- Email: [email protected]
Founder effect of the BRCA1 5382insC mutation in Brazilian patients with hereditary breast ovary cancer syndrome
Cancer Genetics and Cytogenetics 184 (2008) 62e66
Short communication
Founder effect of the BRCA1 5382insC mutation in Brazilian patients with hereditary breast ovary cancer syndrome E.C.B. da Costaa, F.R. Vargasb,c, A.S. Moreirad, J.J. Lourenc¸ob,e, M. Caleffif, P. Ashton-Prollag,h,i, M.A.M. Martins Moreirab,* b
a Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil Genetics Division, National Cancer Institute (CPQ-INCA), Rua Andre´ Cavalcanti 37, Rio de Janeiro, RJ 20231-050, Brazil c Department of Genetics, Federal University of the State of Rio de Janeiro (UNI-RIO), Rio de Janeiro, Brazil d Genome Sequencing Platform DNA PDTIS, Laboratory of Functional Genomics and Bioinformatics, Oswaldo Cruz Institute (IOC-FIOCRUZ), Rio de Janeiro Brazil e Department of Genetics, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil f Mama Moinhos Core Facility, Moinhos de Vento Hospital, Porto Alegre, Brazil g Department of Genetics, Federal University of Rio Grande do Sul (UFRGS) h Medical Genetics Service, Porto Alegre Clinics Hospital (HCPA), Porto Alegre, Brazil i Laboratory of Genomic Medicine, Research Center, Porto Alegre Clinics Hospital (HCPA), Porto Alegre, Brazil
Received 26 December 2007; received in revised form 10 March 2008; accepted 21 March 2008
Abstract
The 5382insC mutation in BRCA1 is a frequently reported mutation, being very prevalent in Central and Eastern Europe. This mutation was recurrently reported in Brazil and one case was reported Portugal, but not in Spain and other South-American countries,. We analyzed the haplotypic profile of seven Brazilian carriers of 5382insC to characterize a possible founder effect. The analyses indicated that mutation carriers shared an identical haplotype. The absence of this mutation in Spain, other South American countries, and sub-Saharan populations, as well as the patients’ own ancestry, point to a significant Central or Eastern European contribution to the present genetic background of Brazilian population, different from the population structuring of remaining South American countries. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction In different populations, founder mutations associated with the hereditary breast and ovary cancer (HBOC) predisposition syndrome have been frequently reported, such as 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 in Ashkenazi Jews [1]; BRCA2 mutation 999del5 in Finland and Iceland [2]; and deletion of exon 17 in BRCA1 among the German population [3]. Because of their high frequency in some populations, founder mutations allow for studies of penetrance, expression, and environmental or genetic risk modifiers [4]. Additionally, haplotype analyses of founder mutation carriers can demonstrate a single common origin of these mutationsdor, alternatively, independent origins, as suggested by Neuhausen et al. [5] for 185delAG in BRCA1. * Corresponding author. Tel.: þ55 21 3233 1460; fax: þ55 21 3233 1423 E-mail address: [email protected] (M.A.M. Martins Moreira). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.03.011
The 5382insC mutation in BRCA1 exon 20 is the second most frequently reported mutation in familial breast cancer in the BIC database (Breast Cancer Information Core; http://research.nhgri.nih.gov/bic/), being very prevalent in Central and Eastern Europe [6]. It is found in ~34% of familial breast cancer cases in Poland [7], 14% in Russia [8], 4% in Germany [9], and 10% among Ashkenazi Jews [10]. Studies using genetic markers (microsatellites and single-nucleotide polymorphisms [SNPs]) suggest that the same haplotype was shared by 5382insC mutation carriers [2,5,9], indicating a single origin in European populations. This mutation was also reported in Brazilian women with breast cancer [11e13], in a population characterized by admixture of multiethnic groups, containing similar European, African, and Amerindian components [14]. Gomes et al. [13] suggest that the high prevalence of BRCA1 5382insC could be related to a founder effect secondary to immigration of Portuguese and Spanish new Christians (i.e., Jewish converts) into Brazil in the 16th century. However, we were unable to find one single report of this
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
mutation 5282insC in breast cancer patients from Spain or from other South American countries [15e19], and only one case was reported from Portugal [20]. In the present study, we analyzed the haplotypic profile of seven unrelated Brazilian carriers of the 5382insC mutation, to characterize a possible founder effect for this mutation in Brazil.
2. Materials and methods 2.1. Patients and mutation detection Seven unrelated carriers of the germline BRCA1 mutation 5382insC and six relatives of two of the probands were used for haplotypic analyses. All procedures followed ethical guidelines and were approved by the local Ethics Committee. Mutations were detected by polymerase chain reaction (PCR) amplifications of exon 20 and direct DNA sequencing with primers 50 CAGAGCAAGACCCTGTCTC 30 /50 GGGAATCCAAATTACACAGC 30 . PCR reactions were performed in 1 PCR buffer (Invitrogen, Carlsbad, CA), 250 mmol/L of each dNTP, 50 pmol of each primer and 1 U of Taq DNA polymerase (Promega, Madison, WI, or Invitrogen) with 100 ng of genomic DNA in a final volume of 50 mL; amplification conditions being 94 C (4 minutes), followed by 35 cycles of 94 C (45 seconds), 60 C (30 seconds), and 72 C (30 seconds). The PCR products were purified with a GFX PCR DNA and gel band purification kit (GE-Healthcare, Chalfont St. Giles, UK) and sequenced with DYEnamic ET dye terminator cycle sequencing kit (GE-Healthcare), following the manufacturer’s instructions. Sequence reactions were run in an ABI-PRISM 377 automatic sequencer (Applied Biosystems, Foster City, CA). 2.2. Haplotypic characterization We used three SNPs and three microsatellite loci for haplotypic characterizations, encompassing ~500 kb of chromosome 13 around the BRCA1 locus. The SNPs were analyzed by PCR amplification and DNA sequencing. SNP rs799905GOC at the b promoter of BRCA1 was amplified with primers BC1ex1AF (50 -TAGCCCCTTGG TTTCCGTG-3´) and BC1ex1AR (5´-TCACAACGCCTTACGCCTC-30 ). PCR reactions were performed in 2.5 mmol/L MgCl2, 250 mmol/L of each dNTP, 50 pmol of each primer, 1 U of Taq DNA polymerase (Invitrogen), and 1 PCR buffer (Invitrogen), and 20e200 ng of genomic DNA in a final volume of 50 mL, with 35 cycles of 94 C (45 seconds), 58 C (45 seconds), and 72 C (30 seconds). SNP rs16941GAAOGGA (Glu1038Gly) at exon 11 was amplified with primer pair EX11F 50 -CCAGTAC AGTGAGCACAATTA-30 /EX11R50 -GTGTTGGAAGCAG GGAAGCTCTTC-30 and SNP rs1799966AGTOGGT (Ser1612Gly) at exon 16 was amplified with primer pair EX16F 50 -AATTCTTAACAGAGACCAGAAC-30 /EX16R50 AAAACTCTTTCCAGAATGTTGT-30 .
63
The PCR reactions were performed in 2.5 mmol/L MgCl2, 250 mmol/L of each dNTP, 50 pmol of each primer, 1 U of Taq DNA polymerase (Invitrogen) and 1 PCR buffer (Invitrogen), and 20e200 ng of genomic DNA in a final volume of 50 mL. Reactions were submitted to an initial step of 94 C for 4 minutes, followed by 35 cycles of 94 C (1 minute); 55 C (1 minute), and 72 C (1 minute). PCR products were purified and sequenced as described above. Three BRCA1-linked microsatellite loci were analyzed. D17S855 (intragenic marker in intron 20) and D17S1325 and D17S1326 (upstream markers) were used for genotyping with primers as listed in the Genome Database (http:// www.gdb.org). For all microsatellite loci, PCR amplifications were performed in final volumes of 25 mL with 2.0 mmol/L MgCl2, 125 mmol/L of each dNTP, 10 pmol of each primer, 1 PCR buffer, and 1 U of Platinum Taq DNA polymerase (Invitrogen) and 20e200 ng of genomic DNA. Amplification cycles were 30 cycles of 94 C (15 seconds), 60 C (15 seconds), and 72 C (20 seconds). Forward primers were labeled with carboxyfluorescein, and PCR products were run in a MEGABace 1000 Sequencer (Amersham BioscienceseGE Healthcare). Scoring of allele size was achieved using the internal size standard ET ROX400. Genetic Profile (version 2.0) software (GE-Healthcare) was used to estimate allele size. 3. Results and discussion The relevance of the 5382insC mutation is highlighted by its high frequency and penetrance in several populations around the world. Previous studies in the Brazilian population [11e13] reported 10, initially unrelated, carriers of this mutation in a total of 17 mutations detected in BRCA1 and BRCA2. Four of these probands, previously reported by Lourenc¸o et al. [11], are included in the present analysis; the other three probands are reported here for the first time. Age of cancer diagnosis (ovary or breast cancer) ranged from 26 to 47 years, with four bilateral cases (breast or ovarian; Table 1). Haplotyping with BRCA1 intragenic and intergenic markers in the seven unrelated probands indicated that they shared an identical haplotype (Table 1). A set of identical alleles was observed in all probands, indicating that 5382insC was syntenic with the following alleles: D17S1325/195, D17S1326/105, rs799905 C, rs16941 A (Glu1038Gly in exon 11), rs1799966 A (Ser1612Gly, in exon 16), and D17S855/150. The shared haplotype thus is 195/105/C/A/A/150. To confirm this possibility, these six markers were analyzed in three relatives of proband B (Fig. 1) and one relative of proband F who were also carriers of 5382insC. The same set of alleles (195/105/C/ A/A/150) was found in all of them. Familial cancer histories were not exclusively related with Eastern or Central European ancestry in these patients, because this was the case only for patients A and G. Patient
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
64
Table 1 Genotypic characterization for genetic markers near or at the BRCA1 locus in 5382inC mutation carriers A Clinical and demographic characteristics Cancer dx Bilateral ovarian Age at dx, yr 47 Ancestry Western Eur., Eastern Eur. Markers D17S1325 195/195 D17S1326 105/103 SNP-rs799905 C/C SNP-rs12941 A/A SNP-rs1799966 A/A D17S855 150/152
B
C
D
E
F
G
Bilateral breast 36 Brazilian,a Western Eur.
Bilateral breast 46 Central Eur., Western Eur.
Bilateral breast 37 Braziliana
Breast 33 Braziliana
Breast 26 Braziliana
Breast d Brazilian,a Central Eur.
195/219 105/89 C/G A/G A/G 150/144
195/197 105/109 C/C A/A A/A 150/142
195/203 105/103 C/C A/A A/A 150/150
195/193 105/109 C/G A/A A/A 150/152
195/195 105/107 C/C A/A A/A 150/152
195/197 105/91 C/G A/G A/G 150/144
Abbreviations: dx, diagnosis; Eur., European. a ‘‘Brazilian’’ denotes pedigree without indication of European origin.
C did not report any data on breast or ovary familial cancer history, and patient B did not report the occurrence of any cancer history in her Eastern European ancestors. The remaining probands, reported simply as of ‘‘Brazilian’’ ancestry, are likely to be of Portuguese or multiethnic ancestry.
Despite the multiethnic origin of the Brazilian population, the 195/105/C/A/A/150 haplotype shared by all 5382insC carriers points to a common origin for this mutation. To our knowledge, this mutation has not yet been reported in African or U.S. African-American populations [21e24], indicating that it was likely absent in native
II:3
5382insC 195 105 C A A 150
III:1 199 91 G G G 146
5382insC IV:1 195 105 C A A 150
195 107 C A A 146
49
5382insC
5382insC 39
III:2 195 105 C A A 150
II:5
189 103 C A A 148
195 105 C A A 150
Negative IV:2 199 91 G G G 148
III:3 219 89 G G G 144
36
Negative III:4 191 197 103 107 C C A A A A 148 150 Markers
219 89 G G G 144
telomere D17S1325 D17S1326 SNP- rs799905 SNP- rs12941 (exon 11) SNP- rs1799966 (exon 16) D17S855 (BRCA1 intron 20) centromere
Fig. 1. Pedigree of family from proband B (arrow), showing carriers of the BRCA1-5382insC mutation, and haplotype analysis. The haplotype linked to the mutation is boxed in mutation carries, and the markers used are given at the lower right. Age at cancer diagnosis is indicated for affected individuals. Symbols: Northeast quadrant black, breast cancer; top half black bilateral, breast cancer; bottom half black, ovary cancer; center dot, mutation carrier.
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
sub-Saharan populations and the different ethnic groups dispersed in the slave trade at the time of Brazilian colonization between the 16th and 19th centuries [25]. Additionally, this mutation has also not been reported in Amerindian or other South American populations [16,19], except for patients born in Brazil. In addition, there is no description of this insertion in breast cancer patients studied for BRCA1 mutations in Spain [15,17,18], and only one case was reported in Portugal [20]. On the other hand, the other frequent BRCA1 founder mutation, 185delAG, was reported in Iberian countries and South America [17,26], including non-Jewish individuals in Brazil [27]. The finding of 5382insC in Brazil but not elsewhere in South America is likely to be a consequence of a different development of the population structure. The sharing of an identical haplotype in Brazilian individuals of different ancestries indicates that 5382insC must have had a common origin. Given that this mutation is very frequent in Central and Eastern Europe, our data indicate a significant Eastern European contribution to the present genetic background of the Brazilian population, contrary to an alternative hypothesis of a contribution from new Christians immigrating in the 16th century. Data on European immigration to Brazil [28] indicate that Eastern or Central European immigration accounted for fewer than 10% of immigrants, with most of these (~176,000) from Germany, out of a total of 4,600,000 immigrants from 1884 to 1959. This probably differs from what occurred in the other South American countries. Acknowledgments This work was supported by the National Council for Scientific and Technological Development (Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico) (CNPq), Ary Fauzino Foundation for Cancer Research and Control (Fundac¸a˜o Ary Fauzino para Controle e Pesquisa do Caˆncer) (FAF), and the Carlos Chagas Filho Foundation for Support of Research of the State of Rio de Janeiro (Fundac¸a˜o Carlos Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro) (FAPERJ). We thank Dr. He´ctor N. Seuanez for reviewing the manuscript. References [1] Warner E, Foulkes W, Goodwin P, Meschino W, Blondal J, Paterson C, Ozcelik H, Goss P, Allingham-Hawkins D, Hamel N, Di Prospero L, Contiga V, Serruya C, Klein M, Moslehi R, Honeyford J, Liede A, Glendon G, Brunet JS, Narod S. Prevalence and penetrance of BRCA1 and BRCA2 gene mutations in unselected Ashkenazi Jewish women with breast cancer. J Natl Cancer Inst 1999;91:1241e7. [2] Barkardottir RB, Sarantaus L, Arason A, Vehmanen P, Bendahl PO, Kainu T, Syrja¨koski K, Krahe R, Huusko P, Pyrho¨nen S, Holli K, Kallioniemi OP, Egilsson V, Kere J, Nevanlinna H. Haplotype analysis in Icelandic and Finnish BRCA2 999del5 breast cancer families. Eur J Hum Genet 2001;10:773e9. [3] Hartmann C, John AL, Klaes R, Hofmann W, Bielen R, Koehler R, Janssen B, Bartram CR, Arnold N, Zschocke J. Large BRCA1 gene deletions are found in 3% of German high-risk breast cancer families. Hum Mutat 2004;24:534. [8 pp.].
65
[4] Neuhausen SL. Founder populations and their uses for breast cancer genetics. Breast Cancer Res 2000;2:77e81. [5] Neuhausen SL, Mazoyer S, Friedman L, Stratton M, Offit K, Caligo A, Tomlinson G, Cannon-Albright L, Bishop T, Kelsell D, Solomon E, Weber B, Couch F, Struewing J, Tonin P, Durocher F, Narod S, Skolnick MH, Lenoir G, Serova O, Ponder B, Stoppa-Lyonnet D, Easton D, King MC, Goldgar DE. Haplotype and phenotype analysis of six recurrent BRCA1 mutations in 61 families: results of an international study. Am J Hum Genet 1996;58:271e80. [6] Szabo CI, King MC. Population genetics of BRCA1 and BRCA2. Am J Hum Genet 1997;60:1013e20. [7] Go´rski B, Jakubowska A, Huzarski T, Byrski T, Gronwald J, Grzybowska E, Mackiewicz A, Stawicka M, Bebenek M, Sorokin D, Fiszer-Maliszewska q, Haus O, Janiszewska H, Niepsuj S, Go´zdz S, Zaremba L, Posmyk M, P1uzanska M, Kilar E, Czudowska D, Wasko B, Miturski R, Kowalczyk JR, Urbanski K, Szwiec M, Koc J, Debniak B, Rozmiarek A, Debniak T, Cybulski C, Kowalska E, To1oczko-Grabarek A, Zajaczek S, Menkiszak J, Medrek K, Masojc´ B, Mierzejewski M, Narod SA, Lubinski J. A high proportion of founder BRCA1 mutations in Polish breast cancer families. Int J Cancer 2004;110:683e6. [8] Sokolenko AP, Mitiushkina NV, Buslov KG, Bit-Sava EM, Iyevleva AG, ChekmariovaEV, ESh Kuligina, Ulibina YM, Rozanov ME, Suspitsin EN, Matsko DE, Chagunava OL, Trofimov DY, Devilee P, Cornelisse C, Togo AV, Semiglazov VF, Imyanitov EN. High frequency of BRCA1 5382insC mutation in Russian breast cancer patients. Eur J Cancer 2006;42:1380e4. [9] Backe J, Hofferbert S, Skawran B, Do¨rk T, Stuhrmann M, Karstens JH, Untch M, Meindl A, Burgemeister R, ChangClaude J, Weber BH. Frequency of BRCA1 mutation 5382insC in German breast cancer patients. Gynecol Oncol 1999;72:402e6. [10] Couch FJ, Weber BL. Mutations and polymorphisms in the familial early-onset breast cancer (BRCA1) gene. Breast Cancer Information Core Hum Mutat 1996;8:8e18. [11] Lourenc¸o JJ, Vargas FR, Bines J, Santos EM, Lasmar CAP, Costa CH, Teixeira EMB, Maia MCM, Coura F, Silva CHD, Moreira MAM. BRCA1 mutations in Brazilian patients. Genet Mol Biol 2004;27:500e4. [12] Dufloth RM, Carvalho S, Heinrich JK, Shinzato JY, dos Santos CC, Zeferino LC, Schmitt F. Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history. Sao Paulo Med J 2005;123:192e7. [13] Gomes MC, Costa MM, Borojevic R, Monteiro AN, Vieira R, Koifman S, Koifman RJ, Li S, Royer R, Zhang S, Narod SA. Prevalence of BRCA1 and BRCA2 mutations in breast cancer patients from Brazil. Breast Cancer Res Treat 2007;103:349e53. [14] Alves-Silva J, da Silva Santos M, Guimara˜es PE, Ferreira AC, Bandelt HJ, Pena SD, Prado VF. The ancestry of Brazilian mtDNA lineages [Erratum in: Am J Hum Genet 2000;67:775]. Am J Hum Genet 2000;67:444e61. [15] Infante M, Dura´n M, Esteban-Carden˜osa E, Miner C, Velasco E. High proportion of novel mutations of BRCA1 and BRCA2 in breast/ovarian cancer patients from Castilla-Leo´n (central Spain). J Hum Genet 2006;51:611e7. [16] Jara L, Ampuero S, Santiba´n˜ez E, Seccia L, Rodrı´guez J, Bustamante M, Martı´nez V, Catenaccio A, Lay-Son G, Blanco R, Reyes JM. BRCA1 and BRCA2 mutations in a South American population. Cancer Genet Cytogenet 2006;166:36e45. [17] Llort G, Munoz CY, Tuser MP, Guillermo IB, Lluch JR, Bale AE, Franco MA. Low frequency of recurrent BRCA1 and BRCA2 mutations in Spain. Hum Mutat 2002;19:307. [7 pp]. [18] Salazar R, Cruz-Hernandez JJ, Sanchez-Valdivieso E, Rodriguez CA, Gomez-Bernal A, Barco E, Fonseca E, Portugal T, GonzalezSarmiento R. BRCA1-2 mutations in breast cancer: identification of nine new variants of BRCA1-2 genes in a population from central western Spain. Cancer Lett 2006;233:172e7.
66
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
[19] Torres D, Rashid MU, Gil F, Umana A, Ramelli G, Robledo JF, Tawil M, Torregrosa L, Briceno I, Hamann U. High proportion of BRCA1/2 founder mutations in Hispanic breast/ovarian cancer families from Colombia. Breast Cancer Res Treat 2007;103:225e32. [20] Machado PM, Branda˜o RD, Cavaco BM, Euge´nio J, Bento S, Nave M, Rodrigues P, Fernandes A, Vaz F. Screening for a BRCA2 rearrangement in high-risk breast/ovarian cancer families: evidence for a founder effect and analysis of the associated phenotypes. J Clin Oncol 2007;25:2027e34. [21] Awadelkarim KD, Aceto G, Veschi S, Elhaj A, Morgano A, Mohamedani AA, Eltayeb EA, Abuidris D, Di Gioacchino M, Battista P, Verginelli F, Cama A, Elwali NE, Mariani-Costantini R. BRCA1 and BRCA2 status in a Central Sudanese series of breast cancer patients: interactions with genetic, ethnic and reproductive factors. Breast Cancer Res Treat 2007;102:189e99. [22] Fregene A, Newman LA. Breast cancer in sub-Saharan Africa: how does it relate to breast cancer in African-American women? Cancer 2005;103:1540e50. [23] Olopade OI, Fackenthal JD, Dunston G, Tainsky MA, Collins F, Whitfield-Broome C. Breast cancer genetics in African Americans. Cancer 2003;97(Suppl 1):236e45.
[24] Pegoraro RJ, Moodley M, Rom L, Chetty R, Moodley J. P53 codon 72 polymorphism and BRCA1 and 2 mutations in ovarian epithelial malignancies in black South Africans. Int J Gynecol Cancer 2003;13:444e9. [25] Klein HS. The African origins of Brasilian slaves [As origens Africanas dos escravos Brasileiros] [In Portuguese]. In: Pena SD, editor. Homo Brasilis: genetic, linguistic, historical, and socioanthropological aspects of the formation of the Brazilian people [Homo Brasilis: aspectos gene´ticos, linguisticos, histo´ricos, e socioantropolo´gicos da formac¸a˜o do povo brasileiro] [In Portuguese]. Ribeira˜o Preto, SP, Brazil: FUNPEC Editora, 2002. pp. 93e112. [26] Ah Mew N, Hamel N, Galvez M, Al-Saffar M, Foulkes WD. Haplotype analysis of a BRCA1: 185delAG mutation in a Chilean family supports its Ashkenazi origins. Clin Genet 2002;62:151e6. [27] Simon SD, Molina A, Moreira-Filho CA. Mutations of BRCA1/2 genes in Brazil [Abstract]. Presented at: Am Soc Clin Oncol Annu Meet 2003, New Orleans. Available at: http://www.asco.org/ASCO/Meetings. [28] IBGE-Instituto Brasileiro de Geografia e Estatı´stica. Brazil: 500 years of settlement [Brasil, 500 anos de povoamento] [In Portuguese]. Rio de Janeiro: Instituto Brasileiro de Geografia e Estatı´stica, 2000.
Short communication
Founder effect of the BRCA1 5382insC mutation in Brazilian patients with hereditary breast ovary cancer syndrome E.C.B. da Costaa, F.R. Vargasb,c, A.S. Moreirad, J.J. Lourenc¸ob,e, M. Caleffif, P. Ashton-Prollag,h,i, M.A.M. Martins Moreirab,* b
a Carlos Chagas Filho Institute of Biophysics, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil Genetics Division, National Cancer Institute (CPQ-INCA), Rua Andre´ Cavalcanti 37, Rio de Janeiro, RJ 20231-050, Brazil c Department of Genetics, Federal University of the State of Rio de Janeiro (UNI-RIO), Rio de Janeiro, Brazil d Genome Sequencing Platform DNA PDTIS, Laboratory of Functional Genomics and Bioinformatics, Oswaldo Cruz Institute (IOC-FIOCRUZ), Rio de Janeiro Brazil e Department of Genetics, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, Brazil f Mama Moinhos Core Facility, Moinhos de Vento Hospital, Porto Alegre, Brazil g Department of Genetics, Federal University of Rio Grande do Sul (UFRGS) h Medical Genetics Service, Porto Alegre Clinics Hospital (HCPA), Porto Alegre, Brazil i Laboratory of Genomic Medicine, Research Center, Porto Alegre Clinics Hospital (HCPA), Porto Alegre, Brazil
Received 26 December 2007; received in revised form 10 March 2008; accepted 21 March 2008
Abstract
The 5382insC mutation in BRCA1 is a frequently reported mutation, being very prevalent in Central and Eastern Europe. This mutation was recurrently reported in Brazil and one case was reported Portugal, but not in Spain and other South-American countries,. We analyzed the haplotypic profile of seven Brazilian carriers of 5382insC to characterize a possible founder effect. The analyses indicated that mutation carriers shared an identical haplotype. The absence of this mutation in Spain, other South American countries, and sub-Saharan populations, as well as the patients’ own ancestry, point to a significant Central or Eastern European contribution to the present genetic background of Brazilian population, different from the population structuring of remaining South American countries. Ó 2008 Elsevier Inc. All rights reserved.
1. Introduction In different populations, founder mutations associated with the hereditary breast and ovary cancer (HBOC) predisposition syndrome have been frequently reported, such as 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 in Ashkenazi Jews [1]; BRCA2 mutation 999del5 in Finland and Iceland [2]; and deletion of exon 17 in BRCA1 among the German population [3]. Because of their high frequency in some populations, founder mutations allow for studies of penetrance, expression, and environmental or genetic risk modifiers [4]. Additionally, haplotype analyses of founder mutation carriers can demonstrate a single common origin of these mutationsdor, alternatively, independent origins, as suggested by Neuhausen et al. [5] for 185delAG in BRCA1. * Corresponding author. Tel.: þ55 21 3233 1460; fax: þ55 21 3233 1423 E-mail address: [email protected] (M.A.M. Martins Moreira). 0165-4608/08/$ e see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2008.03.011
The 5382insC mutation in BRCA1 exon 20 is the second most frequently reported mutation in familial breast cancer in the BIC database (Breast Cancer Information Core; http://research.nhgri.nih.gov/bic/), being very prevalent in Central and Eastern Europe [6]. It is found in ~34% of familial breast cancer cases in Poland [7], 14% in Russia [8], 4% in Germany [9], and 10% among Ashkenazi Jews [10]. Studies using genetic markers (microsatellites and single-nucleotide polymorphisms [SNPs]) suggest that the same haplotype was shared by 5382insC mutation carriers [2,5,9], indicating a single origin in European populations. This mutation was also reported in Brazilian women with breast cancer [11e13], in a population characterized by admixture of multiethnic groups, containing similar European, African, and Amerindian components [14]. Gomes et al. [13] suggest that the high prevalence of BRCA1 5382insC could be related to a founder effect secondary to immigration of Portuguese and Spanish new Christians (i.e., Jewish converts) into Brazil in the 16th century. However, we were unable to find one single report of this
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
mutation 5282insC in breast cancer patients from Spain or from other South American countries [15e19], and only one case was reported from Portugal [20]. In the present study, we analyzed the haplotypic profile of seven unrelated Brazilian carriers of the 5382insC mutation, to characterize a possible founder effect for this mutation in Brazil.
2. Materials and methods 2.1. Patients and mutation detection Seven unrelated carriers of the germline BRCA1 mutation 5382insC and six relatives of two of the probands were used for haplotypic analyses. All procedures followed ethical guidelines and were approved by the local Ethics Committee. Mutations were detected by polymerase chain reaction (PCR) amplifications of exon 20 and direct DNA sequencing with primers 50 CAGAGCAAGACCCTGTCTC 30 /50 GGGAATCCAAATTACACAGC 30 . PCR reactions were performed in 1 PCR buffer (Invitrogen, Carlsbad, CA), 250 mmol/L of each dNTP, 50 pmol of each primer and 1 U of Taq DNA polymerase (Promega, Madison, WI, or Invitrogen) with 100 ng of genomic DNA in a final volume of 50 mL; amplification conditions being 94 C (4 minutes), followed by 35 cycles of 94 C (45 seconds), 60 C (30 seconds), and 72 C (30 seconds). The PCR products were purified with a GFX PCR DNA and gel band purification kit (GE-Healthcare, Chalfont St. Giles, UK) and sequenced with DYEnamic ET dye terminator cycle sequencing kit (GE-Healthcare), following the manufacturer’s instructions. Sequence reactions were run in an ABI-PRISM 377 automatic sequencer (Applied Biosystems, Foster City, CA). 2.2. Haplotypic characterization We used three SNPs and three microsatellite loci for haplotypic characterizations, encompassing ~500 kb of chromosome 13 around the BRCA1 locus. The SNPs were analyzed by PCR amplification and DNA sequencing. SNP rs799905GOC at the b promoter of BRCA1 was amplified with primers BC1ex1AF (50 -TAGCCCCTTGG TTTCCGTG-3´) and BC1ex1AR (5´-TCACAACGCCTTACGCCTC-30 ). PCR reactions were performed in 2.5 mmol/L MgCl2, 250 mmol/L of each dNTP, 50 pmol of each primer, 1 U of Taq DNA polymerase (Invitrogen), and 1 PCR buffer (Invitrogen), and 20e200 ng of genomic DNA in a final volume of 50 mL, with 35 cycles of 94 C (45 seconds), 58 C (45 seconds), and 72 C (30 seconds). SNP rs16941GAAOGGA (Glu1038Gly) at exon 11 was amplified with primer pair EX11F 50 -CCAGTAC AGTGAGCACAATTA-30 /EX11R50 -GTGTTGGAAGCAG GGAAGCTCTTC-30 and SNP rs1799966AGTOGGT (Ser1612Gly) at exon 16 was amplified with primer pair EX16F 50 -AATTCTTAACAGAGACCAGAAC-30 /EX16R50 AAAACTCTTTCCAGAATGTTGT-30 .
63
The PCR reactions were performed in 2.5 mmol/L MgCl2, 250 mmol/L of each dNTP, 50 pmol of each primer, 1 U of Taq DNA polymerase (Invitrogen) and 1 PCR buffer (Invitrogen), and 20e200 ng of genomic DNA in a final volume of 50 mL. Reactions were submitted to an initial step of 94 C for 4 minutes, followed by 35 cycles of 94 C (1 minute); 55 C (1 minute), and 72 C (1 minute). PCR products were purified and sequenced as described above. Three BRCA1-linked microsatellite loci were analyzed. D17S855 (intragenic marker in intron 20) and D17S1325 and D17S1326 (upstream markers) were used for genotyping with primers as listed in the Genome Database (http:// www.gdb.org). For all microsatellite loci, PCR amplifications were performed in final volumes of 25 mL with 2.0 mmol/L MgCl2, 125 mmol/L of each dNTP, 10 pmol of each primer, 1 PCR buffer, and 1 U of Platinum Taq DNA polymerase (Invitrogen) and 20e200 ng of genomic DNA. Amplification cycles were 30 cycles of 94 C (15 seconds), 60 C (15 seconds), and 72 C (20 seconds). Forward primers were labeled with carboxyfluorescein, and PCR products were run in a MEGABace 1000 Sequencer (Amersham BioscienceseGE Healthcare). Scoring of allele size was achieved using the internal size standard ET ROX400. Genetic Profile (version 2.0) software (GE-Healthcare) was used to estimate allele size. 3. Results and discussion The relevance of the 5382insC mutation is highlighted by its high frequency and penetrance in several populations around the world. Previous studies in the Brazilian population [11e13] reported 10, initially unrelated, carriers of this mutation in a total of 17 mutations detected in BRCA1 and BRCA2. Four of these probands, previously reported by Lourenc¸o et al. [11], are included in the present analysis; the other three probands are reported here for the first time. Age of cancer diagnosis (ovary or breast cancer) ranged from 26 to 47 years, with four bilateral cases (breast or ovarian; Table 1). Haplotyping with BRCA1 intragenic and intergenic markers in the seven unrelated probands indicated that they shared an identical haplotype (Table 1). A set of identical alleles was observed in all probands, indicating that 5382insC was syntenic with the following alleles: D17S1325/195, D17S1326/105, rs799905 C, rs16941 A (Glu1038Gly in exon 11), rs1799966 A (Ser1612Gly, in exon 16), and D17S855/150. The shared haplotype thus is 195/105/C/A/A/150. To confirm this possibility, these six markers were analyzed in three relatives of proband B (Fig. 1) and one relative of proband F who were also carriers of 5382insC. The same set of alleles (195/105/C/ A/A/150) was found in all of them. Familial cancer histories were not exclusively related with Eastern or Central European ancestry in these patients, because this was the case only for patients A and G. Patient
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
64
Table 1 Genotypic characterization for genetic markers near or at the BRCA1 locus in 5382inC mutation carriers A Clinical and demographic characteristics Cancer dx Bilateral ovarian Age at dx, yr 47 Ancestry Western Eur., Eastern Eur. Markers D17S1325 195/195 D17S1326 105/103 SNP-rs799905 C/C SNP-rs12941 A/A SNP-rs1799966 A/A D17S855 150/152
B
C
D
E
F
G
Bilateral breast 36 Brazilian,a Western Eur.
Bilateral breast 46 Central Eur., Western Eur.
Bilateral breast 37 Braziliana
Breast 33 Braziliana
Breast 26 Braziliana
Breast d Brazilian,a Central Eur.
195/219 105/89 C/G A/G A/G 150/144
195/197 105/109 C/C A/A A/A 150/142
195/203 105/103 C/C A/A A/A 150/150
195/193 105/109 C/G A/A A/A 150/152
195/195 105/107 C/C A/A A/A 150/152
195/197 105/91 C/G A/G A/G 150/144
Abbreviations: dx, diagnosis; Eur., European. a ‘‘Brazilian’’ denotes pedigree without indication of European origin.
C did not report any data on breast or ovary familial cancer history, and patient B did not report the occurrence of any cancer history in her Eastern European ancestors. The remaining probands, reported simply as of ‘‘Brazilian’’ ancestry, are likely to be of Portuguese or multiethnic ancestry.
Despite the multiethnic origin of the Brazilian population, the 195/105/C/A/A/150 haplotype shared by all 5382insC carriers points to a common origin for this mutation. To our knowledge, this mutation has not yet been reported in African or U.S. African-American populations [21e24], indicating that it was likely absent in native
II:3
5382insC 195 105 C A A 150
III:1 199 91 G G G 146
5382insC IV:1 195 105 C A A 150
195 107 C A A 146
49
5382insC
5382insC 39
III:2 195 105 C A A 150
II:5
189 103 C A A 148
195 105 C A A 150
Negative IV:2 199 91 G G G 148
III:3 219 89 G G G 144
36
Negative III:4 191 197 103 107 C C A A A A 148 150 Markers
219 89 G G G 144
telomere D17S1325 D17S1326 SNP- rs799905 SNP- rs12941 (exon 11) SNP- rs1799966 (exon 16) D17S855 (BRCA1 intron 20) centromere
Fig. 1. Pedigree of family from proband B (arrow), showing carriers of the BRCA1-5382insC mutation, and haplotype analysis. The haplotype linked to the mutation is boxed in mutation carries, and the markers used are given at the lower right. Age at cancer diagnosis is indicated for affected individuals. Symbols: Northeast quadrant black, breast cancer; top half black bilateral, breast cancer; bottom half black, ovary cancer; center dot, mutation carrier.
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
sub-Saharan populations and the different ethnic groups dispersed in the slave trade at the time of Brazilian colonization between the 16th and 19th centuries [25]. Additionally, this mutation has also not been reported in Amerindian or other South American populations [16,19], except for patients born in Brazil. In addition, there is no description of this insertion in breast cancer patients studied for BRCA1 mutations in Spain [15,17,18], and only one case was reported in Portugal [20]. On the other hand, the other frequent BRCA1 founder mutation, 185delAG, was reported in Iberian countries and South America [17,26], including non-Jewish individuals in Brazil [27]. The finding of 5382insC in Brazil but not elsewhere in South America is likely to be a consequence of a different development of the population structure. The sharing of an identical haplotype in Brazilian individuals of different ancestries indicates that 5382insC must have had a common origin. Given that this mutation is very frequent in Central and Eastern Europe, our data indicate a significant Eastern European contribution to the present genetic background of the Brazilian population, contrary to an alternative hypothesis of a contribution from new Christians immigrating in the 16th century. Data on European immigration to Brazil [28] indicate that Eastern or Central European immigration accounted for fewer than 10% of immigrants, with most of these (~176,000) from Germany, out of a total of 4,600,000 immigrants from 1884 to 1959. This probably differs from what occurred in the other South American countries. Acknowledgments This work was supported by the National Council for Scientific and Technological Development (Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico) (CNPq), Ary Fauzino Foundation for Cancer Research and Control (Fundac¸a˜o Ary Fauzino para Controle e Pesquisa do Caˆncer) (FAF), and the Carlos Chagas Filho Foundation for Support of Research of the State of Rio de Janeiro (Fundac¸a˜o Carlos Chagas Filho de Amparo a Pesquisa do Estado do Rio de Janeiro) (FAPERJ). We thank Dr. He´ctor N. Seuanez for reviewing the manuscript. References [1] Warner E, Foulkes W, Goodwin P, Meschino W, Blondal J, Paterson C, Ozcelik H, Goss P, Allingham-Hawkins D, Hamel N, Di Prospero L, Contiga V, Serruya C, Klein M, Moslehi R, Honeyford J, Liede A, Glendon G, Brunet JS, Narod S. Prevalence and penetrance of BRCA1 and BRCA2 gene mutations in unselected Ashkenazi Jewish women with breast cancer. J Natl Cancer Inst 1999;91:1241e7. [2] Barkardottir RB, Sarantaus L, Arason A, Vehmanen P, Bendahl PO, Kainu T, Syrja¨koski K, Krahe R, Huusko P, Pyrho¨nen S, Holli K, Kallioniemi OP, Egilsson V, Kere J, Nevanlinna H. Haplotype analysis in Icelandic and Finnish BRCA2 999del5 breast cancer families. Eur J Hum Genet 2001;10:773e9. [3] Hartmann C, John AL, Klaes R, Hofmann W, Bielen R, Koehler R, Janssen B, Bartram CR, Arnold N, Zschocke J. Large BRCA1 gene deletions are found in 3% of German high-risk breast cancer families. Hum Mutat 2004;24:534. [8 pp.].
65
[4] Neuhausen SL. Founder populations and their uses for breast cancer genetics. Breast Cancer Res 2000;2:77e81. [5] Neuhausen SL, Mazoyer S, Friedman L, Stratton M, Offit K, Caligo A, Tomlinson G, Cannon-Albright L, Bishop T, Kelsell D, Solomon E, Weber B, Couch F, Struewing J, Tonin P, Durocher F, Narod S, Skolnick MH, Lenoir G, Serova O, Ponder B, Stoppa-Lyonnet D, Easton D, King MC, Goldgar DE. Haplotype and phenotype analysis of six recurrent BRCA1 mutations in 61 families: results of an international study. Am J Hum Genet 1996;58:271e80. [6] Szabo CI, King MC. Population genetics of BRCA1 and BRCA2. Am J Hum Genet 1997;60:1013e20. [7] Go´rski B, Jakubowska A, Huzarski T, Byrski T, Gronwald J, Grzybowska E, Mackiewicz A, Stawicka M, Bebenek M, Sorokin D, Fiszer-Maliszewska q, Haus O, Janiszewska H, Niepsuj S, Go´zdz S, Zaremba L, Posmyk M, P1uzanska M, Kilar E, Czudowska D, Wasko B, Miturski R, Kowalczyk JR, Urbanski K, Szwiec M, Koc J, Debniak B, Rozmiarek A, Debniak T, Cybulski C, Kowalska E, To1oczko-Grabarek A, Zajaczek S, Menkiszak J, Medrek K, Masojc´ B, Mierzejewski M, Narod SA, Lubinski J. A high proportion of founder BRCA1 mutations in Polish breast cancer families. Int J Cancer 2004;110:683e6. [8] Sokolenko AP, Mitiushkina NV, Buslov KG, Bit-Sava EM, Iyevleva AG, ChekmariovaEV, ESh Kuligina, Ulibina YM, Rozanov ME, Suspitsin EN, Matsko DE, Chagunava OL, Trofimov DY, Devilee P, Cornelisse C, Togo AV, Semiglazov VF, Imyanitov EN. High frequency of BRCA1 5382insC mutation in Russian breast cancer patients. Eur J Cancer 2006;42:1380e4. [9] Backe J, Hofferbert S, Skawran B, Do¨rk T, Stuhrmann M, Karstens JH, Untch M, Meindl A, Burgemeister R, ChangClaude J, Weber BH. Frequency of BRCA1 mutation 5382insC in German breast cancer patients. Gynecol Oncol 1999;72:402e6. [10] Couch FJ, Weber BL. Mutations and polymorphisms in the familial early-onset breast cancer (BRCA1) gene. Breast Cancer Information Core Hum Mutat 1996;8:8e18. [11] Lourenc¸o JJ, Vargas FR, Bines J, Santos EM, Lasmar CAP, Costa CH, Teixeira EMB, Maia MCM, Coura F, Silva CHD, Moreira MAM. BRCA1 mutations in Brazilian patients. Genet Mol Biol 2004;27:500e4. [12] Dufloth RM, Carvalho S, Heinrich JK, Shinzato JY, dos Santos CC, Zeferino LC, Schmitt F. Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history. Sao Paulo Med J 2005;123:192e7. [13] Gomes MC, Costa MM, Borojevic R, Monteiro AN, Vieira R, Koifman S, Koifman RJ, Li S, Royer R, Zhang S, Narod SA. Prevalence of BRCA1 and BRCA2 mutations in breast cancer patients from Brazil. Breast Cancer Res Treat 2007;103:349e53. [14] Alves-Silva J, da Silva Santos M, Guimara˜es PE, Ferreira AC, Bandelt HJ, Pena SD, Prado VF. The ancestry of Brazilian mtDNA lineages [Erratum in: Am J Hum Genet 2000;67:775]. Am J Hum Genet 2000;67:444e61. [15] Infante M, Dura´n M, Esteban-Carden˜osa E, Miner C, Velasco E. High proportion of novel mutations of BRCA1 and BRCA2 in breast/ovarian cancer patients from Castilla-Leo´n (central Spain). J Hum Genet 2006;51:611e7. [16] Jara L, Ampuero S, Santiba´n˜ez E, Seccia L, Rodrı´guez J, Bustamante M, Martı´nez V, Catenaccio A, Lay-Son G, Blanco R, Reyes JM. BRCA1 and BRCA2 mutations in a South American population. Cancer Genet Cytogenet 2006;166:36e45. [17] Llort G, Munoz CY, Tuser MP, Guillermo IB, Lluch JR, Bale AE, Franco MA. Low frequency of recurrent BRCA1 and BRCA2 mutations in Spain. Hum Mutat 2002;19:307. [7 pp]. [18] Salazar R, Cruz-Hernandez JJ, Sanchez-Valdivieso E, Rodriguez CA, Gomez-Bernal A, Barco E, Fonseca E, Portugal T, GonzalezSarmiento R. BRCA1-2 mutations in breast cancer: identification of nine new variants of BRCA1-2 genes in a population from central western Spain. Cancer Lett 2006;233:172e7.
66
E.C.B. da Costa et al. / Cancer Genetics and Cytogenetics 184 (2008) 62e66
[19] Torres D, Rashid MU, Gil F, Umana A, Ramelli G, Robledo JF, Tawil M, Torregrosa L, Briceno I, Hamann U. High proportion of BRCA1/2 founder mutations in Hispanic breast/ovarian cancer families from Colombia. Breast Cancer Res Treat 2007;103:225e32. [20] Machado PM, Branda˜o RD, Cavaco BM, Euge´nio J, Bento S, Nave M, Rodrigues P, Fernandes A, Vaz F. Screening for a BRCA2 rearrangement in high-risk breast/ovarian cancer families: evidence for a founder effect and analysis of the associated phenotypes. J Clin Oncol 2007;25:2027e34. [21] Awadelkarim KD, Aceto G, Veschi S, Elhaj A, Morgano A, Mohamedani AA, Eltayeb EA, Abuidris D, Di Gioacchino M, Battista P, Verginelli F, Cama A, Elwali NE, Mariani-Costantini R. BRCA1 and BRCA2 status in a Central Sudanese series of breast cancer patients: interactions with genetic, ethnic and reproductive factors. Breast Cancer Res Treat 2007;102:189e99. [22] Fregene A, Newman LA. Breast cancer in sub-Saharan Africa: how does it relate to breast cancer in African-American women? Cancer 2005;103:1540e50. [23] Olopade OI, Fackenthal JD, Dunston G, Tainsky MA, Collins F, Whitfield-Broome C. Breast cancer genetics in African Americans. Cancer 2003;97(Suppl 1):236e45.
[24] Pegoraro RJ, Moodley M, Rom L, Chetty R, Moodley J. P53 codon 72 polymorphism and BRCA1 and 2 mutations in ovarian epithelial malignancies in black South Africans. Int J Gynecol Cancer 2003;13:444e9. [25] Klein HS. The African origins of Brasilian slaves [As origens Africanas dos escravos Brasileiros] [In Portuguese]. In: Pena SD, editor. Homo Brasilis: genetic, linguistic, historical, and socioanthropological aspects of the formation of the Brazilian people [Homo Brasilis: aspectos gene´ticos, linguisticos, histo´ricos, e socioantropolo´gicos da formac¸a˜o do povo brasileiro] [In Portuguese]. Ribeira˜o Preto, SP, Brazil: FUNPEC Editora, 2002. pp. 93e112. [26] Ah Mew N, Hamel N, Galvez M, Al-Saffar M, Foulkes WD. Haplotype analysis of a BRCA1: 185delAG mutation in a Chilean family supports its Ashkenazi origins. Clin Genet 2002;62:151e6. [27] Simon SD, Molina A, Moreira-Filho CA. Mutations of BRCA1/2 genes in Brazil [Abstract]. Presented at: Am Soc Clin Oncol Annu Meet 2003, New Orleans. Available at: http://www.asco.org/ASCO/Meetings. [28] IBGE-Instituto Brasileiro de Geografia e Estatı´stica. Brazil: 500 years of settlement [Brasil, 500 anos de povoamento] [In Portuguese]. Rio de Janeiro: Instituto Brasileiro de Geografia e Estatı´stica, 2000.