Onagbesan et al., 2009), and BMP15 (Elis et al., 2007; Stephens and Johnson, 2016), have been implicated in regulating GC function and/or follicle development within the laying hen ovary. In particular, BMP6 signaling via the SMAD 1/5/8 signaling pathway was reported to enhance cellular levels of FSH-induced cAMP and differentiation specifically within cultured GCs from pre-recruitment (6 to 8 mm) follicles (Oc´on-Grove et al., 2012). The present studies were conducted with the turkey hen ovary to assess the extent to which the laying hen and turkey hen share similar follicle dynamics and, in particular, cellular mechanisms related to follicle recruitment. Here, we focus on identifying the stage of follicle development associated with FSH-responsiveness within the GC layer, together with the ability of MAPK signaling to modulate BMP6-mediated GC differentiation.

MATERIALS AND METHODS Animals and Reagents Aviagen B.U.T. Big 6 turkey hens, obtained from Aviagen Turkeys, Inc., East Lewisburg, West Virginia, were used in the studies described. All animal procedures were approved by the Institutional Animal Care and Use Committee at the Pennsylvania State University and were performed in accordance with The Guiding Principles for the Care and Use of Laboratory Animals. Hens were housed on the floor throughout the study and provided with free access to feed and water. As part of a larger study, 40 hens were housed under a non-stimulatory photoperiod of 8 h light, 16 h dark until 54 wk of age. At this time, the photoperiod was increased to 16 h light: 8 h dark to initiate egg laying. Hens were euthanized and exsanguinated using an elec-

tric stunning knife between 68 and 72 wk of age. Fully developed ovaries were collected without regard to stage of the clutch or ovulatory cycle. The entire ovary was immediately removed and placed in ice-cold 1% NaCl solution, and then further processed for measuring follicle size and collection of the follicle granulosa layer. All but one hen within this group of 40 hens had a fully developed pre-recruitment and preovulatory follicle hierarchy at the time of collection.

Tissue Processing for mRNA Plus GC Incubation and Culture In an initial study, all ovarian follicles 1 mm diameter and greater from 14 hens were collected and cleaned of excess connective tissue. Slow growing follicles (1 to 2 and 3 to 5 mm), the pre-recruitment cohort (6 to 10 mm), and all preovulatory follicles were weighed to the nearest mg. In addition, 1 to 2 mm, 3 to 5 mm, 6 to 7 mm, and 8 to 10 mm follicles together with the single, most recently recruited 11 to 13 mm follicle from 4 hens were split open with a scalpel blade and the granulosa layer, devoid of theca contamination, was collected from the expressed yolk as previously described (Tilly and Johnson, 1987). Granulosa layers were rinsed free of yolk, and then frozen at −80◦ C until mRNA was isolated to measure mRNA levels of STAR, FSHR, CYP11A1, and VPAC2, plus BMP4, BMP6 and antiMullerian hormone (AMH). For the remaining experiments, GC layers from 3 to 5 mm, 6 to 10 mm, and 11 to 13 mm follicles were collected to conduct a 3 h incubation, while GC layers from additional 8 to 9 mm pre-recruitment follicles were dispersed and cultured overnight. All incubations and cultures were conducted in complete media consisting of Dulbecco’s Modified Eagle Medium (DMEM) with high glucose (HyClone Laboratories, Logan, UT), plus 2.5% fetal bovine serum (PAA Laboratories, Etobicoke, Ontario, CA), 0.1 mM non-essential amino acids and 1% antibiotic-antimycotic mixture (both from Invitrogen, Carlsbad, CA). For incubations, GC layers were collected and gently dispersed into small pieces using a 1 mL pipette, added to 12 × 75 mm polypropylene tubes (Fisher Scientific, Pittsburgh, PA) at a density of approximately 5 × 105 cells per mL, and placed in a shaking water bath at 40◦ C for 3 h under ambient air conditions (Kim and Johnson, 2016). The granulosa layer was collected as described above and GC for culture and were dispersed with 0.3% type II collagenase (Worthington, Lakewood, NJ) and plated at a density of approximately 5 × 105 per well in 12-well polystyrene culture plates (Becton Dickinson, Franklin Lakes, NJ). These cells were allowed to initiate attachment at 40◦ C in an atmosphere of 95% air: 5% CO2 for 2 to 3 h, and then cultured for an additional 24 h without or with growth factor(s) and/or FSH treatment (Oc´ on-Grove et al., 2012). Recombinant human (rh) FSH was provided by the National Hormone and Pituitary Program

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

3

TURKEY OVARIAN FOLLICLE DYNAMICS Table 1. Primers generated against Meleagris gallopavo mRNAs were designed to span an intron and were validated for use with quantitative PCR analysis. Target

GenBank Accession #

nt

Primer sequence

CYP11A1

XM 01,071,7201.1

140

FSHR

XM 01,070,6607.1

138

STAR

XM 0,032,12432.2

129

VPAC2

XM 01,071,2425.1

120

RPL19

XM 01,072,4597.1

131

5 -TTCCACAACGTCCACAACAT-3 Fwd 5 -AGCATCCCCTCTGACTTGAA-3 Rev 5 - GGAGCTTTCACAGGACTTCG-3 Fwd 5 -CACGAGGTTGTTGGCTTTCT-3 Rev 5 - CCTTCAGCGAGATGGAGATG-3 Fwd 5 - TCAGCACTTTGTCTCCGTTG -5 Rev 5 - TGATTGCTGTCCATCCAGAA-3 FWD 5 - CCCAAACTCCAACACATCCT-3 REV 5 - TGGGCATCGGTAAGAGAAAG-3 Fwd 5 - CATATGGCGGTCGATCTTCT-3 Rev

0

(Torrance, CA, USA), while BMP6 and transforming growth factor alpha (TGFα) were purchased from PeproTech (Rocky Hill, NJ, USA).

Forward and reverse primers directed against Meleagris gallopavo FSHR, CYP11A1, STAR, VPAC2, and RPL19 mRNA were purchased from Integrated DNA Technologies, Inc., Coralville, IA and are described in Table 1. Each primer pair was validated for specificity by evaluating melt curves and sequencing the amplified product. Total RNA was extracted from incubated and cultured cells using Trizol Reagent (Life Technologies, Grand Island, NY) as described by Kim et al. (2013). Real-time PCR analysis was conducted using the 7500 Fast thermocycler (Applied Biosystems) with associated software (v.2.0.4). Target gene expression was standardized to RPL19 using the ΔΔCt method (Livak and Schmittgen, 2001).

Progesterone Enzyme-Linked Immunoassay Progesterone from media samples was quantified by enzyme immunoassay (Cayman Chemical Co.) and conducted as previously reported (Johnson and Lee, 2016).

Data Analysis All experiments were replicated using tissues from different hens. Real-time PCR results from freshly collected tissues relative to the stage of development are expressed as a fold-difference compared to a pooled cDNA reference (Figures 2 and 3), or to the respective control incubated/cultured cells (which were set to 1.0; Figures 4 to 6). These data were analyzed by a oneway analysis of variance and Duncan’s multiple range test without including the incubated or cultured controls. Progesterone data are expressed as mean pg/μg of cell protein +/−SEM for the combined replicate experiments and analyzed by the analysis of variance followed by Duncan’s multiple range test (Figures 4 and 5).

2

3

4

5

6

7

8

9

10 11 12 13 14

Follicle number

-0.2

Log10(weight) g

Quantitative Real-Time PCR

1

-0.4 -0.6 -0.8 -1 -1.2 Turkey 1

Turkey 2

Turkey 3

Figure 1. Hierarchy of slow-growing pre-recruitment follicles ranging from 6 to 10 mm diameter collected from 3 turkey hens.

RESULTS The organization of ovarian follicles and the distribution of follicles characterized by size and weight are described in Table 2 and Figure 1. For the purpose of analysis, ovarian follicles were grouped as: rapid growing, yellow-yolk-filled preovulatory follicles; the single follicle most recently recruited into the preovulatory hierarchy that has begun to accumulate yellow yolk (11 to 13 mm diameter); a “pre-recruitment cohort” containing largely protein-rich, white yolk (6 to 10 mm diameter); slow growing 3 to 5 mm follicles; and, the largest grouping that is most variable in number, 1 to 2 mm follicles. Basal levels of FSHR, VPAC2, CYP11A1 and STAR mRNA from GC layers at different stages of early follicle development (1 to 10 mm) and immediately subsequent to follicle selection into the preovulatory hierarchy (11 to 13 mm) are compared in Figure 2. Expression of BMP4, BMP6 and AMH at the same stages of follicle development is shown in Figure 3. Following a 3 h incubation of freshly collected GCs without or with rhFSH, it was determined that those from 11 to 13 mm follicles respond with a pronounced increase in STAR expression plus progesterone production (Figure 4). By comparison, GCs from the

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

4 2.5

FSHR

2.5

1

VPAC2

2

1.5

b

1.5

bc

bc

1

c

0.5

0.5

0

0

5 A

2.5

3

2

2

B

B

a b STAR

a

a

ab

ab b

1.5

B

1

1

B

0.5 0

0 1-2 3-5 6-7 8-10 11-13

2 mm 4 mm 6 mm 8 mm 12 mm 1-2 3-5 6-7 8-10 11-13

Figure 2. Basal levels of FSHR, CYP11A1, VPAC2, and STAR mRNA expression in freshly collected granulosa layers from follicles relative to stage of development. N = 4 hens A, B; a, b, c: P < 0.05.

a

BMP4

3

a*

b,* b 3-5_FSH 3-5mm

6-8_FSH 9-12_FSH 6-10mm 11-13mm

1.4 1.0 0.6 B

0.2 C

follicle (mm diameter)

4

80 70 60 50 40 30 20 10 0

A b

pg/ g protein

CYP11A1

4

Progesterone

Fold-change vs pooled cDNA

2

STAR mRNA

a

fold-respective Con

GHANEM AND JOHNSON

C

C

C

3Con FSH 3FSH Con 6Con FSH 6FSH Con 9Con FSH 9FSH Con 3-5 mm 6-10 mm 11-13 mm

Figure 4. Top panel. STAR mRNA expression in turkey GCs following a 3 h incubation without (Con) or with FSH (10 ng/mL) relative to stage of follicle development. Bottom panel. Progesterone in media from incubated GCs; N = 5 replicate incubations. ∗ : P < 0.05 compared to its respective control; a, b; A, B, C: P < 0.05.

Fold-change vs pooled cDNA

2 1

b

b b

0 2.5

b

a

2.0

BMP6

a,b

1.5 1.0

b,c

b,c c

0.5

8 7 6 5 4 3 2 1 0

1-2 a

3-5

6-8 8-10 11-13

follicle (mm diameter) a

AMH b

b

b

Figure 5. STAR expression and progesterone production in undifferentiated GCs from 8 to 9 mm pre-recruitment follicles precultured for 21 h without or with TGFα (10 ng/mL), followed by treatment for 3 h without or with rhFSH (10 ng/mL). ∗ : P < 0.05 vs Con/Con that was set to 1.0 (not shown); A, B: P < 0.05.

21-2 mm 43-5 mm 6 6-7 mm 88-10 mm 11-13 9-12 mm follicle (mm diameter) Figure 3. Expression of BMP4, BMP6, and AMH mRNA in granulosa cells from follicles relative to stages of development; N = 4 hens. a, b, c: P < 0.05.

pre-recruitment cohort (6 to 10 mm) demonstrated a small but a significant increase in STAR expression but no increase in progesterone levels, while incubated GCs from 3 to 5 mm follicles showed no response to rhFSH. Following a 21 h culture of GCs from 8 to 9 mm prerecruitment follicles, a subsequent 3 h challenge with rhFSH induced a significant increase in both STAR ex-

pression and progesterone production (Figure 5). Significantly, preculture with TGFα completely blocked the stimulatory effects of rhFSH. Finally, culture of GCs from 8 to 9 mm follicles for 21 h with BMP6 increased FSHR and CYP11A1 expression compared to control cultured cells, and a subsequent 3 h challenge with rhFSH following BMP6 treatment further enhanced STAR expression compared to the 3 h rhFSH challenge alone (Figure 6). Again, co-culture with TGFα prevented any stimulatory effect of BMP6 or BMP6 plus rhFSH on STAR expression.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

5

TURKEY OVARIAN FOLLICLE DYNAMICS

Figure 6. Left panels. FSHR, STAR, and CYP11A mRNA in undifferentiated GCs from 8 to 9 mm follicles pre-cultured for 21 h without or with BMP6 (25 ng/mL), followed by a 3 h challenge without or with 10 ng FSH/mL. Right panel. STAR expression in GCs pretreated for 15 min with 10 ng TGFα /mL then cultured for an additional 21 h without or with BMP6, followed by a 3 h challenge with FSH. A, B, C: P < 0.05; ∗ : P < 0.05, t-test versus Con/Con (not shown). N = 5 hens

Table 2. Summary of number and weights of slow growing and preovulatory follicles in ovaries from 60 to 64 wk-old turkey hens. Preovulatory follicles (N = 13 hens) SEM Minimum 0.5 9 0.040 0.560 0.589 27.200

Number of follicles Smallest follicle weight (g) Largest follicle weight (g)

Mean 11.4 0.821 31.363

Number of follicles Smallest follicle weight (g) Largest follicle weight (g)

Mean 13.3 0.116 0.396

6 to 10 mm follicles (N = 14 hens) SE Mean Minimum 1.7 6 0.005 0.101 0.025 0.264

Maximum 31 0.149 0.594

Range 25 0.049 0.329

Number of follicles Smallest follicle weight (g) Largest follicle weight (g)

Mean 15.6 0.023 0.088

3 to 5 mm follicles (N = 14 hens) SE Mean Minimum 1.3 9 0.001 0.020 0.003 0.064

Maximum 25 0.029 0.099

Range 16 0.009 0.035

Number of follicles Smallest follicle weight (g) Largest follicle weight (g)

Mean 43.2 0.001 0.018

1 to 2 mm follicles (N = 14 hens) SE Mean Minimum 4.6 18 0.0002 0.0004 0.0003 0.015

Maximum 73 0.003 0.020

Range 55 0.003 0.004

DISCUSSION Considering the discrete hierarchal organization of ovarian follicles prior to recruitment into the rapid growth phase present in both the domestic hen (Gilbert et al., 1983) and turkey hen (Figure 1), the term “pre-

Maximum 14 1.040 34.410

Range 5 0.480 7.210

recruitment cohort” is used herein in preference to “prehierarchal follicles” to more appropriately describe the group and organization of 6 to 10 mm follicles that will eventually enter the turkey hen preovulatory hierarchy. Given this distinct size hierarchy, it has been suggested that the largest pre-recruitment follicle represents the

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

6

GHANEM AND JOHNSON

next to enter the rapid growth phase (Gilbert et al., 1983; Perry et al., 1983). Nevertheless, such a strict order of recruitment (e.g., the largest pre-recruitment follicle always the next to enter the preovulatory hierarchy) has yet to be empirically established in either the turkey or laying hen ovary. The process of recruitment into the rapid growth phase is of fundamental importance as published data from the laying hen has demonstrated that it represents the initial stage at which FSHR in the GC layer acquires the capacity for FSH-induced cAMP formation. The initial capacity for FSHR signaling via cAMP initiates multiple processes within the GC layer that are critical for final maturation prior to ovulation, including FSH-induced steroidogenesis, angiogenesis, LH receptor expression, enhanced cell survival, and GC proliferation (Johnson, 2015, 2014b). Notably, expression profiles of BMP4, BMP6, and AMH during early follicle development in the turkey (Figure 3) are similar to those in the laying hen (Johnson et al., 2008; Oc´ on-Grove et al., 2012; Kim et al., 2013). Moreover, profiles of FSHR, VPAC2, CYP11A1, and STAR expression during early follicle growth (Figure 2) are not unlike those previously described in the laying hen ovary (Woods and Johnson, 2005; Kim and Johnson, 2016). Significantly, expression of elevated CYP11A1 in GC at the 11 to 13 mm stage of development (Figure 2) is consistent with the initial stage of differentiation and the capacity for steroid production within the GC layer, together with the initiation of the follicle’s rapid growth phase. Due to the virtual absence of luteinizing hormone receptor (LHR) expression in GCs from laying hen prerecruitment follicles (Johnson and Bridgham, 2001), both STAR and progesterone production are initially mediated via FSH signaling (Figure 4). STAR represents an early response gene dependent upon signaling via cAMP that in the laying hen is transiently expressed and present at highest levels in GCs from preovulatory follicles (Johnson and Bridgham, 2001; Johnson et al., 2002). Moreover, both FSH-induced STAR expression (mRNA and protein) plus progesterone production is initiated following a 3 h incubation, in vitro, of laying hen and turkey hen GCs from the most recently recruited follicle (e.g., 9 to 12 mm follicle in the laying hen and 11 to 13 mm stage of development in the turkey hen; Johnson, 2015 and Figure 4, respectively). A fundamental question regarding follicle recruitment pertains to the most proximal mechanism that initially enables FSH-responsiveness within the GC layer. We have previously reported studies from the laying hen that implicate inhibitory MAPK signaling in maintaining the FSHR in a desensitized state and unable to generate cAMP prior to follicle recruitment (Johnson, 2014b). In the present study, preculture of undifferentiated GCs from 8 to 9 mm follicles for 21 h without exogenous MAPK agonists (e.g., epidermal growth factor receptor ligands, including TGFα) enables both FSH-

induced STAR expression and progesterone production (Figure 5). On the other hand, co-culture of turkey hen GCs with TGFα prevents an increase in STAR expression and progesterone production. Moreover, pretreatment with TGFα for as little as 15 min prevents the sensitizing effects of BMP6 in cultured cells (Figure 6). While we hypothesize that premature FSHresponsiveness within the GC layer of pre-recruitment follicles is prevented by tonic MAPK signaling, the proximal signal/mechanism for the reduction/removal of inhibitory signal within the single recruited follicle has not been unequivocally identified. We further hypothesize that a reduction of such inhibitory signaling in more than one pre-recruitment follicle can result in more than one follicle entering the preovulatory hierarchy in a given day. This anomaly would eventually result in double ovulations, as can occur in broiler breeder hens. In summary, data described herein provide evidence for a similar organization of the laying hen and turkey ovarian follicle hierarchy, together with cellular mechanisms regulating the differentiation of GCs at the time of follicle recruitment into the preovulatory hierarchy. Thus, suboptimal ovarian function should not be considered a major limitation to optimizing egg production. These results support the continued emphasis on modifying incubation behavior and broodiness in the turkey hen as means to enhance reproductive efficiency.

ACKNOWLEDGMENTS We thank Ashli Moore (University of Kentucky, Lexington, KY) and Paul Bartell (Penn State University, University Park, PA) for the turkey hens and their management expertise, J. Lee for technical support, and the staff at the Poultry Education and Research Center, Pennsylvania State University for management services. This research was funded by NSF grant IOS-1354713 and the Walther H. Ott Endowment at The Pennsylvania State University to ALJ.

REFERENCES Balasubramanian, K., H.A. Lavoie, J.C. Garmey, D.M. Stocco, and J.D. Veldhuis 1997. Regulation of porcine granulosa cell steroidogenic acute regulatory protein (StAR) by insulin-like growth factor I: synergism with follicle-stimulating hormone or protein kinase A agonist. Endocrinology. 138:433–439. Elis, S., J. Dupont, I. Couty, L. Persani, M. Govoroun, E. Blesbois, F. Batellier, and P. Monget 2007. Expression and biological effects of bone morphogenetic protein-15 in the hen ovary. J. Endocrinol. 194:485–497. Gilbert, A. B., M. M. Perry, D. Waddington, and M. A. Hardie 1983. Role of atresia in establishing the follicular hierarchy in the ovary of the domestic hen (Gallus domesticus). Reproduction 69:221– 227. Haugen, M. J., and A.L. Johnson 2010. Bone morphogenetic protein 2 inhibits FSH responsiveness in hen granulosa cells. Reproduction 140:551–558. Hocking, P. M., M. A. Walker, D. Waddington, and A.B. Gilbert. 1987. Observations on the size of the follicular hierarchy in the turkey hen and a case of arrested follicular growth. Br. Poult. Sci. 28:755–757.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018

TURKEY OVARIAN FOLLICLE DYNAMICS Johnson, A. L. 2015. Ovarian follicle selection and granulosa cell differentiation. Poult. Sci. 94:781–785. Johnson, A. L. 2014b. The avian ovary and follicle development: some comparative and practical insights. Turkish J. Vet. Anim. Sci. 38:1–10 Johnson, A. L., and J. T. Bridgham. 2001. Regulation of steroidogenic acute regulatory protein and luteinizing hormone receptor messenger ribonucleic acid in hen granulosa cells. Endocrinology 142:3116–3124. Johnson, A. L., and J. Lee. 2016. Granulosa cell responsiveness to follicle stimulating hormone during early growth of hen ovarian follicles. Poult. Sci. 95:108–114. Johnson, A. L., E. V. Solovieva, and J. T. Bridgham. 2002. Relationship between steroidogenic acute regulatory protein expression and progesterone production in hen granulosa cells during follicle development. Biol. Reprod. 67:1313–1320. Johnson, P. A., T. R. Kent, M. E. Urick, and J. R. Giles. 2008. Expression and regulation of anti-Mullerian hormone in an oviparous species, the hen. Biol. Reprod. 78:13–19. Kim, D., O. M. Oc´ on-Grove, and A. L. Johnson. 2013. Bone morphogenetic protein 4 supports the initial differentiation of hen (Gallus gallus) granulosa cells. Biol. Reprod. 88:161–161. Kim, D., and A. L. Johnson. 2016. Vasoactive intestinal peptide promotes differentiation and clock gene expression in granulosa cells from prehierarchal follicles. Mol. Reprod. Dev. 83:455–463. Livak, K.J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods 25:402–408. Manna, P. R., M. T. Dyson, and D. M. Stocco. 2009. Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives. Mol. Hum. Reprod. 15:321–333. Oc´on-Grove, O. M., D. H. Poole, and A. L. Johnson. 2012. Bone morphogenetic protein 6 promotes FSH receptor and anti-Mullerian hormone mRNA expression in granulosa cells from hen prehierarchal follicles. Reproduction 143:825–833.

7

Onagbesan, O., V. Bruggeman, and E. Decuypere. 2009. Intraovarian growth factors regulating ovarian function in avian species: a review. Anim. Reprod. Sci. 111:121–140. Perry, M. M., D. Waddington, A. B. Gilbert, and M. A. Hardie. 1983. Growth rates of the small yolky follicles in the domestic fowl. IRCS Med. Sci. 11:979–980. Stephens, C. S., and P. A. Johnson. 2016. Bone morphogenetic protein 15 may promote follicle selection in the hen. Gen. Comp. Endocrinol. 235:170–176. Tilly, J. L., and A.L. Johnson. 1987. Presence and hormonal control of plasminogen activator in granulosa cells of the domestic hen. Biol. Reprod. 37:1156–1164. Tilly, J. L., K. I. Kowalski, and A. L. Johnson. 1991. Stage of ovarian follicular development associated with the initiation of steroidogenic competence in avian granulosa cells. Biol. Reprod. 44:305– 314. Tilly, J. L., K. I. Kowalski, and A.L. Johnson. 1991. Cytochrome P450 side-chain cleavage (P450scc) in the hen ovary. II. P450scc messenger RNA, immunoreactive protein, and enzyme activity in developing granulosa cells. Biol. Reprod. 45:967–974. You, S., J. T. Bridgham, D. N. Foster, and A. L. Johnson. 1996. Characterization of the chicken follicle-stimulating hormone receptor (cFSH-R) complementary deoxyribonucleic acid, and expression of cFSH-R messenger ribonucleic acid in the ovary. Biol. Reprod. 55:1055–1062. Wakabayashi, N., A. Suzuki, H. Hoshino, and K. Nishimora 1997. The cDNA cloning and transient expression of a chicken gene encoding a follicle-stimulating hormone receptor. Gene 197:121– 127. Woods, D. C., and A. L. Johnson. 2005. Regulation of follicle-stimulating hormone-receptor messenger RNA in hen granulosa cells relative to follicle selection. Biol. Reprod. 72:643–650. Woods, D. C., M. J. Haugen, and A. L. Johnson. 2007. Actions of epidermal growth factor receptor/mitogen-activated protein kinase and protein kinase c signaling in granulosa cells from Gallus gallus are dependent upon stage of differentiation. Biol. Reprod. 77:61–70.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pey224/5026369 by Bibl Natuur - En Sterrenkunde/University LIbrary Utrecht user on 05 June 2018