Fowl adenovirus serotype 4: Epidemiology, pathogenesis, diagnostic detection, and vaccine strategies

Fowl adenovirus serotype 4: Epidemiology, pathogenesis, diagnostic detection, and vaccine strategies P. H. Li,∗,† P. P. Zheng,∗,‡ T. F. Zhang,∗,‡ G. Y. Wen,∗,‡ H. B. Shao,∗,‡ and Q. P. Luo∗,‡,1 ∗

Key Laboratory of Prevention and Control Agents for Animal Bacteriosis (Ministry of Agriculture), Institute of Animal Husbandry and Veterinary Sciences, Hubei Academy of Agricultural Sciences, Special 1, Nanhuyaoyuan, Hongshan District, Wuhan, 430064, China; † Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Science, Wuhan, China; and ‡ Hubei Key Laboratory of Animal Embryo and Molecular Breeding, Institute of Animal Husbandry and Veterinary Sciences, Hubei Academy of Agricultural Sciences, Special 1, Nanhuyaoyuan, Hongshan District, Wuhan, 430064, China fusion test, indirect immunofluorescence assays, counterimmunoelectrophoresis, enzyme-linked immunosorbent assays, restriction endonuclease analyses, polymerase chain reaction (PCR), real-time PCR, and high-resolution melting-curve analyses). Although inactivated vaccines have been deployed widely to control the disease, attenuated live vaccines and subunit vaccines also have been developed, and they are more attractive vaccine candidates. This article provides a comprehensive review of FAdV-4, including its epidemiology, pathogenesis, diagnostic detection, and vaccine strategies.

ABSTRACT Fowl adenovirus (FAdV) serotype-4 is highly pathogenic for chickens, especially for broilers aged 3 to 5 wk, and it has emerged as one of the foremost causes of economic losses to the poultry industry in the last 30 years. The liver is a major target organ of FAdV-4 infections, and virus-infected chickens usually show symptoms of hydropericardium syndrome. The virus is very contagious, and it is spread both vertically and horizontally. It can be isolated from infected liver homogenates and detected by several laboratory diagnostic methods (including an agar gel immunodif-

Key words: diagnosis, epidemiology, FAdV-4, pathogenesis, vaccine 2017 Poultry Science 00:1–11 http://dx.doi.org/10.3382/ps/pex087

INTRODUCTION

ing of the virus, and to discuss the latest progress and prospects regarding disease control.

Fowl adenovirus (FAdV) serotype-4, one of 12 FAdV subtypes, is the causative agent of hydropericardium syndrome (HPS), a severe disease in broiler chickens that is characterized by the accumulation of a clear, straw-colored fluid in the pericardial sac, as well as nephritis and hepatitis (Fig. 1). Its mortality rate ranges from 30 to 70% (Cheema et al., 1989; Mansoor et al., 2011; Zhao et al., 2015; Shah et al., 2016). Since the first outbreak of FAdV-4 in Pakistan in 1987, the virus has propagated to vast regions of Asia, Central and South America, and some European countries (Ravindran and Roy, 2014). Given that HPS caused by FAdV-4 is highly infectious, which results in significant morbidity and mortality in broiler chickens, and that it is associated with increased costs related to vaccination and disinfection, FAdV-4-mediated economic losses to the broiler industry are substantial. Thus, a comprehensive review is needed to facilitate our understand-

CLASSIFICATION, STRUCTURE, AND PHYSICOCHEMICAL PROPERTIES FADV belonging to the family Adenoviridae and genus Aviadenovirus can be divided into 5 species (FAdV-A to FAdV-E) based on their restriction enzyme digestion pattern (Zsak and Kisary, 1984), and 12 serotypes (FAdV-1 to 8a and 8b to 11) have been identified by a cross-neutralization test (Hess, 2000; Kim et al., 2014). FAdV-4 has been grouped into the species FAdV-C (Schachner et al., 2014), and it has a doublestranded DNA genome of approximately 43 to 46 kb, which encodes 10 major structural proteins in the virion (Fig. 2) and 11 non-structural proteins, including E1A, E1B, DBP [E2A], ADP [E3], E4, 52/55 K, pIVaII, pol, EP, 33 K, and 100 K (Hess et al., 1995; Ojkic and Nagy, 2000; Nemerow et al., 2009; Griffin and Nagy, 2011; Xie et al., 2013). FAdV-4 is filterable through a membrane filter (0.1-μm pore size) (Kumar et al., 1997), and virus pellets from liver extracts were demonstrated to be isometric, spherical particles measuring 80 to 90 nm in

 C 2017 Poultry Science Association Inc. Received October 25, 2016. Accepted March 20, 2017. 1 Corresponding author: [email protected]

1

2

LI ET AL.

Figure 1. Gross lesions of broiler chickens naturally infected with FAdV-4. 1a: A clear, straw-colored fluid accumulated in the pericardial sac. The liver swelled. 1b: The kidney exhibited edemas with uric acid deposition.

Figure 2. Schematic diagram of FAdV showing the 10 capsid proteins. Hexons constitute the facets of the icosahedral capsid, and pentons cap the vertices of the capsid. Two antenna-like fiber proteins that are morphologically unique anchor each penton base (Hess et al., 1995). Minor capsid proteins (pIIIa, pVI, and pVIII) are located in the inner surface. Protein IX has not yet been found in the FAdV capsid (Ojkic and Nagy, 2000; Griffin and Nagy, 2011; Zhao, et al., 2015). Terminal protein, protein μ , protein V, and protein VII are attached to the DNA genome within the virus particles. Adapted from (Nemerow, et al., 2009).

diameter by transmission electron microscopy (TEM) (Chandra et al., 1997, 2000). The pH tolerability of FAdV-4 ranges from 3 to 10. The virus can be inactivated by heating at 60◦ C for one h, 80◦ C for 10 min, or 100◦ C for 5 min, or by treating with 5% chloroform or 10% ether (Afzal et al., 1991).

EPIDEMIOLOGY The first outbreak of FAdV-4 was identified in Pakistan in 1987 (Khawaja et al., 1988; Grgi´c et al.,

2013). The disease caused by FAdV-4 is characterized by an accumulation of a clear, straw-colored fluid in the pericardium, nephritis, and hepatitis, and it is known as “Angara Disease” because of the epidemic region of Angara Goth, near Karachi, Pakistan (Khawaja et al., 1988; Anjum et al., 1989; Akhtar, 1994). Subsequently, outbreaks have extended to other countries, including Iraq (TA abdul-Aziz, 1991; Abdul-Aziz and Hasan, 1995), India (Gowda and Satyanarayana, 1994), Japan (Abe et al., 1998), Mexico, Chile, Ecuador, Peru (Cowen et al., 1996; Shane, 1996; Voss et al., 1996), Russia (Borisov et al., 1997), Slovakia (Jantosovic et al., 1991), Bangladesh (Biswas et al., 2002), Korea (Kim et al., 2008), and China (Zhang, 2006; Li et al., 2016c) (Fig. 3). Broiler chickens are the dominant host for FAdV-4, and once an infection starts, chickens most likely develop HPS and other complications (Grgi´c et al., 2013). The majority of FAdV-4 infections are endemic during the hot and humid season (Schachner et al., 2014; Shah et al., 2016), but sporadic outbreaks also occur in other seasons. In India, the first outbreak of FAdV4 was documented in the poultry farms of Jammuand Kashmir, Punjab, and Delhi during 1994 (Gowda and Satyanarayana, 1994). Months later, HPS caused by FAdV-4 spread to other parts of India, including Terai of Uttarakhand, Uttar Pradesh, Maharashtra, Andhra Pradesh, Karnataka, Tamil Nadu, and Kerala (Asrani et al., 1997; Kumar et al., 1997; Asthana et al., 2013). The disease is commonly called “leechi disease” because of the characteristic appearance of an infected hydropericardium, which is similar to that of the exterior of an Indian leechi fruit (Gowda and Satyanarayana, 1994; Naeem et al., 1995a). The disease manifests suddenly, with a high morbidity of the hydropericardium, and its mortality rate can reach 80% (Shane, 1996). During long-term surveillance of FAdV-4 in China, HPS cases had sporadic or clustered distributions from 2006 to 2014 (Zhang, 2006; Ren et al., 2011; Liu et al., 2015; Li et al., 2016a); however, since July 2015, epidemics have broken out in Henan, Hebei, Liaoning, Jilin, Heilongjiang, Xinjiang, Anhui, Shandong, Jiangxi, Hubei, and Jiangsu provinces, and they have

FOWL ADENOVIRUS SEROTYPE 4: A FULL REVIEW

3

Figure 3. Worldwide distribution of FAdV-4. Red indicates countries where FAdV-4 has been endemic or epidemic. Data were collected from GenBank and PubMed publications.

tended to spread rapidly (Liu and Ma, 2015; Li et al., 2016b,c). Phylogenetic analyses of the hexon gene revealed that 12 outbreak-associated FAdV-4 strains clustered with two Chinese FAdV-4 isolates (PK-01 and PK-06) in a relatively independent branch of the tree, which suggests that these strains may have originated from previously isolated strains in India (Zhang et al., 2016). The disease has been observed mainly in yellowfeather broilers aged 4 to 8 wk, and occasionally in broilers aged 2 to 3 wk, and it is characterized by an acute onset with an incubation period of 24 to 48 h, and by hydropericardium, in which a clear, straw-colored fluid accumulates in the pericardial sac. Additionally, the liver swells, and the kidneys exhibit edemas with uric acid deposition (Fig. 1). Outbreaks of HPS in 817 broilers, white-feather broilers, Ma chickens, and commercial layers also have been recorded (Liu and Ma, 2015). The mortality rate during these outbreaks of HPS in broiler farms in China was nearly 40%, reaching 90% in the worst cases (Li et al., 2016a). Novel Chinese FAdV-4 isolates with a truncated ORF19 gene have been blamed for this pandemic (Ye et al., 2016; Li et al., 2016c). Chinese FAdV-4 isolates (including HB1510, JX15, and HNLY15) carry a deletion in the ORF19 gene, compared with other serotype 4 isolates (KR-5, ON1, and MX-SHP90 from Austria, Canada, and Mexico, respectively), and they were highly pathogenic in infection studies in chickens (Ye et al., 2016; Li et al., 2016c). Note that these results are consistent with the FAdV-4 strain SHP95. This strain, which has a deletion in the ORF19 gene, was isolated from a chicken broiler farm in Mexico, and it is more virulent than isolates with an intact ORF19 gene (Vera-Hernandez et al., 2016). However, further studies are needed to elucidate the exact role of the ORF19 deletions in these highly virulent strains. It was also found that these Chinese FAdV-4 isolates harbored 33-nt or 66-nt deletions in

the ORF29 gene, compared with a 2013 Chinese FAdV4 isolate (Ye et al., 2016), which suggests that these FAdV-4 strains adapt to their hosts and environments in China. Recently, it has been reported that the detection, identification, and isolation of FAdV-4 in ducks (Chen et al., 2016), geese (Ivanics et al., 2010; Li et al., 2016a), and ostriches (Li et al., 2016a) correlates with HPS. The ill duck flocks, comprising ducks aged from 25 to 40 d old, were characterized by similar symptoms to HPS in chickens (pericardial effusion, an enlarged and discolored liver, and renal enlargement) with mortality rates of 15 to 30%; however, no mortality occurred in duckling flocks that were less than one wk old (Chen et al., 2016). In the gosling cases, the morbidity and mortality started at 8 to 9 d and ended at 24 to 25 d of age, and the most typical signs of HPS also were observed (VeraHernandez et al., 2016). The ill ostriches developed astasia, loss of appetite, and HPS with mortality rates of 15 to 30%. All the deaths occurred in young ostriches (Li et al., 2016a). These epidemiological data may contribute to determining the evolutionary relationships of FAdV-4 among various host species, thereby providing insights into the control and prevention of FAdV.

PATHOGENESIS It has been proven that FAdV-4 alone is the etiological agent of HPS (Ganesh et al., 2002a). HPS caused by FAdV-4 follows an unusually aggressive clinical course, ranging from 7 to 15 d, and different broiler strains share similar sensitivities to FAdV-4 under field conditions (Anjum et al., 1989). Embryonated chicken eggs inoculated with FAdV-4 by the yolk-sac route will end with stunted growth, hemorrhage, and death of the embryos (Cheema et al., 1989; Shafique et al., 1993). HPS can be reproduced in commercial broiler

4

LI ET AL.

PURIFICATION OF THE VIRUS

Figure 4. FAdV-4 transmission cycle. FAdV-4 proliferating in broilers is transmitted horizontally from flock to flock by the fecaloral route. If breeder chickens are infected before laying eggs, their progeny would most likely be infected congenitally, which further facilitates the vertical transmission of the causative agent. Wild birds that have high positive rates of HPS might serve as specific reservoirs in the spread of the disease under natural conditions.

chickens by the subcutaneous injection of an infected liver homogenate (Cheema et al., 1989; Anjum, 1990; Kumar et al., 1997), but this does not represent the mode of transmission of HPS under field conditions. When specific-pathogen-free (SPF) chickens were used as animal models to search for the transmission mode, HPS was reproduced by oral infection with purified, virulent FAdV-4 (Mazaheri et al., 1998), which highlighted the role of FAV4 in the pathogenesis of HPS. FAdV-4 is highly pathogenic for broiler chickens (Khawaja et al., 1988), and it is transmitted horizontally from flock to flock and farm to farm (Cowen, 1992; Akhtar, 1995; Chandra et al., 2000) by the fecaloral route (Abdul-Aziz and Hasan, 1995; Cowen et al., 1996) (Fig. 4). The HPS agent also can infect broilers through vertical transmission (Asthana et al., 2013). In the event that broiler breeder chickens are infected by the virus before laying eggs, their progeny would most likely be infected congenitally, which further facilitates the vertical transmission of the causative agent (Cowen, 1992; Toro et al., 2001). According to the results of an indirect hemagglutination assay, serum samples of crows and pigeons had high positive rates of HPS, which suggests that free-living birds could be carriers of the HPS agent (Manzoor et al., 2013). Wild birds might serve as specific reservoirs in the spread of the disease under natural conditions, although further confirmation is needed. Several reports have indicated that virulent FAdV-4 strains have a predilection for lymphoid tissues, and that they cause the depletion of B and T cells in lymphoid organs, which results in immunosuppression (Naeem et al., 1995a; Mazaheri et al., 1998; Schonewille et al., 2008). In immunosuppressed chickens, persistent infection tends to occur frequently, which further leads to virus shedding (Kaj´ an et al., 2013). The mixed infection of more than one serotype might also be a factor that prolongs the persistence and excretion of FAdV-4 (Asthana et al., 2013).

The liver from diseased chickens was identified as the main infection-related organ, and it contained the highest viral load (Cheema et al., 1988; Afzal et al., 1991; Chandra et al., 1997). Thus, infected liver tissue serves as the source of the FAdV-4 virus, and it has been used to purify the virus (Ganesh et al., 2002a). FAdV-4 also can propagate in primary chicken kidney cells (Khawaja et al., 1988), chicken embryo kidney cells (Khawaja et al., 1988), chicken embryo liver cells (Oberoi et al., 1996), chicken embryo fibroblasts (Niczyporuk et al., 2015), and quail fibroblast (QT-35) cells (Schonewille et al., 2010), with cytopathic effects characterized by cell degeneration and detachment from the surface and the presence of intranuclear inclusion bodies in the infected cells (Oberoi et al., 1996; Balamurugan et al., 2001, 2002; Balamurugan and Kataria, 2004). The purified viruses shared the same morphological features with the liver tissue sections under TEM (Chandra et al., 1997; Ganesh et al., 2002a).

DIAGNOSTIC DETECTION Clinicopathological Diagnosis and TEM Infected chickens do not exhibit typical clinical symptoms, except sudden death, in postmortem analyses of dead or moribund chickens, although the accumulation of a clear, straw-colored fluid in the pericardial sac, nephritis, and hepatitis have been observed (Zhao et al., 2015). Thus, suspected cases are judged by a sudden occurrence of high mortality among broiler chickens aged 3 to 6 wk (Kumar et al., 1997), with hydropericardium, nephritis, and hepatitis (basophilic intranuclear inclusion bodies in the hepatocytes) (Anjum et al., 1989; Afzal et al., 1991). TEM enables ultrastructural examinations of viruses, bacteria, protozoa, and fungi, and it plays a vital role in the diagnosis of microorganisms (Curry et al., 2006; Graham and Orenstein, 2007). Discrete icosahedral, adenovirus-like particles have been observed by TEM in purified, negatively stained liver homogenates, hepatocytes, or virus pellets from HPS cases, which demonstrates that FAdV are the causative agents of HPS (Cheema et al., 1989; Chandra et al., 1997; Ganesh et al., 2002a). The adenovirus particles identified in the nuclei of infected hepatocytes have the typical appearance of adenoviruses, being non-enveloped, hexagonal, icosahedral, and approximately 75 nm in diameter, which is helpful in confirming diagnoses (Hess, 2000; Ganesh et al., 2002a). Isolation of the virus from the blood, bodily fluids, or tissues of infected organisms is the gold standard in the diagnosis of virus infections. Primary chicken kidney, chicken embryo kidney, chicken embryo liver, chicken embryo fibroblast, and QT-35 cells can be used to isolate FAdV-4 (Khawaja et al., 1988; Oberoi et al., 1996; Schonewille et al., 2010; Niczyporuk et al., 2015).

FOWL ADENOVIRUS SEROTYPE 4: A FULL REVIEW

Molecular Techniques Molecular techniques, such as restriction endonuclease analysis (REA), in situ hybridization using DNA probes, polymerase chain reaction (PCR), real-time PCR, and a high-resolution melting (HRM)-curve analysis, are available for the detection and differentiation of FAdV. REA was initially used to group and differentiate FAdV isolates and strains. Based upon genomic similarities of the DNA generated by digestion with BamHI and HindIII, 11 serotypes from 17 FAdV strains were divided into 5 groups (A–E) (Zsak and Kisary, 1984) (Table 1). Although there were 2-way cross-neutralizations between FAdV serotypes 4 and 10, few differences were revealed by REA using HindIII, DraI, XbaI, NotI, SfiI, BglII, SmaI, and NaeI (Erny et al., 1995). Several reports have used in situ hybridization to directly detect FAdV DNA with specific probes (Ramis et al., 1994; Goodwin et al., 1996; Latimer et al., 1997). However, this method is not commonly used currently because of its complexity of operation and the availability of more convenient and reliable diagnostic methods. PCR is the primary assay for detecting FAdV (Hess et al., 1999; Toro et al., 1999; Zhao et al., 2015; Li et al., 2016c). The main merits of the avian adenovirus PCR assay are its high sensitivity, simplicity, selectivity, and rapidity (Hess, 2000; Asthana et al., 2013). The hexon gene of adenoviruses comprises the conserved pedestal regions (P1, P2) and the variable loops (L1–L4) (Roberts et al., 1986; Raue and Hess, 1998; Xie et al., 1999), and it is the major targeted gene of the published PCR techniques for detecting avian adenovirus. Primers were designed in both the variable region and the conserved region, and all published primer information is shown in Table 1. The use of PCR with 2 primer pairs, H1/H2 and H3/H4, which hybridize to the conserved region, combined with REA, has enabled the detection and differentiation of all 12 FAdV reference strains by PCR and REA (Raue and Hess, 1998; Hess et al., 1999; Toro et al., 1999; Meulemans et al., 2001; Singh et al., 2002; Meulemans et al., 2004). Using primers targeting the variable region of the hexon gene, FAdV-4 was detected successfully from an HPS case in India by PCR coupled with Southern hybridization (Ganesh et al., 2002b). Currently, the PCR product of the hexon gene is sequenced directly, and the resulting information can be used to identify the group and type of avian adenovirus (Mase et al., 2009a,b, 2012; Niczyporuk, 2016). In addition, fiber genes also are used for detecting avian adenovirus because they encode type-specific neutralizing, typespecific non-neutralizing, and subgenus-specific neutralizing epitopes. The use of PCR-RFA of the fiber genes constitutes a new, reliable method of differentiating HPS–FAdV-4 isolates and non-HPS–FAdV-4 isolates (Mase et al., 2010). Conventional PCR is a simple and sensitive tool for the detection of avian viral pathogens, but this tech-

5

nique cannot quantify viral loads (Watanabe et al., 2005; G¨ unes et al., 2012). Using either vector or genomic DNA as a standard, there have been several reports of the use of SYBR Green-based, real-time PCR methods to detect and quantify all FAdV species (Romanova et al., 2009; Steer et al., 2009; Marek et al., 2010; G¨ unes et al., 2012; Grafl et al., 2013) (Table 1). As above, combining PCR with REA (Singh et al., 2002; Meulemans et al., 2004; Mittal et al., 2014) and/or DNA sequencing (Mase et al., 2009a; Kaj´ an et al., 2013) could be used to genotype and differentiate all 12 FAdV serotypes, but these combined methods are relatively expensive and time-consuming, and they often require extensive interpretation, which limits their use as a routine typing tool (Steer et al., 2009). Recently, an HRM-curve analysis has provided a simple and less expensive alternative for directly genotyping genetic variations (Lin et al., 2008; Naze et al., 2015). With the HexL1s/HexL1 primer pair targeting the L1 region of the hexon gene, an HRM-curve analysis of the approximately 590-bp PCR products showed that the melting curve profiles were highly reproducible and visually distinct from each other, with one or more major peaks, which constituted a simple, sensitive, and specific method for genotyping and differentiating all 12 serotypes (Steer et al., 2009; Marek et al., 2010).

Serological Techniques Several serological techniques have been used to diagnose FAdV infections in poultry. These include an agar gel immunodiffusion test, an agar gel precipitation test, counterimmunoelectrophoresis, indirect hemagglutination, a viral neutralization (VN) test, an indirect immunofluorescence assay, and various modifications of an enzyme-linked immunosorbent assay (ELISA). Initially, based on prepared hyperimmune sera, an agar gel immunodiffusion (Verma et al., 1971), counterimmunoelectrophoresis (Berg, 1982; Kumar et al., 1997, 2003), an agar gel precipitation test (Khehra et al., 1993; Kumar et al., 1997), and an indirect immunofluorescence assay (Guy et al., 1988; Kumar et al., 2003) detected FAdV in liver homogenate extracts or different tissues of affected birds. The antibody titer and the seroprevalence after vaccination could be detected by indirect hemagglutination (Afzal et al., 1994; Mashkoor et al., 1994; Rahman et al., 1997), which also was used to detect an HPS agent antibody from infected chickens (Rahman et al., 1997). However, the VN test is a more sensitive and accurate method, which was used initially to differentiate FAdV serotypes (McFerran and Connor, 1977; Erny et al., 1995), evaluate the antibody response induced by vaccines (Ojkic and Nagy, 2003; Grgi´c et al., 2013; Schachner et al., 2014), and diagnose the infection of FAdV (Dawson et al., 1980; Mazaheri et al., 1998; Ganesh et al., 2002a; Kumar et al., 2003). The disadvantage of the VN test is that it is expensive and

Primer Forward

FAVHL

HexF1

FAdVF JSN

PCR

PCR

PCR

52K-fw

Real-time PCR

HRM-curve Hex L1-s analysis

F

Real-time PCR

PCR+REA FibF1

MK89

PCR

Hexon C

PCR+REA Hexon A

H3

PCR+REA H1

Method

TAGTGATGMCGSGACATCAT SKCSACYTAYTTCGACAT TTRTCWCKRAADCCGATGTA CCCTCCCACCGCTTACCA

Hexon B

AGTGATGACGGGACATCAT GAYRGYHGGRTNBTGGAYATGGG

TACTTATCNACRGCYTGRTTCCA AATGTCACNACCGARAAGGC

CBGCBTRCATGTACTGGTA

FAVHR

HeXR1

FAdVR JSN

TTTGTCACGCGGTGGGGAGG ATGGTGTTCTATTGGACGCA

TGTTTGGATGTTGCACCTTT ATGGCKCAGATGGCYAAGG

AGCGCCTGGGTCAAACCGA ATGGGAGCSACCTAYTTCGACAT

AAATTGTCCCKRAANCCGATGTA

FibR1

R

52K-rv

Hex L1-as

CAGGGTTACGTCTACTCCCC

CACGTTGCCCTTATCTTGC GACATGGGGTCGACCTATTTCGACAT

MK90

Hexon D

H4

AAGGGATTGACGTTGTCCA AACGTCAACCCCTTCAACCACC TTGCCTGTGGCGAAAGGCG CAARTTCAGRCAGACGGT

TGGACATGGGGGCGACCTA

Sequence (5 to 3 )

H2

Reverse

Table 1. Molecular techniques for detecting FAdV infections.

FAdV-1 Hexon

52K

ORF20A

FAdV-4 Fiber

FAdV-1 Hexon

FAdV-1 Hexon

FAdV-10 Hexon

FAdV-1 Hexon

FAdV-1 Hexon

FAdV-1 Hexon

Gene

AluI

References

(Xie et al., 1999)

(G¨ unes et al., 2012; Grafl et al., 2013)

(Romanova et al., 2009)

(Mase et al., 2010)

The method was proven to be a sensitive (Raue et al., 2005; Steer and specific method for differentiating et al., 2009; Marek et al., all 12 FAdV serotypes 2010)

The method was used to detect and quantitate FAdVs in chicken tissues (detection limit: 6.73 × 108 copies of FAdV DNA per reaction).

The method was used to detect and quantitate FAdV in chicken tissues (detection limit: 9.4 × 107 copies of FAdV DNA per reaction).

The method was used to differentiate HPS–FAdV-4 isolates and non-HPS–FAdV-4 isolates

PCR coupled with direct sequencing was (Niczyporuk, 2016) used in phylogenetic and geographic analyses of avian adenovirus.

PCR coupled with direct sequencing was (Mase et al., 2009a,b; used to identify the group and type of 2012) avian adenovirus.

This was the first trial of amplifying the (Ganesh et al., 2002b) variable region of the hexon, which was useful in detecting FAdV-4 in HPS cases

As little as 1 fg of DNA could be detected

(Meulemans et al., 2001, 2004; Kaj´ an et al., 2013; Mittal et al., 2014)

The method was used to detect (Raue and Hess, 1998; Hess infections of all FAdV in chickens, and to et al., 1999; Toro et al., distinguish all 12 FAdV reference strains 1999; Singh et al., 2002)

Application information

BsiWI, StyI, MluI, The method allowed the complete AspI, ScaI, BglI differentiation of all 12 FAdV strains

HpaII

HaeII

Enzyme

6 LI ET AL.

7

FOWL ADENOVIRUS SEROTYPE 4: A FULL REVIEW

time consuming (Berg, 1982); therefore, it must be used rationally. Recent advances in FAdV serological techniques have focused mainly on various modifications of ELISA. In earlier versions, an indirect ELISA with whole viruses as coating antigens was employed to detect antibodies to FAdV in tissue samples from chickens undergoing natural and experimental infections (Dawson et al., 1980; Mockett and Cook, 1983; Saifuddin and Wilks, 1990; Afzal et al., 1994; Kumar et al., 2003). The preparation of viral antigens was relatively cumbersome and inefficient, but apart from that, the method did not have a high sensitivity and specificity. A sandwich ELISA was developed to detect an FAdV-4 antigen in various tissues, including the liver, spleen, bursa, thymus, and kidneys, of experimentally infected chicks (Balamurugan et al., 2001). The method had a higher sensitivity and specificity, which could detect FAdV4 antigen below 20,000 50% tissue culture infective doses per mL, and below 1.14 μg in 5% (w/v) suspensions of liver tissue (Balamurugan et al., 2001). A similar sandwich ELISA also was established subsequently

(Schonewille et al., 2010). Recently, non-structural proteins (100 K, 33 K) and structural proteins (hexon, fiber-2) were expressed successfully and purified in a prokaryotic expression system. Indirect ELISA based on the recombinant proteins proved to be sensitive, specific, and accurate, but more importantly, these methods are easier to standardize, which makes them suitable for large-scale applications (Xie et al., 2013; Junnu et al., 2014; Ravindran and Roy, 2014; Schachner et al., 2014).

VACCINE STRATEGIES Proper disinfection of premises and equipment, adequate ventilation, appropriate light, and restricted entry of poultry workers or visitors might be helpful in preventing HPS (TA abdul-Aziz, 1991). However, vaccination against HPS offers broad protection for vaccinated chickens, and it minimizes direct losses; thus, it is the most fundamental means of controlling HPS (Table 2) (Chandra et al., 2000; Balamurugan and Kataria, 2004; Kim et al., 2014).

Table 2. Vaccines against HPS disease. Vaccine category

Preparation

Immune efficacy

Advantage

Disadvantage

References

Inactivated vaccine

Liver homogenate extract; inactivation by formalin, heat treatment

Provided 90–100% protection in double vaccinated group and 80–90% protection after a single dose

Provided protection against HPS

Concerns about the spread of HPS

Inactivated vaccine

Inactivated vaccines prepared in cell culture systems and SPF chickens, oil-emulsifying

Provided broad cross-protection against various serotypes of FAdV

Multiple immunizations were needed

Attenuated vaccine

Live FAdV-4 vaccine attenuated by serially passaging in chicken embryos Live FAdV-4 vaccine attenuated in QT-35 cells

Provided 94.73% protection

Higher biosecurity and standards than autogenous inactivated vaccines Provided high protection

(Cheema et al., 1989; Chishti et al., 1989; Afzal & Ahmad, 1990; Anjum, 1990; Afzal et al., 1994; Mashkoor et al., 1994; Kumar et al., 1997) (Kataria et al., 1997; Kim et al., 2014)

Risk of reversion to virulence

(Mansoor et al., 2011)

Risk of reversion to virulence

(Schonewille et al., 2008, 2010)

Attenuated vaccine

Isolated from a broiler breeder flock with no clinical signs of HPS

Risk of reversion to virulence

(Grgi´c et al., 2013)

Subunit vaccine

FAdV-4 penton-based recombinant protein prepared in Escherichia coli

A strong specific antibody response, a 1:50 VN antibody response, increased IFN-γ and IL-10 expression in the liver, and decreased IFN-γ and IL-18 expression in the spleen Provided 90% protection

Elicited a strong immune response, provided full protection Elicited humoral and cellular immune responses

Multiple immunizations were needed

(Shah et al., 2012)

Subunit vaccine

FAdV-4 fiber-2 recombinant protein prepared in baculovirus expression systems

Provided high protection (only one dead bird out of 28), lack of VN antibodies

Multiple immunizations were needed

(Schachner et al., 2014)

Subunit vaccine

FAdV-4 100 K recombinant protein prepared in E. coli

Elicited significant serum antibody titers, provided little protection (40%)

Provided little protection

(Shah et al., 2016)

Attenuated vaccine

Provided full protection against a severe challenge of virulent FAdV-4, lack of VN antibodies

Safe, provided high protection, easy preparation, low cost Safe, provided high protection, easy preparation, low cost Safe, easy preparation, low cost

8

LI ET AL.

In the early stages of an HPS outbreak, inactivated vaccines prepared from an infected liver homogenate provide the main means of controlling the disease (Cheema et al., 1989; Chishti et al., 1989; Afzal and Ahmad, 1990; Anjum, 1990; Afzal et al., 1994; Mashkoor et al., 1994; Kumar et al., 1997). Although relatively satisfactory results were obtained with the use of these autogenous, formalin-inactivated vaccines, there was still much concern regarding the spread of HPS because of improper inactivation of virulent strains, poorly hygienic conditions during vaccine production, the lack of a suitable adjuvant, and the appropriate quantity of virus. To minimize the risk of spreading HPS (Ahmad and Hasan, 2004; Khan et al., 2005; Ahmad et al., 2011), cell culture systems and SPF chickens, with strict biosecurity and high standards of hygiene, are better choices for the development of inactivated vaccines (Naeem et al., 1995a,b). In India, an inactivated, oil-emulsified vaccine, which was prepared from FAdV-4 in cell culture, provided 100% protection to 3-week-old chickens that were inoculated with 0.5mL doses of the vaccine (105.5 50% tissue culture infective doses per 0.1 mL) (Kataria et al., 1997). Recently, a similar inactivated, oil-emulsified vaccine not only provided protection against FAdV-4 in vaccinated chickens, but it also provided broad cross-protection against various serotypes of FAdV in vaccinated chickens and the progeny of vaccinated breeders (Kim et al., 2014). There are several reports of the use of attenuated live vaccines against FAdV-4 (Schonewille et al., 2008, 2010; Ahmad et al., 2011; Grgi´c et al., 2013). Attenuation was obtained by serially passaging the virus in chicken embryos (Mansoor et al., 2011) or QT-35 cells (Schonewille et al., 2010). Although there was a lack of neutralizing antibodies, chickens vaccinated with a live FAdV-4 vaccine that was attenuated in QT-35 cells were fully protected against a severe challenge of virulent FAdV-4 (Schonewille et al., 2010). FAdV-4 ON1 was isolated from a broiler breeder flock with no clinical signs of HPS in Canada in 2004, and it is considered to be a live vaccine virus (Grgi´c et al., 2013). SPF chickens vaccinated with FAdV-4 ON via oral and intramuscular infections developed a strong anti-FAdV-4-specific antibody response, a 1:50 VN antibody response, increased interferon (IFN)-γ and interleukin (IL)-10 expression in the liver, and decreased IFN-γ and IL-18 expression in the spleen (Grgi´c et al., 2013). Several subunit vaccines also were developed against HPS (Shah et al., 2012; Schachner et al., 2014; Shah et al., 2016). Subunit vaccines based on the penton base and fiber-2 recombinant proteins provided high protection; thus, they represent attractive candidates for vaccines to prevent HPS in chickens (Shah et al., 2012; Schachner et al., 2014)

CONCLUSIONS FAdV-4 is highly pathogenic to broiler chickens, and it has already spread to vast regions of Asia, Central

and South America, and some European countries. The FAdV-4-mediated economic losses to the broiler industry continue to grow rapidly; thus, appropriate control and prevention programs should be developed by each affected country. To increase the resistance of chickens to HPS virus infections, as well as to reduce the amount and duration of virus shedding in the environment, new, safe and effective vaccines are needed. Given their potential widespread application in broiler flocks, oral vaccines have a unique advantage, namely affordability, for mass vaccination because they eliminate the use of syringes and needles. Attenuated Salmonella strains are promising oral vaccine vectors in vivo (Atkins et al., 2006), and they have been tested for other avian viruses (Pei et al., 2015). Recently, bioinformatics tools have been used to predict FAdV-4 B-cell epitopes (Asthana et al., 2011), and potential epitope regions defined using bioinformatics were recognized by a panel of 7 hexon-specific monoclonal neutralizing antibodies of the chimpanzee adenovirus 68 (AdC68) (Pichla-Gollon et al., 2007). Thus, novel vaccines based on B-cell epitope prediction would enlarge our horizon of FAdV-4 vaccine designs and provide useful strategies to control and prevent FAdV-4 cases.

ACKNOWLEDGMENTS We thank Prof. Dr. Wanpo Zhang for his careful review of the manuscript. Authors’ contributions: Penghui Li, Peipei Zheng, Tengfei Zhang, Guoyuan Wen, and Huabin Shao wrote the review and designed tables and figures. Qingping Luo revised the text, tables, and figures. All authors read and approved the final manuscript.

FUNDING This study was funded by National Key R&D Program (2016YFD0500803), the Hubei Science and Technology Bureau (grant no. 2015ACDA039), and the China Agriculture Research System (grant no. CARS42-G11) and the Hubei Agricultural Innovation Center (2011-620-004-003). Conflict of interest: The authors declare no conflict of interest.

REFERENCES Abdul-Aziz, T. A., and S. Y. Hasan. 1995. Hydropericardium syndrome in broiler chickens: Its contagious nature and pathology. Res. Vet. Sci. 59:219–221. abdul-Aziz, T. A., and M. A. al-Attar. 1991. New syndrome in Iraqi chicks. Vet. Rec. 129:272–272. Abe, T., K. Nakamura, H. Tojo, M. Mase, T. Shibahara, S. Yamaguchi, and N. Yuasa. 1998. Histology, immunohistochemistry, and ultrastructure of hydropericardium syndrome in adult broiler breeders and broiler chicks. Avian. Dis. 606–612. Afzal, M., and I. Ahmad. 1990. Efficacy of an inactivated vaccine against hydropericardium syndrome in broilers. Vet. Rec. 126: 59–60.

FOWL ADENOVIRUS SEROTYPE 4: A FULL REVIEW Afzal, M., A. Hameed, and A. Khan. 1994. Immune response to inactivated hydropericardium syndrome vaccine in broilers. Pak. Vet. J. 14:5–5. Afzal, M., R. Muneer, and G. Stein. 1991. Studies on the aetiology of hydropericardium syndrome (Angara disease) in broilers. Vet. Rec. 128:591–593. Ahmad, K., and S. Hasan. 2004. The efficacy of experimental Angara disease vaccines. Pak. Vet. J. 24:101–103. Ahmad, M., S. Zaman, M. Mushtaq, A. Anjum, and M. Akram. 2011. Comparative pathogenicity of liver homogenate and cell culture propagated hydropericardium syndrome virus in broiler birds. Pak. Vet. J. 31:321–326. Akhtar, S. 1994. Hydropericardium syndrome in broiler chickens in Pakistan. World. Poultry. Sci. J. 50:177–182. Akhtar, S. 1995. Lateral spread of the aetiologic agent(s) of hydropericardium syndrome in broiler chickens. Vet. Rec. 136:118– 120. Anjum, A. D. 1990. Experimental transmission of hydropericardium syndrome and protection against it in commercial broiler chickens. Avian. Pathol. 19:655–660. Anjum, A. D., M. A. Sabri, and Z. Iqbal. 1989. Hydropericarditis syndrome in broiler chickens in Pakistan. Vet. Rec. 124:247–248. Asrani, R., V. Gupta, S. Sharma, S. Singh, and R. Katoch. 1997. Hydropericardium-hepatopathy syndrome in Asian poultry. Vet. Rec. 141:271–273. Asthana, M., R. Chandra, and R. Kumar. 2013. Hydropericardium syndrome: current state and future developments. Arch. Virol. 158:921–931. Asthana, M., V. K. Singh, R. Kumar, and R. Chandra. 2011. Isolation, cloning and In silico study of hexon gene of fowl adenovirus 4 (FAV4) isolates associated with Hydro pericardium syndrome in domestic fowl. J. Proteomics Bioinform. 4:190–195. Atkins, H. S., M. Morton, K. F. Griffin, M. G. Stokes, J. P. Nataro, and R. W. Titball. 2006. Recombinant Salmonella vaccines for biodefence. Vaccine. 24:2710–2717. Balamurugan, V., J. Katari, A. Tiwari, K. Verma, R. Toroghi, and S. Jadhao. 2001. Development of sandwich elisa for the detection of fowl adenovirus 4 associated with hydropericardium syndrome in experimentally infected chicken. Acta. Virol. 45:95–100. Balamurugan, V., and J. M. Kataria. 2004. The hydropericardium syndrome in poultry – A current scenario. Vet. Res. Commun. 28:127–148. Balamurugan, V., J. M. Kataria, R. S. Kataria, K. C. Verma, and T. Nanthakumar. 2002. Characterization of fowl adenovirus serotype-4 associated with hydropericardium syndrome in chicken. Comp. Immunol. Micro. 25:139–147. Berg, N. W. 1982. Rapid detection of infectious bursal disease antibodies by counterimmunoelectrophoresis. Avian Pathol. 11:611– 614. Biswas, P., B. Sil, R. Faruque, S. Ahmed, D. Biswas, and S. Chowdhury. 2002. Adenovirus induced hydropericardium-hepatitis syndrome in broiler parent chickens in Chittagong, Bangladesh. Pakistan J. Biol. Sci. 5:994–996. Borisov, V., A. Borisov, and A. Gusev. 1997. Hydropericardium syndrome in chickens in Russia. Proc. Proceedings of the Tenth International Congress of World Veterinary Poultry Association, Budapest, Hungary. Chandra, R., S. Shukla, M. Kumar, and S. Garg. 1997. Electron microscopic demonstration of an adenovirus in the hepatocytes of birds experimentally infected with hydropericardium syndrome. Vet. Rec. 140:70–71. Chandra, R., S. K. Shukla, and M. Kumar. 2000. The hydropericardium syndrome and inclusion body hepatitis in domestic fowl. Trop. Anim. Health. Prod. 32:99–111. Cheema, A., M. Afzal, and J. Ahmad. 1988. Studies on the causation of hydropericardium syndrome in Pakistan. Proc. Proceedings of a National Seminar on Hydropericardium Syndrome in Chickens in Pakistan,, Rawalpindi, Pakistan. Cheema, A., J. Ahmad, and M. Afzal. 1989. An adenovirus infection of poultry in Pakistan. Rev. Sci. Tech. Off. Int. Epiz. 8:789–795. Chen, H., Y. Dou, X. Zheng, Y. Tang, M. Zhang, Y. Zhang, Z. Wang, and Y. Diao. 2016. Hydropericardium hepatitis syndrome emerged in cherry valley ducks in China. Transbound. Emerg. Dis. doi 10.1111/tbed.12500.

9

Chishti, M., M. Afzal, and A. Cheema. 1989. Preliminary studies on the development of vaccine against the hydropericardium syndrome of poultry. Rev. Sci. Tech. Oie. 8:797–801. Cowen, B. S. 1992. Inclusion body hepatitis–anaemia and hydropericardium syndromes: aetiology and control. World. Poultry. Sci. J. 48:247–254. Cowen, B., H. Lu, D. Weinstock, and A. Castro. 1996. Pathogenicity studies of fowl adenoviruses isolated in several regions of the world. Proc. International Symposium on Adenovirus Infection in Poultry. Curry, A., H. Appleton, and B. Dowsett. 2006. Application of transmission electron microscopy to the clinical study of viral and bacterial infections: Present and future. Micron. 37: 91–106. Dawson, G. J., L. N. Orsi, V. J. Yates, P. W. Chang, and A. D. Pronovost. 1980. An enzyme-linked immunosorbent assay for detection of antibodies to avian adenovirus and avian adenovirusassociated virus in chickens. Avian. Dis. 24:393–402. Erny, K., J. Pallister, and M. Sheppard. 1995. Immunological and molecular comparison of fowl adenovirus serotypes 4 and 10. Arch. Virol. 140:491–501. Ganesh, K., R. Raghavan, R. N. Gowda, M. L. Satyanarayana, and V. V. Suryanarayana. 2002a. Purification and characterization of the aetiological agent of hydropericardium hepatitis syndrome from infected liver tissues of broiler chickens. Trop. Anim. Health. Prod. 34:7–17. Ganesh, K., V. V. Suryanarayana, and R. Raghavan. 2002b. Detection of fowl adenovirus associated with hydropericardium hepatitis syndrome by a polymerase chain reaction. Vet. Res. Commun. 26:73–80. Goodwin, M. A., K. S. Latimer, R. S. Resurreccion, P. G. Miller, and R. P. Campagnoli. 1996. DNA in situ hybridization for the rapid diagnosis of massive necrotizing avian adenovirus hepatitis and pancreatitis in chicks. Avian. Dis. 40:828–831. Gowda, R. S., and M. Satyanarayana. 1994. Hydropericardium syndrome in poultry. Indian J. Vet. Pathol. 18:159–161. Grafl, B., D. Liebhart, A. Gunes, P. Wernsdorf, F. Aigner, J. Bachmeier, and M. Hess. 2013. Quantity of virulent fowl adenovirus serotype 1 correlates with clinical signs, macroscopical and pathohistological lesions in gizzards following experimental induction of gizzard erosion in broilers. Vet. Res. 44:38. Graham, L., and J. M. Orenstein. 2007. Processing tissue and cells for transmission electron microscopy in diagnostic pathology and research. Nat. Protocols. 2:2439–2450. ´ Nagy. 2013. Pathogenicity and Grgi´c, H., Z. Poljak, S. Sharif, and E. cytokine gene expression pattern of a serotype 4 fowl adenovirus isolate. PLoS. ONE. 8:e77601. Griffin, B. D., and E. Nagy. 2011. Coding potential and transcript analysis of fowl adenovirus 4: Insight into upstream ORFs as common sequence features in adenoviral transcripts. J. Gen. Virol. 92:1260–1272. G¨ unes, A., A. Marek, B. Grafl, E. Berger, and M. Hess. 2012. Realtime PCR assay for universal detection and quantitation of all five species of fowl adenoviruses (FAdV-A to FAdV-E). J. Virol. Methods. 183:147–153. Guy, J. S., J. L. Schaeffer, and H. J. Barnes. 1988. Inclusion-body hepatitis in day-old turkeys. Avian. Dis. 587–590. Hess, M. 2000. Detection and differentiation of avian adenoviruses: A review. Avian. Pathol. 29:195–206. Hess, M., A. Cuzange, R. W. Ruigrok, J. Chroboczek, and B. Jacrot. 1995. The avian adenovirus penton: Two fibres and one base. J. Mol. Biol. 252:379–385. Hess, M., R. Raue, and C. Prusas. 1999. Epidemiological studies on fowl adenoviruses isolated from cases of infectious hydropericardium. Avian. Pathol. 28:433–439. Ivanics, E., V. Palya, B. Markos, A. Dan, K. Ursu, B. Harrach, G. Kajan, and R. Glavits. 2010. Hepatitis and hydropericardium syndrome associated with adenovirus infection in goslings. Acta. Vet. Hung. 58:47–58. Jantosovic, J., J. Konard, J. Saly, I. Skardova, J. Kusev, and K. Beninghausova. 1991. Hydropericardium syndrome in chicks. Veterinastvi. 41:261–263. Junnu, S., P. Lertwatcharasarakul, S. Jala, S. Phattanakunanan, P. Moonjit, and T. Songserm. 2014. Developing an Indirect ELISA

10

LI ET AL.

based on recombinant hexon protein for serological detection of inclusion body hepatitis in chickens. J. Vet. Med. Sci. 76:289–293. Kaj´ an, G. L., S. Kecskem´eti, B. Harrach, and M. Benk˝ o. 2013. Molecular typing of fowl adenoviruses, isolated in Hungary recently, reveals high diversity. Vet. Microbiol. 167:357–363. Kataria, J., K. Verma, S. Jadhao, J. Deepak, and R. Sah. 1997. Efficacy of an inactivated oil emulsified vaccine against inclusion body hepatitis-hydropericardium syndrome (litchi disease) in chicken prepared from cell culture propagated fowl adenovirus. Indian. J. Comp. Microbiol. Immunol. Infect. Dis. 18:38–42. Khan, A., A. Sabri, M. Mansoor, and I. Hussain. 2005. Hydropericardium syndrome in Pakistan: A review. World. Poultry. Sci. J. 61:647–654. Khawaja, D., S. Ahmad, A. Rauf, M. Zulfiqar, and S. Mahmood. 1988. Isolation of an adeno virus from hydropericardium syndrome in broiler chicks. Pakistan. J. Vet. Res. Khehra, R., M. Oberoi, N. Maiti, M. Sawhney, and S. Sharma. 1993. Inclusion body hepatitis: Detection of avian adenovirus by counter imunoelectrophoresis. Indian. J. Virol. 9:58–61. Kim, J. N., S. H. Byun, M. J. Kim, J. Kim, H. W. Sung, and I. P. Mo. 2008. Outbreaks of hydropericardium syndrome and molecular characterization of Korean fowl adenoviral isolates. Avian. Dis. 52:526–530. Kim, M.-S., T.-H. Lim, D.-H. Lee, H.-N. Youn, S.-S. Yuk, B.-Y. Kim, S.-W. Choi, C.-H. Jung, J.-H. Han, and C.-S. Song. 2014. An inactivated oil-emulsion fowl Adenovirus serotype 4 vaccine provides broad cross-protection against various serotypes of fowl Adenovirus. Vaccine. 32:3564–3568. Kumar, R., R. Chandra, and S. K. Shukla. 2003. Isolation of etiological agent of hydropericardium syndrome in chicken embryo liver cell culture and its serological characterization. Indian. J. Exp. Biol. 41:821–826. Kumar, R., R. Chandra, S. K. Shukla, D. K. Agrawal, and M. Kumar. 1997. Hydropericardium syndrome (HPS) in India: A preliminary study on the causative agent and control of the disease by inactivated autogenous vaccine. Trop. Anim. Health. Prod. 29:158–164. Latimer, K. S., F. D. Niagro, O. C. Williams, A. Ramis, M. A. Goodwin, B. W. Ritchie, and R. P. Campagnoli. 1997. Diagnosis of avian adenovirus infections using DNA in situ hybridization. Avian. Dis. 41:773–782. Li, C. J., H. Y. Li, D. D. Wang, J. J. Wang, Y. M. Wang, S. H. Wang, J.D. Li, P. Liu, J. L. Wang, S. Z. Xu, S. J. Cui, Y. Zhang, and Y. B. Yin. 2016a. Characterization of fowl adenoviruses isolated between 2007 and 2014 in China. Vet Microbiol. 197:62–67. Li, H., J. Wang, L. Qiu, Z. Han, and S. Liu. 2016b. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitishydropericardium syndrome in chickens in China. Infect. Genet. Evol. 45:230–241. Li, L., L. Luo, Q. Luo, T. Zhang, K. Zhao, H. Wang, R. Zhang, Q. Lu, Z. Pan, H. Shao, W. Zhang, and G. Wen. 2016c. Genome sequence of a fowl adenovirus serotype 4 strain lethal to chickens, isolated from China. Genome Announc. 4. Lin, J.-H., C.-P. Tseng, Y.-J. Chen, C.-Y. Lin, S.-S. Chang, H.S. Wu, and J.-C. Cheng. 2008. Rapid differentiation of influenza a virus subtypes and genetic screening for virus variants by high-resolution melting analysis. J. Clin. Microbiol. 46: 1090–1097. Liu, X., and F. Ma. 2015. Diagnosis and protection of the hydropericardium syndrome. Veterinary Orientation 32–33. Liu, D., H. Liu, J. Yu, PingGuo, T. Gao, Q. Wang, D. Luan, D. Ma, F. Liu, and Y. Du. 2015. Epidemiological investigation of group 1 adenovirus in chickens in China. China Poultry. 37:70–73. Mansoor, M. K., I. Hussain, M. Arshad, and G. Muhammad. 2011. Preparation and evaluation of chicken embryo-adapted fowl adenovirus serotype 4 vaccine in broiler chickens. Trop. Anim. Health. Prod. 43:331–338. Manzoor, S., Z. Hussain, S. Rahman, and I. Hussain. 2013. Identification of antibodies against hydropericardium syndrome in wild birds. Brit. Poultry. Sci. 54:325–328. Marek, A., A. Gunes, E. Schulz, and M. Hess. 2010. Classification of fowl adenoviruses by use of phylogenetic analysis and highresolution melting-curve analysis of the hexon L1 gene region. J. Virol. Methods. 170:147–154.

Mase, M., M. Chuujou, T. Inoue, K. Nakamura, S. Yamaguchi, and T. Imada. 2009a. Genetic characterization of fowl adenoviruses isolated from chickens with hydropericardium syndrome in Japan. J. Vet. Med. Sci. 71:1455–1458. Mase, M., H. Mitake, T. Inoue, and T. Imada. 2009b. Identification of Group I-III avian adenovirus by PCR coupled with direct sequencing of the hexon gene. J. Vet. Med. Sci. 71:1239–1242. Mase, M., K. Nakamura, and T. Imada. 2010. Characterization of fowl adenovirus serotype 4 isolated from chickens with hydropericardium syndrome based on analysis of the short fiber protein gene. J. Vet. Diagn. Invest. 22:218–223. Mase, M., K. Nakamura, and F. Minami. 2012. Fowl adenoviruses isolated from chickens with inclusion body hepatitis in Japan, 2009–2010. J. Vet. Med. Sci.74:1087–1089. Mashkoor, S., A. Hameed, H. Ahmad, and M. Qureshi. 1994. Improved Angara disease vaccine for broiler chicks. Veterinarski. Arkhiv. 64:27–33. Mazaheri, A., C. Prusas, M. Voss, and M. Hess. 1998. Some strains of serotype 4 fowl adenoviruses cause inclusion body hepatitis and hydropericardium syndrome in chickens. Avian.Pathol. 27:269– 276. McFerran, J. B., and T. J. Connor. 1977. Further studies on the classification of fowl adenoviruses. Avian. Dis. 21:585–595. Meulemans, G., M. Boschmans, T. P. Berg, and M. Decaesstecker. 2001. Polymerase chain reaction combined with restriction enzyme analysis for detection and differentiation of fowl adenoviruses. Avian. Pathol. 30:655–660. Meulemans, G., B. Couvreur, M. Decaesstecker, M. Boschmans, and T. van den Berg. 2004. Phylogenetic analysis of fowl adenoviruses. Avian. Pathol. 33:164–170. Mittal, D., N. Jindal, A. K. Tiwari, and R. S. Khokhar. 2014. Characterization of fowl adenoviruses associated with hydropericardium syndrome and inclusion body hepatitis in broiler chickens. Virusdisease. 25:114–119. Mockett, A. P., and J. K. Cook. 1983. The use of an enzymelinked immunosorbent assay to detect IgG antibodies to serotypespecific and group-specific antigens of fowl adenovirus serotypes 2, 3 and 4. J. Virol. Methods. 7:327–335. Naeem, K., T. Niazi, S. Malik, and A. Cheema. 1995a. Immunosuppressive potential and pathogenicity of an avian adenovirus isolate involved in hydropericardium syndrome in broilers. Avian. Dis. 723–728. Naeem, K., M. Rabbani, M. Hussain, and A. H. Cheema. 1995b. Development of cell culture vaccine against HPS in poultry. Pakistan Veterinary J. 150–151. Naze, F., A. Desvars, M. Picardeau, P. Bourhy, and A. Michault. 2015. Use of a new high resolution melting method for genotyping pathogenic Leptospira spp. PLoS One 10:e0127430. Nemerow, G. R., L. Pache, V. Reddy, and P. L. Stewart. 2009. Insights into adenovirus host cell interactions from structural studies. Virology. 384:380–388. Niczyporuk, J. S. 2016. Phylogenetic and geographic analysis of fowl adenovirus field strains isolated from poultry in Poland. Arch. Virol. 161:33–42. Niczyporuk, J. S., G. Wozniakowski, and E. Samorek-Salamonowicz. 2015. Application of cross-priming amplification (CPA) for detection of fowl adenovirus (FAdV) strains. Arch. Virol. 160:1005– 1013. Oberoi, M., A. Singh, and B. Singh. 1996. Isolation of avian adenovirus from outbreaks of inclusion body hepatitishydropericardium syndrome in poultry. Indian. J. Virol. 12:123– 124. ´ Nagy. 2000. The complete nucleotide sequence of Ojkic, D., and E. fowl adenovirus type 8. J. Gen. Virol. 81:1833–1837. ´ Nagy. 2003. Antibody response and virus tissue Ojkic, D., and E. distribution in chickens inoculated with wild-type and recombinant fowl adenoviruses. Vaccine. 22:42–48. Pei, Z., X. Jiang, Z. Yang, X. Ren, H. Gong, M. Reeves, J. Sheng, Y. Wang, Z. Pan, F. Liu, J. Wu, and S. Lu. 2015. Oral delivery of a novel attenuated salmonella vaccine expressing influenza a virus proteins protects mice against H5N1 and H1N1 viral infection. PLoS One 10:e0129276. Pichla-Gollon, S. L., M. Drinker, X. Zhou, F. Xue, J. J. Rux, G. P. Gao, J. M. Wilson, H. C. Ertl, R. M. Burnett, and

FOWL ADENOVIRUS SEROTYPE 4: A FULL REVIEW J. M. Bergelson. 2007. Structure-based identification of a major neutralizing site in an adenovirus hexon. J. Virol. 81:1680–1689. Rahman, S., M. Ashfaque, A. Anjum, and T. Sindhu. 1997. Indirect hemagglutination test for detecting Angara disease (hydropericardium syndrome) agent antibodies. Pak. J. Livstock. and Poult. 3:176–178. Ramis, A., K. S. Latimer, F. D. Niagro, R. P. Campagnoli, B. W. Ritchie, and D. Pesti. 1994. Diagnosis of psittacine beak and feather disease (PBFD) viral infection, avian polyomavirus infection, adenovirus infection and herpesvirus infection in psittacine tissues using DNA in situ hybridization. Avian. Pathol. 23:643– 657. Raue, R., and M. Hess. 1998. Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus. J. Virol. Methods. 73:211–217. Raue, R., H. Gerlach, and H. Muller. 2005. Phylogenetic analysis of the hexon loop 1 region of an adenovirus from psittacine birds supports the existence of a new psittacine adenovirus (PsAdV). Archives of virology 150:1933–1943. Ravindran, R., and P. Roy. 2014. Recombinant hexon antigen based single serum dilution ELISA for rapid serological profiling against fowl adenovirus-4 causing hydropericardium syndrome in chickens. J. Virol. Methods. 207:121–127. Ren, C., W. Mao, H. Gao, C. Bai, and H. Shao. 2011. Prevention of the hydropericardium syndrome in chickens. Veterinary Orientation. 64–64. Roberts, M. M., J. L. White, M. G. Grutter, and R. M. Burnett. 1986. Three-dimensional structure of the adenovirus major coat protein hexon. Science (New York, N.Y.) 232:1148–1151. ´ Nagy. 2009. Detection and Romanova, N., J. C. Corredor, and E. quantitation of fowl adenovirus genome by a real-time PCR assay. J. Virol. Methods. 159:58–63. Saifuddin, M., and C. R. Wilks. 1990. Development of an enzymelinked immunosorbent assay to detect and quantify adenovirus in chicken tissues. Avian. Dis. 34:239–245. Schachner, A., A. Marek, B. Jaskulska, I. Bilic, and M. Hess. 2014. Recombinant FAdV-4 fiber-2 protein protects chickens against hepatitis–hydropericardium syndrome (HHS). Vaccine. 32:1086– 1092. Schonewille, E., R. Jaspers, G. Paul, and M. Hess. 2010. Specificpathogen-free chickens vaccinated with a live FAdV-4 vaccine are fully protected against a severe challenge even in the absence of neutralizing antibodies. Avian. Dis. 54:905–910. Schonewille, E., A. Singh, T. W. G¨ obel, W. Gerner, A. Saalm¨ uller, and M. Hess. 2008. Fowl adenovirus (FAdV) serotype 4 causes depletion of B and T cells in lymphoid organs in specific pathogenfree chickens following experimental infection. Vet. Immunol. Immunop. 121:130–139. Shafique, M., M. Khan, M. Javeed, and A. Khan. 1993. Lesions of hydropericardium syndrome in embryonating eggs and in broiler chicks under immunosuppression. Singap. Vet. J. 16:58–64. Shah, M. S., A. Ashraf, M. I. Khan, M. Rahman, M. Habib, and J. A. Qureshi. 2016. Molecular cloning, expression and characterization of 100 K gene of fowl adenovirus-4 for prevention and control of hydropericardium syndrome. Biologicals 44:19–23. Shah, M. S., A. Ashraf, M. Rahman, M. I. Khan, and J. A. Qureshi. 2012. A subunit vaccine against hydropericardium syndrome using adenovirus penton capsid protein. Vaccine. 30:7153–7156. Shane, S. M. 1996. Hydropericardium-Hepatitis Syndrome the current world situation. Zootecnica. International. 19:20–27.

11

Singh, A., M. Oberoi, G. Grewal, H. Hafez, and M. Hess. 2002. The use of PCR combined with restriction enzyme analysis to characterize fowl adenovirus field isolates from northern India. Vet. Res. Commun. 26:577–585. Steer, P. A., N. C. Kirkpatrick, D. O’Rourke, and A. H. Noormohammadi. 2009. Classification of Fowl Adenovirus Serotypes by Use of High-Resolution Melting-Curve Analysis of the Hexon Gene Region. J. Clin. Microbiol. 47:311–321. Toro, H., O. Gonzalez, C. Escobar, L. Cerda, M. Morales, and C. Gonzalez. 2001. Vertical induction of the inclusion body hepatitis/hydropericardium syndrome with fowl adenovirus and chicken anemia virus. Avian. Dis. 215–222. Toro, H., C. Prusas, R. Raue, L. Cerda, C. Geisse, C. Gonzalez, and M. Hess. 1999. Characterization of fowl adenoviruses from outbreaks of inclusion body hepatitis/hydropericardium syndrome in Chile. Avian. Dis. 43:262–270. Vera-Hernandez, P. F., A. Morales-Garzon, D. V. Cortes-Espinosa, A. Galiote-Flores, L. J. Garcia-Barrera, E. T. Rodriguez-Galindo, A. Toscano-Contreras, E. Lucio-Decanini, and A. E. Absalon. 2016. Clinicopathological characterization and genomic sequence differences observed in a highly virulent fowl Aviadenovirus serotype 4. Avian. Pathol. 45:73–81. Verma, K., B. Malik, and S. Kumar. 1971. Preliminary report on the isolation and characterization of chicken embryo-lethalorphan (CELO) virus from poultry. Indian. J. Anim. Sci. 40: 1002–1003. Voss, M., E. Vielitz, M. Hess, C. Prusas, and A. Mazaherri. 1996. Aetiological aspects of hepatitis and HPS caused by pathogenic adenoviruses in different countries. Proc. International symposium on adenovirus and reovirus infection in poultry, Rauischholzhausen. Watanabe, M., U. Kohdera, M. Kino, T. Haruta, S. Nukuzuma, T. Suga, K. Akiyoshi, M. Ito, S. Suga, and Y. Komada. 2005. Detection of adenovirus DNA in clinical samples by SYBR Green real-time polymerase chain reaction assay. Pediatr. Int. 47:286– 291. Xie, Z., A. A. Fadl, T. Girshick, and M. I. Khan. 1999. Detection of avian adenovirus by polymerase chain reaction. Avian. Dis. 43:98–105. Xie, Z., S. Luo, Q. Fan, L. Xie, J. Liu, Z. Xie, Y. Pang, X. Deng, and X. Wang. 2013. Detection of antibodies specific to the nonstructural proteins of fowl adenoviruses in infected chickens but not in vaccinated chickens. Avian. Pathol. 42:491–496. Ye, J., G. Liang, J. Zhang, W. Wang, N. Song, P. Wang, W. Zheng, Q. Xie, H. Shao, Z. Wan, C. Wang, H. Chen, W. Gao, and A. Qin. 2016. Outbreaks of serotype 4 fowl adenovirus with novel genotype, China. Emerg. Microbes. Infect. 5:e50. Zhang, X. 2006. A report of the hydropericardium syndrome in broiler. Guid. Chin. Poul. 23:25–25. Zhao, J., Q. Zhong, Y. Zhao, Y. X. Hu, and G. Z. Zhang. 2015. Pathogenicity and complete genome characterization of fowl adenoviruses isolated from chickens associated with inclusion body hepatitis and hydropericardium syndrome in China. PLoS One 10:e0133073. Zhang, T., Q. Jin, P. Ding, Y. Wang, Y. Chai, Y. Li, X. Liu, J. Luo, and G. Zhang. 2016. Molecular epidemiology of hydropericardium syndrome outbreak-associated serotype 4 fowl adenovirus isolates in central China. Virol. J. 13:188. Zsak, L., and J. Kisary. 1984. Grouping of fowl adenoviruses based upon the restriction patterns of DNA generated by BamHI and HindIII. Intervirology. 22:110–114.