- Email: [email protected]
Freezing of body fluids induces metallothionein gene expression in earthworms (Dendrobaena octaedra)
Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Freezing of body fluids induces metallothionein gene expression in earthworms (Dendrobaena octaedra) Karina Vincents Fisker a, Martin Holmstrup a,⁎, Jesper Givskov Sørensen b a b
Section of Soil Fauna Ecology and Ecotoxicology, Department of Bioscience, Aarhus University, Vejlsøvej 25, DK-8600 Silkeborg, Denmark Section of Genetics, Ecology and Evolution, Department of Bioscience, Aarhus University, Ny Munkegade 116, DK-8000 Aarhus C, Denmark
a r t i c l e
i n f o
Article history: Received 10 July 2015 Received in revised form 14 August 2015 Accepted 23 August 2015 Available online 29 August 2015 Editor: T.P. Mommsen Keywords: Freeze tolerance Metal toxicity Metallothionein Oxidative stress qPCR
a b s t r a c t The molecular mechanisms activated by environmental contaminants and natural stressors such as freezing need to be investigated in order to better understand the mechanisms of interaction and potential effects that combined stressors may have on organisms. Using the freeze-tolerant earthworm Dendrobaena octaedra as model species, we exposed worms to freezing and exposure to sublethal copper in a factorial design and investigated the transcription of candidate genes for metal and cold stress. We hypothesised that both freezing and copper would induce transcription of genes coding for heat shock proteins (hsp10 and hsp70), metallothioneins (mt1 and mt2), and glutathione-S-transferase (gst), and that the combined effects of these two stressors would be additive. The gene transcripts hsp10, hsp70, and gst were significantly upregulated by freezing, but only hsp10 was upregulated by copper. We found that copper at the time of sampling had no effect on transcription of two metallothionein genes whereas transcription was strongly upregulated by freezing. Moreover, there was a significant interaction causing more than additive transcription rates of mt1 in the copper/freezing treatment suggesting that freeze-induced cellular dehydration increases the concentration of free copper ions in the cytosol. This metallothionein response to freezing is likely adaptive and possibly provides protection against freezeinduced elevated metal concentrations in the cytosol and excess ROS levels due to hypoxia during freezing. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Soil invertebrates of the cold temperate and subarctic regions that inhabit the superficial litter layer must tolerate long periods of subzero temperatures and recurring periods of thawing and freezing. One such species, the earthworm Dendrobaena octaedra Savigny, has developed the ability to survive freezing of its body fluids (Berman et al., 2002; Rasmussen and Holmstrup, 2002). The biochemical mechanisms that support freeze tolerance in this species are the same as described for numerous other invertebrates and include accumulation of large stores of glycogen that can be converted to glucose serving both as a cryoprotectant and as fuel for anaerobic metabolism when oxygen supply is hindered by freezing of body fluids (Storey and Storey, 1990; Holmstrup et al., 2007a; Calderon et al., 2009). Metabolic rate of D. octaedra decreases to about 10% of aerobic rate at the same temperature which extends the period that glycogen reserves can support anaerobic metabolism and ensure survival in a frozen state for almost 6 months (Calderon et al., 2009). Recently, our laboratory has focussed on the interactions between environmental contaminants (e.g. heavy metals) and natural stressors such ⁎ Corresponding author. Tel.: +45 3018 3152. E-mail address: [email protected] (M. Holmstrup).
http://dx.doi.org/10.1016/j.cbpc.2015.08.008 1532-0456/© 2015 Elsevier Inc. All rights reserved.
as freezing and drought (Holmstrup et al., 2010; Laskowski et al., 2010). Emissions of heavy metals from smelters and other industrial sources have locally contaminated soils of northern Europe with impacts on the soil fauna (Bengtsson et al., 1983; Bengtsson and Rundgren, 1988; Spurgeon and Hopkin, 1999; Tosza et al., 2010). In addition to toxic effects of heavy metals per se, our studies show that sublethal concentrations of some heavy metals can reduce the ability of D. octaedra to tolerate freezing which adds another dimension to the problems of pollution (Bindesbøl et al., 2005, 2009; Noyes et al., 2009; Hooper et al., 2013). The molecular mechanisms activated by environmental contaminants (e.g. heavy metals) and natural stressors such as freezing and drought need to be investigated in order to better understand the mechanisms of interaction and potential effects that combined stressors will have on animals (Hooper et al., 2013). Here, we choose to investigate a number of candidate genes, representing such mechanisms. It is well-known that anoxic or hypoxic conditions followed by reperfusion and high oxygen consumption may lead to generation of reactive oxygen species (ROS) that can cause oxidative damages such as denaturation of proteins and enzyme malfunctioning, lipid peroxidation, and damages to DNA (Hermes-Lima et al., 1998; Hermes-Lima, 2004). Freezing of body fluids also lead to hypoxic conditions because oxygen transport is limited in the frozen animal. The recurrence of oxic conditions upon thawing will subsequently initiate the generation
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
of ROS which is a major problem for freeze-tolerant animals (Joanisse and Storey, 1996; English and Storey, 2003; Storey et al., 2013). Earthworms living in soils polluted with copper take up free copper ions (Cu2 +) primarily across their skin (Vijver et al., 2003) through membrane-bound copper pumps (Vulpe and Packman, 1995). Once in the cytoplasm, Cu2+ is delivered to various cell targets with the help of copper chaperones. These chaperones include glutathione and metallothionein (Dallinger et al., 2000). The MT pathway is one of the most studied metal detoxifying mechanisms and known to be important for metal homeostasis in earthworms (Stürzenbaum et al., 1998, 2004; Spurgeon et al., 2004). Metallothioneins (MT) are cysteine-rich, lowmolecular-weight proteins, which are known to have a high binding capacity for cadmium, copper, and probably also zinc (Dallinger et al., 2000; Spurgeon et al., 2004). If not bound to MT or other molecular chaperones, free cellular Cu2+ can result in generation of ROS via the Fenton reaction (Stohs and Bagchi, 1995; Valko et al., 2005). It seems therefore that survival of both freezing and copper toxicity depends on efficient enzyme systems that can prevent generation of, or remove and detoxify ROS. We are particularly interested in uncovering the mechanisms underlying the interactions between effects of freezing and contaminants, and therefore have studied the transcription of genes involved in detoxification of ROS and heavy metals using D. octaedra as a model. In a factorial test design, we tested the effects of freezing and exposure for sublethal copper concentrations singly and in combination. We hypothesised that both freezing and copper would induce transcription of genes coding for heat shock proteins, metallothioneins, cytochrome oxidase, and glutathione-S-transferase, and that the combined effects of these two stressors would be additive. 2. Materials and methods 2.1. Earthworms and soil Dendrobaena octaedra were collected near Valdemarsvik, south-east Sweden, in autumn 2009. About 15 adult worms were collected from each of three locations (about 1 km apart from each other) where the vegetation was dominated by mosses in mixed pine and birch forest. The area was not contaminated by human activities. The earthworms were transported to the laboratory in Silkeborg, Denmark, and were used for establishment of laboratory cultures. The adult worms from the collection sites were cultured as three separate populations in uncontaminated agricultural soil at 15 °C and fed with cow dung as described by Fisker et al. (2011a). Cocoons were harvested every month and hatched in Petri dishes, of which the bottom was layered with wet filter paper. The soil used in this experiment originated from the agricultural research facilities at Askov, Denmark (see Fisker et al. (2011a) for further details on soil properties). The soil was dried for 24 h at 80 °C before it was re-watered to 18% of dry weight. Cow dung was dried and finely ground, and worm food was prepared by mixing moist soil, dried cow dung, and water in the ratio: 42:21:37 w/w/w. Soil for the copper treatment was spiked with anhydrous CuCl2 (Cu2 +) by dissolving it in water before mixing it into the dry soil. The food for the copper-exposed worms was made on basis of the copper-spiked soil mixed with dried cow dung in the same ratio as for the control food. The soil for the experiment was made 1 day before use to equilibrate and was kept at 15 ± 1 °C. 2.2. Treatments The present study used 3rd generation worms with an age of approximately 4 months to conduct a combined freeze and copper tolerance study. Worms were placed in either uncontaminated control soil or soil spiked with copper to a nominal concentration of 160 mg kg−1 dry soil. A previous study showed that this concentration of copper is sublethal and that worms exposed to soil spiked with 160 mg Cu kg−1 had an increased internal copper concentration (between 110 and
45
150 μg g−1 dry tissue) compared to worms from control soil (13–16 μg g−1 dry tissue)(Fisker et al., 2011b). The two groups were slowly acclimated to low temperatures and thereafter exposed to subzero temperatures. The worms were placed separately in 200 mL plastic beakers containing 70–75 g soil and roughly 4 g food (n = 10–15). Worms were acclimated at 10 °C for 1 week followed by 1 week at 5 °C, and finally 4 weeks at 2 °C. After the cold acclimation period, the worms were moved to 50 mL plastic beakers containing the same mixed moist soil and food (about 30 g fresh weight) and kept at 2 °C for two more weeks to ensure that the worms were cold hardy and would survive the freezing treatment (Holmstrup et al., 2007b). Half of the worms were kept at + 2 °C as a control group, and the rest of the worms were placed in a walk-in freezer cabinet at − 1 ± 0.2 °C for 16 h. A small piece of ice (50–100 mg) was added to the soil surface to seed the freezing of soil and worm. The worms were checked by prodding to confirm that their body fluids were frozen. Temperature was then lowered to − 2 ± 0.2 °C and kept here for 14 h until they were sampled for analysis. At the end of the treatments, worms were quickly rinsed in demineralised water, placed in 2 mL centrifuge tubes, and snap frozen in liquid nitrogen. All thawed worms looked healthy and were responding to handling upon thawing. The samples were kept at −80 °C until further analysis. 2.3. RNA extraction and cDNA synthesis Four replicate worms from each population and treatment were used for testing the relative gene expression. The samples were homogenised in 1 ml 50 mM phosphate buffer (pH 7.4) using a Tissue-lyser II with a steel bead at 30 Hz for 20 s (Qiagen, Copenhagen, Denmark). RNA extraction was done by using the RNeasy Mini kit with on-column DNAse treatment (Qiagen, Copenhagen, Denmark) according to the instructions provided by the manufacturer. The success of the DNAse treatment was later verified by the absence of amplifiable DNA in a qPCR assay on RNA samples. The concentration of RNA was determined by using an Implen NanoPhotometer spectrophotometer (AH Diagnostics, Aarhus, Denmark). By following the manufacturer's instructions, cDNA was synthesised from 1.2 μg total RNA using the Omniscript Reverse Transcriptase kit (Qiagen) and Anchored Oligo(dT)20 primers (Invitrogen A/S, Taastrup, Denmark). Furthermore, cDNA was diluted 14-fold, to a concentration equivalent to 4 ng total RNA μL−1, and stored at −20 °C until further use. 2.4. Relative quantification of messenger RNA (qPCR) The sequences of the analysed genes were obtained from a transcriptome of D. octaedra (M. Holmstrup et al., unpublished). Preliminary annotated isotigs were identified and further verified by blastx analyses against the non-redundant protein database in GenBank (http://www. ncbi.nlm.nih.gov/genbank/). E-values for these blastx analyses are listed in Table 1. Primers were designed by using Primer3 (Rozen and Skaletsky, 2000) and were synthesised by MWG (Ebersberg, Germany). Primer sequences for the target genes are listed in Table 1. Details of these analyses are presented in Fisker et al. (2013). Stratagene Brilliant® II SYBR® Green qPCR Mastermix (AH Diagnostics, Aarhus, Denmark) was used for real-time quantitative polymerase chain reaction (qPCR) conducted on a Stratagene MX3005P (AH Diagnostics, Aarhus, Denmark). Each reaction contained 5 μL of cDNA template (equivalent to 20 ng total RNA) along with 900 nM primers in a final volume of 15 μL and these reactions were run in duplicate. The amplification was performed under the following conditions: 95 °C for 10 min to activate the DNA polymerase, then 40 cycles of 95 °C for 10 s and 60 °C for 60 s. Melting curves of the raw qPCR data were inspected to confirm the presence of a single amplification product with no primer-dimers. Furthermore, all products were run on a 1% agarose gel to verify that only one PCR product was present. No major
46
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
Table 1 Gene name, gene symbol, and primer sequences used for genes investigated by real-time qPCR. Primer sequences were as the ones investigated by Fisker et al. (2013), where a detailed analysis of the identified expressed sequence tags can be found (table modified from Fisker et al. (2013)). Gene name
Symbol
Primer (5′–3′)
Amplicon size (bp)
Heat shock protein 10
hsp10
92
Heat shock protein 70
hsp70
Metallothionein
mt1
Metallothionein
mt2
Glutathione-S-transferase
Gst
Cytochrome oxidase
Cytox
F: TTCTCGAGGCAACAGTTGTG R: AACTTTATCGCCGACCTTCA F: AGCTGAGCATCGAGGAGAAG R: TCCTTGAAGTCCTCCACGTC F: TGTCGACTGCAAGTGTGTGA R: ATCCACTCTTCTCCGATCCA F: TGGCTGATGCTCTCAACACT R: GCAGGAACATGTAGACCCTTG F: TGGATTCTTCGTTGGTGACA R: ACGCGAGTAGAATCCCTTCA F: CACCATCAGGGATCAGACCT R: TGTGGTGGGCTCATGTAACT
variations were found and all qPCR products originated from the expected genes. 2.5. Data analyses and statistics Data analysis for real-time PCR (DART-PCR) (Peirson et al., 2003) was used for analysing the raw qPCR data. For every sample, DARTPCR enables calculation of threshold cycles and amplification efficiencies. Calculated efficiencies indicated around 2-fold amplification per PCR cycle for all genes. In the few cases where outliers were identified by DART-PCR, they were removed from the dataset prior to further analysis. The resulting data set was normalised using the data-driven NORMA-Gene normalisation method which does not require the use of reference genes (Heckmann et al., 2011). Data were logtransformed to optimise normality and homogeneity of variances. A mixed model with ‘copper’ and ‘freezing’ as fixed factors and ‘population’ as a random factor was used to test for the effect of copper and freezing, and their interaction, on relative normalised expression of the target genes using R (version 3.1.2). 3. Results Copper exposure had a negative effect on transcription of hsp10 and negative effect on cytox close to statistical significance (P = 0.05) whereas other examined genes were not significantly influenced by
100 80 71 127 99
copper exposure (Fig. 1 and Table 2). Freezing increased transcription levels of all tested genes (Fig. 1 and Table 2). Transcription of the genes mt1 and mt2 were two-fold and more than five-fold upregulated, respectively. Transcription of gst was also about five times higher in frozen worms. Finally, for mt1, there was a significant interaction between effects of freezing and copper exposure suggesting that transcription in the combined treatment was higher than expected from the addition of the two separate effects (Fig. 1 and Table 2). 4. Discussion Freezing of body fluids results in a drastic cellular dehydration since solutes are excluded from the growing ice leading to an increasing solute concentration of the unfrozen body water and a consequent osmotic outflux of water from cells and tissues (Zachariassen, 1985; Storey and Storey, 1996). The ongoing molecular processes are therefore taking place under challenging and potentially stressful conditions in the cell. The increased concentration of ions may perturb the conformation of proteins in the cytosol, and as a response, the cells may launch a stress response including molecular chaperones such as heat shock proteins, which will help by stabilising and re-folding the denatured proteins (Ananthan et al., 1986; Feder and Hofmann, 1999). High levels of ROS can in parallel induce denaturation of proteins further elevating the need for molecular chaperones. We observed that transcription of hsp10 and hsp70 was upregulated due to freezing which is an indication
Fig. 1. Transcription of selected target genes (see Table 1 for codes and Table 2 for statistics) in the earthworm Dendrobaena octaedra exposed to control soil or copper-spiked soil (160 mg Cu kg−1 dry soil), and subsequently kept at +2 °C (control temperature) or frozen at −2 °C. All values (mean ± sem) are relative to controls kept at +2 °C (Cu 0; +2 °C).
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
47
Table 2 Nested two-way ANOVA analysis of gene expression (see Table 1 for codes) in Dendrobaena octaedra exposed to either control soil or copper-spiked soil (160 mg Cu kg−1 dry soil), and subsequently either kept at +2 °C (control temperature) or frozen at −2 °C. The effects of copper and freezing were tested including interaction between the two stressors (P-values; df = 1). Source
mt1
mt2
gst
hsp10
hsp70
cytox
Copper Freezing Copper × freezing
0.128 1.4 × 10−6 0.033
0.094 1.7 × 10−7 0.174
0.388 1.05 × 10−11 0.316
0.003 0.009 0.184
0.061 1.3 × 10−9 0.053
0.050 2.55 × 10−5 0.131
of cellular damages such as protein denaturation. Low temperature per se can potentially cause proteins to lose their folded structure (Lopez et al., 2008); however, the temperature lowering from +2 °C to freezing at −2 °C used in the present experiment seems unlikely to have such effects. We suggest that the induction of heat shock proteins is rather due to the aforementioned changes in osmolyte concentration upon freezing of body fluids. In line with this interpretation, several studies have shown that freezing (in freeze-tolerant invertebrates) can induce heat shock proteins (Teets et al., 2011; Zhang et al., 2011) whereas freezeavoiding or chill-susceptible species do not have elevated levels of heat shock proteins during cold exposure (i.e. without ice formation), but often upon recovery from cold exposure (Sejerkilde et al., 2003; Nielsen et al., 2005; Kostal and Tollarová-Borovanská, 2009; Sørensen et al., 2010; Hayward et al., 2014). The transcription of a gene coding for a cytochrome oxidase (cytox) seemed to be downregulated by copper in the present experiment, but not with convincing statistical significance. Similarly, Fisker et al. (2013) found that this gene was not influenced by copper. The copper concentration used in the present study was not causing decreased growth or reproduction rates as compared to control soil (Bindesbøl et al., 2007), so it may be concluded that transcription of cytox is not responsive to the copper concentrations used here. Bundy et al. (2008) studied gene expression in the earthworm Lumbricus rubellus exposed to copper and observed that most cytochrome oxidases involved in the mitochondrial electron transport chain were upregulated and that an increased metabolism of stored carbohydrates occurred as a consequence of copper exposure. The increased expression of cytochrome oxidases could be a response of the organism facilitating oxidative phosphorylation in the metabolism of storage carbohydrates (Bundy et al., 2008). Upon freezing, D. octaedra rapidly catabolises glycogen to glucose, which is then available as a cryoprotectant and as fuel for metabolism (Rasmussen and Holmstrup, 2002; Calderon et al., 2009). We observed that the transcription of cytox in frozen D. octaedra was upregulated, and although we have only studied one gene of many cytochrome oxidases, this response could also be a sign of an increased expression of genes coding for enzymes of the electron transport chain needed for optimal exploitation of available glucose. The two metallothionein genes that have been identified in D. octaedra are homologous to metallothioneins identified in other earthworm species (Spurgeon et al., 2004; Liang et al., 2011). Perhaps surprisingly, we did not observe any induction of transcription of these genes in copper-exposed worms even though worms clearly accumulate copper in significant concentrations when exposed to this or other types of copper-contaminated soil (Fisker et al., 2011a,2011b). Previous investigations show that mt1 is relatively unresponsive to copper whereas mt2 was significantly upregulated after 7 days of exposure to the same concentrations as used in the present study (Fisker et al., 2013). Other authors have also found that metallothioneins of earthworms are not as responsive to copper as to e.g. cadmium (Spurgeon et al., 2004). Another reason for this seeming unresponsiveness could be that body concentration of copper at the time of sampling (i.e. after 6 weeks) had reached steady state and that an early upregulation of mt1 and mt2 had occurred, but that gene transcription at the time of sampling had resumed to normal (Fisker et al., 2013). Interestingly, transcription of both metallothionein genes was significantly upregulated in frozen earthworms. Two different interpretations of
this result may be suggested. Firstly, freeze-induced dehydration of cells is expected to rapidly increase the concentration of free metal ions (e.g. Cd, Cu, and Zn) to potentially toxic concentrations which could induce the transcription of metallothionein genes. With a typical melting point (MP) of earthworm body fluids around −0.4 °C (Holmstrup, 1992), we may roughly estimate that about 80% of freezeable body water is frozen at −2 °C (the fraction of ice, F = 1 − MP/T, where T is ambient temperature). Accordingly, concentrations of free metal ions would increase fivefold and thus perhaps reach toxic levels. Trautsch et al. (2011) found that ice nucleating lipoproteins of freeze-tolerant beetles (Phyto depressus) had 100-fold greater capacity to bind metals (Cu2+, Cd2+, and Zn2+) than albumin and proposed that lipoproteins may aid in detoxification of freezing-induced elevated concentrations of such metal ions during overwintering. These authors noted that the concentrations of lipoproteins of P. depressus were three to four orders of magnitude higher than needed for effectively securing protective freezing at high subzero temperatures and therefore suggested that the lipoproteins had other functions in addition to ice nucleation (Trautsch et al., 2011). Metallothioneins may have a similar role as proposed for ice nucleating lipoproteins in P. depressus. In that case, we expected the combination of freezing and copper exposure to result in a greater upregulation of metallothionein genes than freezing alone would do. In fact, we did observe a significant interaction between freezing and copper exposure resulting in a higher than additive transcription of mt1 in the combined treatment, which supports the hypothesis that freeze-induced elevation of free Cu2+ could be the reason for an increased transcription of metallothionein genes. Although not statistically significant (i.e. no significant interaction term), the same trend was observed for mt2. An alternative, but not mutually exclusive, explanation for freezeinduced elevated transcription of metallothionein genes could be related to hypoxia. As described in the introduction to this study, freezing of body fluids inevitably produces hypoxia of tissues due to the reduced diffusive transport of oxygen when ice is present in the earthworm body. In line with this notion, Calderon et al. (2009) reported that D. octaedra frozen at −2 °C accumulated alanine, which is an indicator of anaerobic metabolism (Storey et al., 2007). If anoxic conditions led to formation of excess ROS, there would be a need for cellular antioxidant agents. Glutathione is an important antioxidant that may be depleted due to oxidative stress (Hermes-Lima, 2004). This, in turn, is related to transcription rate of genes coding for glutathione-S-transferase, which indeed was significantly upregulated in frozen worms. However, metallothioneins can also act as antioxidant agents during hypoxic conditions (Viarengo et al., 1999). Hence, the increased gene transcription of mt1 and mt2 of frozen D. octaedra could be interpreted as a protective response to freezeinduced hypoxia. Only one previous study has indicated this mechanism of metallothionein in a freeze-tolerant invertebrate, the marine gastropod Littorina littorea (English and Storey, 2003). Similar to the observations of the present study, these authors observed a significant upregulation of metallothionein during a 24 h freeze and suggested that metallothionein served as an antioxidant scavenging ROS by thiolate oxidation of the cysteine residues (English and Storey, 2003). In conclusion, the present study has shown that transcription of two metallothionein genes is significantly upregulated in D. octaedra during freezing of body fluids. This cellular response to freezing is likely adaptive and possibly provides protection against freeze-induced elevated metal concentrations in the cytosol and excess ROS levels due to hypoxia during freezing.
48
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
Acknowledgments This study was supported by a Sapere Aude DFF-Starting grant from The Danish Council for Independent Research | Natural Sciences (JGS). References Ananthan, J., Goldberg, A., Voellmy, R., 1986. Abnormal proteins serve as eukaryotic stress signals and trigger the activation of heat shock genes. Science 232, 522–524. Bengtsson, G., Rundgren, S., 1988. The Gusum case: a brass mill and the distribution of soil Collembola. Can. J. Zool. 66, 1518–1526. Bengtsson, G., Nordström, S., Rundgren, S., 1983. Population density and tissue metal concentration of lumbricids in forest soils near a brass mill. Environ. Pollut. 30, 87–108. Berman, D., Meshcheryakova, E., Alfimov, A., Leirkh, A., 2002. Distribution of the earthworms Dendrobaena octaedra (Lumbricidae, Oligochaeta) in the northern holarctic is restricted by its insufficient freeze tolerance. Zool. J. 81, 1210–1221. Bindesbøl, A.M., Holmstrup, M., Damgaard, C., Bayley, M., 2005. Stress synergy between environmentally realistic levels of copper and frost in the earthworm Dendrobaena octaedra. Environ. Toxicol. Chem. 24, 1462–1467. Bindesbøl, A.M., Bayley, M., Damgaard, C., Holmstrup, M., 2007. Life-history traits and population growth rate in the laboratory of the earthworm Dendrobaena octaedra cultured in copper-contaminated soil. Appl. Soil Ecol. 35, 46–56. Bindesbøl, A.M., Bayley, M., Damgaard, C., Holmstrup, M., 2009. Impacts of heavy metals, polyaromatic hydrocarbons and pesticides on freeze tolerance of the earthworm Dendrobaena octaedra. Environ. Toxicol. Chem. 28, 2341–2347. Bundy, J.G., Sidhu, J.K., Rana, F., Spurgeon, D.J., Svendsen, C., Wren, J.F., Sturzenbaum, S.R., Morgan, A.J., Kille, P., 2008. 'Systems toxicology' approach identifies coordinated metabolic responses to copper in a terrestrial non-model invertebrate, the earthworm Lumbricus rubellus. BMC Biol. 6. Calderon, S., Holmstrup, M., Westh, P., Overgaard, J., 2009. Dual roles of glucose in the freeze-tolerant earthworm Dendrobaena octaedra: cryoprotection and fuel for metabolism. J. Exp. Biol. 212, 859–866. Dallinger, R., Berger, B., Gruber, C., Hunziker, P., Sturzenbaum, S., 2000. Metallothioneins in terrestrial invertebrates: Structural aspects, biological significance and implications for their use as biomarkers. Cell. Mol. Biol. 46, 331–346. English, T.E., Storey, K.B., 2003. Freezing and anoxia stresses induce expression of metallothionein in the foot muscle and hepatopancreas of the marine gastropod Littorina littorea. J. Exp. Biol. 206, 2517–2524. Feder, M., Hofmann, G., 1999. Heat shock proteins, molecular chaperones, and the stress response. Annu. Rev. Physiol. 61, 243–282. Fisker, K.V., Sorensen, J.G., Damgaard, C., Pedersen, K.L., Holmstrup, M., 2011a. Genetic adaptation of earthworms to copper pollution: is adaptation associated with fitness costs in Dendrobaena octaedra? Ecotoxicology 20, 563–573. Fisker, K.V., Sørensen, J.G., Holmstrup, M., 2011b. No costs on freeze tolerance in genetically copper adapted earthworm populations (Dendrobaena octaedra). Comp. Biochem. Physiol. C 154, 204–207. Fisker, K.V., Holmstrup, M., Sorensen, J.G., 2013. Variation in metallothionein gene expression is associated with adaptation to copper in the earthworm Dendrobaena octaedra. Comp. Biochem. Physiol., C:Toxicol. Pharmacol. 157, 220–226. Hayward, S.A.L., Manso, B., Cossins, A.R., 2014. Molecular basis of chill resistance adaptations in poikilothermic animals. J. Exp. Biol. 217, 6–15. Heckmann, L.H., Sørensen, P.B., Krogh, P.H., Sørensen, J.G., 2011. NORMA-Gene: a simple and robust method for qPCR normalisation based on target gene data. BMC Bioinf. 12. Hermes-Lima, M., 2004. Oxygen in biology and biochemistry: Role of free radicals. In: Storey, K.B. (Ed.), Functional Metabolism: Regulation and Adaptation. John Wiley and Sons, Inc., Hoboken, pp. 319–368. Hermes-Lima, M., Storey, J.M., Storey, K.B., 1998. Antioxidant defenses and metabolic depression. The hypothesis of preparation for oxidative stress in land snails. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 120, 437–448. Holmstrup, M., 1992. Cold hardiness strategy in cocoons of the lumbricid earthworm Dendrobaena octaedra (Savigny). Comp. Biochem. Physiol. 102A, 49–54. Holmstrup, M., Overgaard, J., Bindesbøl, A.M., Pertoldi, C., Bayley, M., 2007a. Adaptations to overwintering in the earthworm Dendrobaena octaedra: genetic differences in glucose mobilisation and freeze tolerance. Soil Biol. Biochem. 39, 2640–2650. Holmstrup, M., Sørensen, L.I., Bindesbøl, A.M., Hedlund, K., 2007b. Cold acclimation and lipid composition in the earthworm Dendrobaena octaedra. Comp. Biochem. Physiol. A 147, 911–919. Holmstrup, M., Bindesbøl, A.M., Oostingh, G.J., Duschl, A., Scheil, V., Köhler, H.R., Loureiro, S., Soares, A., Ferreira, A.L.G., Kienle, C., Gerhardt, A., Laskowski, R., Kramarz, P.E., Bayley, M., Svendsen, C., Spurgeon, D.J., 2010. Interactions between effects of environmental chemicals and natural stressors: a review. Sci. Total Environ. 408, 3746–3762. Hooper, M.J., Ankley, G.T., Cristol, D.A., Maryoung, L.A., Noyes, P.D., Pinkerton, K.E., 2013. Interactions between chemical and climate stressors: a role for mechanistic toxicology in assessing climate change risks. Environ. Toxicol. Chem. 32, 32–48. Joanisse, D.R., Storey, K.B., 1996. Oxidative stress and antioxidants in overwintering larvae of cold-hardy goldenrod gall insects. J. Exp. Biol. 199, 1483–1491.
Kostal, V., Tollarová-Borovanská, M., 2009. The 70 kDa heat shock protein assists during the repair of chilling injury in the insect, Pyrrhocoris apterus. PLoS ONE 4 (2), e4546. Laskowski, R., Bednarska, A.J., Kramarz, P.E., Loureiro, S., Scheil, V., Kudlek, J., Holmstrup, M., 2010. Interactions between toxic chemicals and natural environmental factors – a meta-analysis and case studies. Sci. Total Environ. 408, 3763–3774. Liang, S.H., Chen, S.C., Chen, C.Y., Kao, C.M., Yang, J.I., Shieh, B.S., Chen, J.H., Chen, C.H., 2011. Cadmium-induced earthworm metallothionein-2 is associated with metal accumulation and counteracts oxidative stress. Pedobiologia 54, 333–340. Lopez, C.F., Darst, R.K., Rossky, P.J., 2008. Mechanistic elements of protein cold denaturation. J. Phys. Chem. B 112, 5961–5967. Nielsen, M.M., Overgaard, J., Sørensen, J.G., Holmstrup, M., Justesen, J., Loeschcke, V., 2005. Role of HSF activation for resistance to heat, cold and high-temperature knock-down. J. Insect Physiol. 51, 1320–1329. Noyes, P.D., McElwee, M.K., Miller, H.D., Clark, B.W., Van Tiem, L.A., Walcott, K.C., Erwin, K.N., Levin, E.D., 2009. The toxicology of climate change: environmental contaminants in a warming world. Environ. Int. 35, 971–986. Peirson, S.N., Butler, J.N., Foster, R.G., 2003. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res. 31, e73. Rasmussen, L., Holmstrup, M., 2002. Geographic variation of freeze-tolerance in the earthworm Dendrobaena octaedra. J. Comp. Physiol. B. 172, 691–698. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Sejerkilde, M., Sørensen, J.G., Loeschcke, V., 2003. Effects of cold- and heat hardening on thermal resistance in Drosophila melanogaster. J. Insect Physiol. 49, 719–726. Sørensen, J.G., Heckmann, L.H., Holmstrup, M., 2010. Temporal gene expression profiles in a palaearctic springtail as induced by desiccation, cold exposure and during recovery. Funct. Ecol. 24, 838–846. Spurgeon, D.J., Hopkin, S.P., 1999. Seasonal variation in the abundance, biomass and biodiversity of earthworms in soils contaminated with metal emissions from a primary smelting works. J. Appl. Ecol. 36, 173–183. Spurgeon, D.J., Sturzenbaum, S.R., Svendsen, C., Hankard, P.K., Morgan, A.J., Weeks, J.M., Kille, P., 2004. Toxicological, cellular and gene expression responses in earthworms exposed to copper and cadmium. Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 138, 11–21. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal-ions. Free Radic. Biol. Med. 18, 321–336. Storey, K., Storey, J., 1990. Facultative metabolic rate depression: molecular regulation and biochemical adaptation in anaerobiosis, hibernation and estivation. Quat. Rev. Biol. 65, 145–174. Storey, K.B., Storey, J.M., 1996. Natural freezing survival in animals. Annu. Rev. Ecol. Syst. 27, 365–386. Storey, K.B., Storey, J.M., Churchill, T.A., 2007. Freezing and anoxia tolerance of slugs: a metabolic perspective. J. Comp. Physiol. B-Biochem. Syst. Environ. Physiol. 177, 833–840. Storey, K.B., Lant, B., Anozie, O.O., Storey, J.M., 2013. Metabolic mechanisms for anoxia tolerance and freezing survival in the intertidal gastropod, Littorina littorea. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 165, 448–459. Stürzenbaum, S.R., Kille, P., Morgan, A.J., 1998. The identification, cloning and characterization of earthworm metallothionein. FEBS Lett. 431, 437–442. Stürzenbaum, S.R., Georgiev, O., Morgan, A.J., Kille, P., 2004. Cadmium detoxification in earthworms: from genes to cells. Environ. Sci. Technol. 38, 6283–6289. Teets, N.M., Kawarasaki, Y., Lee, R.E., Denlinger, D.L., 2011. Survival and energetic costs of repeated cold exposure in the Antarctic midge, Belgica antarctica: a comparison between frozen and supercooled larvae. J. Exp. Biol. 214, 806–814. Tosza, E., Dumnicka, E., Niklinska, M., Rozen, A., 2010. Enchytraeid and earthworm communities along a pollution gradient near Olkusz (southern Poland). Eur. J. Soil Biol. 46, 218–224. Trautsch, J., Rosseland, B.O., Pedersen, S.A., Kristiansen, E., Zachariassen, K.E., 2011. Do ice nucleating lipoproteins protect frozen insects against toxic chemical agents? J. Insect Physiol. 57, 1123–1126. Valko, M., Morris, H., Cronin, M.T.D., 2005. Metals, toxicity and oxidative stress. Curr. Med. Chem. 12, 1161–1208. Viarengo, A., Burlando, B., Cavaletto, M., Marchi, B., Ponzano, E., Blasco, J., 1999. Role of metallothionein against oxidative stress in the mussel Mytilus galloprovincialis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 277, R1612–R1619. Vijver, M.G., Vink, J.P.M., Miermans, C.J.H., van Gestel, C.A.M., 2003. Oral sealing using glue: a new method to distinguish between intestinal and dermal uptake of metals in earthworms. Soil Biol. Biochem. 35, 125–132. Vulpe, C.D., Packman, S., 1995. Cellular copper transport. In: McCormick, D.B. (Ed.)Annual Review of Nutrition, pp. 293–322. Zachariassen, K.E., 1985. Physiology of cold tolerance in insects. Physiol. Rev. 65, 799–831. Zhang, G., Storey, J.M., Storey, K.B., 2011. Chaperone proteins and winter survival by a freeze tolerant insect. J. Insect Physiol. 57, 1115–1122.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc
Freezing of body fluids induces metallothionein gene expression in earthworms (Dendrobaena octaedra) Karina Vincents Fisker a, Martin Holmstrup a,⁎, Jesper Givskov Sørensen b a b
Section of Soil Fauna Ecology and Ecotoxicology, Department of Bioscience, Aarhus University, Vejlsøvej 25, DK-8600 Silkeborg, Denmark Section of Genetics, Ecology and Evolution, Department of Bioscience, Aarhus University, Ny Munkegade 116, DK-8000 Aarhus C, Denmark
a r t i c l e
i n f o
Article history: Received 10 July 2015 Received in revised form 14 August 2015 Accepted 23 August 2015 Available online 29 August 2015 Editor: T.P. Mommsen Keywords: Freeze tolerance Metal toxicity Metallothionein Oxidative stress qPCR
a b s t r a c t The molecular mechanisms activated by environmental contaminants and natural stressors such as freezing need to be investigated in order to better understand the mechanisms of interaction and potential effects that combined stressors may have on organisms. Using the freeze-tolerant earthworm Dendrobaena octaedra as model species, we exposed worms to freezing and exposure to sublethal copper in a factorial design and investigated the transcription of candidate genes for metal and cold stress. We hypothesised that both freezing and copper would induce transcription of genes coding for heat shock proteins (hsp10 and hsp70), metallothioneins (mt1 and mt2), and glutathione-S-transferase (gst), and that the combined effects of these two stressors would be additive. The gene transcripts hsp10, hsp70, and gst were significantly upregulated by freezing, but only hsp10 was upregulated by copper. We found that copper at the time of sampling had no effect on transcription of two metallothionein genes whereas transcription was strongly upregulated by freezing. Moreover, there was a significant interaction causing more than additive transcription rates of mt1 in the copper/freezing treatment suggesting that freeze-induced cellular dehydration increases the concentration of free copper ions in the cytosol. This metallothionein response to freezing is likely adaptive and possibly provides protection against freezeinduced elevated metal concentrations in the cytosol and excess ROS levels due to hypoxia during freezing. © 2015 Elsevier Inc. All rights reserved.
1. Introduction Soil invertebrates of the cold temperate and subarctic regions that inhabit the superficial litter layer must tolerate long periods of subzero temperatures and recurring periods of thawing and freezing. One such species, the earthworm Dendrobaena octaedra Savigny, has developed the ability to survive freezing of its body fluids (Berman et al., 2002; Rasmussen and Holmstrup, 2002). The biochemical mechanisms that support freeze tolerance in this species are the same as described for numerous other invertebrates and include accumulation of large stores of glycogen that can be converted to glucose serving both as a cryoprotectant and as fuel for anaerobic metabolism when oxygen supply is hindered by freezing of body fluids (Storey and Storey, 1990; Holmstrup et al., 2007a; Calderon et al., 2009). Metabolic rate of D. octaedra decreases to about 10% of aerobic rate at the same temperature which extends the period that glycogen reserves can support anaerobic metabolism and ensure survival in a frozen state for almost 6 months (Calderon et al., 2009). Recently, our laboratory has focussed on the interactions between environmental contaminants (e.g. heavy metals) and natural stressors such ⁎ Corresponding author. Tel.: +45 3018 3152. E-mail address: [email protected] (M. Holmstrup).
http://dx.doi.org/10.1016/j.cbpc.2015.08.008 1532-0456/© 2015 Elsevier Inc. All rights reserved.
as freezing and drought (Holmstrup et al., 2010; Laskowski et al., 2010). Emissions of heavy metals from smelters and other industrial sources have locally contaminated soils of northern Europe with impacts on the soil fauna (Bengtsson et al., 1983; Bengtsson and Rundgren, 1988; Spurgeon and Hopkin, 1999; Tosza et al., 2010). In addition to toxic effects of heavy metals per se, our studies show that sublethal concentrations of some heavy metals can reduce the ability of D. octaedra to tolerate freezing which adds another dimension to the problems of pollution (Bindesbøl et al., 2005, 2009; Noyes et al., 2009; Hooper et al., 2013). The molecular mechanisms activated by environmental contaminants (e.g. heavy metals) and natural stressors such as freezing and drought need to be investigated in order to better understand the mechanisms of interaction and potential effects that combined stressors will have on animals (Hooper et al., 2013). Here, we choose to investigate a number of candidate genes, representing such mechanisms. It is well-known that anoxic or hypoxic conditions followed by reperfusion and high oxygen consumption may lead to generation of reactive oxygen species (ROS) that can cause oxidative damages such as denaturation of proteins and enzyme malfunctioning, lipid peroxidation, and damages to DNA (Hermes-Lima et al., 1998; Hermes-Lima, 2004). Freezing of body fluids also lead to hypoxic conditions because oxygen transport is limited in the frozen animal. The recurrence of oxic conditions upon thawing will subsequently initiate the generation
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
of ROS which is a major problem for freeze-tolerant animals (Joanisse and Storey, 1996; English and Storey, 2003; Storey et al., 2013). Earthworms living in soils polluted with copper take up free copper ions (Cu2 +) primarily across their skin (Vijver et al., 2003) through membrane-bound copper pumps (Vulpe and Packman, 1995). Once in the cytoplasm, Cu2+ is delivered to various cell targets with the help of copper chaperones. These chaperones include glutathione and metallothionein (Dallinger et al., 2000). The MT pathway is one of the most studied metal detoxifying mechanisms and known to be important for metal homeostasis in earthworms (Stürzenbaum et al., 1998, 2004; Spurgeon et al., 2004). Metallothioneins (MT) are cysteine-rich, lowmolecular-weight proteins, which are known to have a high binding capacity for cadmium, copper, and probably also zinc (Dallinger et al., 2000; Spurgeon et al., 2004). If not bound to MT or other molecular chaperones, free cellular Cu2+ can result in generation of ROS via the Fenton reaction (Stohs and Bagchi, 1995; Valko et al., 2005). It seems therefore that survival of both freezing and copper toxicity depends on efficient enzyme systems that can prevent generation of, or remove and detoxify ROS. We are particularly interested in uncovering the mechanisms underlying the interactions between effects of freezing and contaminants, and therefore have studied the transcription of genes involved in detoxification of ROS and heavy metals using D. octaedra as a model. In a factorial test design, we tested the effects of freezing and exposure for sublethal copper concentrations singly and in combination. We hypothesised that both freezing and copper would induce transcription of genes coding for heat shock proteins, metallothioneins, cytochrome oxidase, and glutathione-S-transferase, and that the combined effects of these two stressors would be additive. 2. Materials and methods 2.1. Earthworms and soil Dendrobaena octaedra were collected near Valdemarsvik, south-east Sweden, in autumn 2009. About 15 adult worms were collected from each of three locations (about 1 km apart from each other) where the vegetation was dominated by mosses in mixed pine and birch forest. The area was not contaminated by human activities. The earthworms were transported to the laboratory in Silkeborg, Denmark, and were used for establishment of laboratory cultures. The adult worms from the collection sites were cultured as three separate populations in uncontaminated agricultural soil at 15 °C and fed with cow dung as described by Fisker et al. (2011a). Cocoons were harvested every month and hatched in Petri dishes, of which the bottom was layered with wet filter paper. The soil used in this experiment originated from the agricultural research facilities at Askov, Denmark (see Fisker et al. (2011a) for further details on soil properties). The soil was dried for 24 h at 80 °C before it was re-watered to 18% of dry weight. Cow dung was dried and finely ground, and worm food was prepared by mixing moist soil, dried cow dung, and water in the ratio: 42:21:37 w/w/w. Soil for the copper treatment was spiked with anhydrous CuCl2 (Cu2 +) by dissolving it in water before mixing it into the dry soil. The food for the copper-exposed worms was made on basis of the copper-spiked soil mixed with dried cow dung in the same ratio as for the control food. The soil for the experiment was made 1 day before use to equilibrate and was kept at 15 ± 1 °C. 2.2. Treatments The present study used 3rd generation worms with an age of approximately 4 months to conduct a combined freeze and copper tolerance study. Worms were placed in either uncontaminated control soil or soil spiked with copper to a nominal concentration of 160 mg kg−1 dry soil. A previous study showed that this concentration of copper is sublethal and that worms exposed to soil spiked with 160 mg Cu kg−1 had an increased internal copper concentration (between 110 and
45
150 μg g−1 dry tissue) compared to worms from control soil (13–16 μg g−1 dry tissue)(Fisker et al., 2011b). The two groups were slowly acclimated to low temperatures and thereafter exposed to subzero temperatures. The worms were placed separately in 200 mL plastic beakers containing 70–75 g soil and roughly 4 g food (n = 10–15). Worms were acclimated at 10 °C for 1 week followed by 1 week at 5 °C, and finally 4 weeks at 2 °C. After the cold acclimation period, the worms were moved to 50 mL plastic beakers containing the same mixed moist soil and food (about 30 g fresh weight) and kept at 2 °C for two more weeks to ensure that the worms were cold hardy and would survive the freezing treatment (Holmstrup et al., 2007b). Half of the worms were kept at + 2 °C as a control group, and the rest of the worms were placed in a walk-in freezer cabinet at − 1 ± 0.2 °C for 16 h. A small piece of ice (50–100 mg) was added to the soil surface to seed the freezing of soil and worm. The worms were checked by prodding to confirm that their body fluids were frozen. Temperature was then lowered to − 2 ± 0.2 °C and kept here for 14 h until they were sampled for analysis. At the end of the treatments, worms were quickly rinsed in demineralised water, placed in 2 mL centrifuge tubes, and snap frozen in liquid nitrogen. All thawed worms looked healthy and were responding to handling upon thawing. The samples were kept at −80 °C until further analysis. 2.3. RNA extraction and cDNA synthesis Four replicate worms from each population and treatment were used for testing the relative gene expression. The samples were homogenised in 1 ml 50 mM phosphate buffer (pH 7.4) using a Tissue-lyser II with a steel bead at 30 Hz for 20 s (Qiagen, Copenhagen, Denmark). RNA extraction was done by using the RNeasy Mini kit with on-column DNAse treatment (Qiagen, Copenhagen, Denmark) according to the instructions provided by the manufacturer. The success of the DNAse treatment was later verified by the absence of amplifiable DNA in a qPCR assay on RNA samples. The concentration of RNA was determined by using an Implen NanoPhotometer spectrophotometer (AH Diagnostics, Aarhus, Denmark). By following the manufacturer's instructions, cDNA was synthesised from 1.2 μg total RNA using the Omniscript Reverse Transcriptase kit (Qiagen) and Anchored Oligo(dT)20 primers (Invitrogen A/S, Taastrup, Denmark). Furthermore, cDNA was diluted 14-fold, to a concentration equivalent to 4 ng total RNA μL−1, and stored at −20 °C until further use. 2.4. Relative quantification of messenger RNA (qPCR) The sequences of the analysed genes were obtained from a transcriptome of D. octaedra (M. Holmstrup et al., unpublished). Preliminary annotated isotigs were identified and further verified by blastx analyses against the non-redundant protein database in GenBank (http://www. ncbi.nlm.nih.gov/genbank/). E-values for these blastx analyses are listed in Table 1. Primers were designed by using Primer3 (Rozen and Skaletsky, 2000) and were synthesised by MWG (Ebersberg, Germany). Primer sequences for the target genes are listed in Table 1. Details of these analyses are presented in Fisker et al. (2013). Stratagene Brilliant® II SYBR® Green qPCR Mastermix (AH Diagnostics, Aarhus, Denmark) was used for real-time quantitative polymerase chain reaction (qPCR) conducted on a Stratagene MX3005P (AH Diagnostics, Aarhus, Denmark). Each reaction contained 5 μL of cDNA template (equivalent to 20 ng total RNA) along with 900 nM primers in a final volume of 15 μL and these reactions were run in duplicate. The amplification was performed under the following conditions: 95 °C for 10 min to activate the DNA polymerase, then 40 cycles of 95 °C for 10 s and 60 °C for 60 s. Melting curves of the raw qPCR data were inspected to confirm the presence of a single amplification product with no primer-dimers. Furthermore, all products were run on a 1% agarose gel to verify that only one PCR product was present. No major
46
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
Table 1 Gene name, gene symbol, and primer sequences used for genes investigated by real-time qPCR. Primer sequences were as the ones investigated by Fisker et al. (2013), where a detailed analysis of the identified expressed sequence tags can be found (table modified from Fisker et al. (2013)). Gene name
Symbol
Primer (5′–3′)
Amplicon size (bp)
Heat shock protein 10
hsp10
92
Heat shock protein 70
hsp70
Metallothionein
mt1
Metallothionein
mt2
Glutathione-S-transferase
Gst
Cytochrome oxidase
Cytox
F: TTCTCGAGGCAACAGTTGTG R: AACTTTATCGCCGACCTTCA F: AGCTGAGCATCGAGGAGAAG R: TCCTTGAAGTCCTCCACGTC F: TGTCGACTGCAAGTGTGTGA R: ATCCACTCTTCTCCGATCCA F: TGGCTGATGCTCTCAACACT R: GCAGGAACATGTAGACCCTTG F: TGGATTCTTCGTTGGTGACA R: ACGCGAGTAGAATCCCTTCA F: CACCATCAGGGATCAGACCT R: TGTGGTGGGCTCATGTAACT
variations were found and all qPCR products originated from the expected genes. 2.5. Data analyses and statistics Data analysis for real-time PCR (DART-PCR) (Peirson et al., 2003) was used for analysing the raw qPCR data. For every sample, DARTPCR enables calculation of threshold cycles and amplification efficiencies. Calculated efficiencies indicated around 2-fold amplification per PCR cycle for all genes. In the few cases where outliers were identified by DART-PCR, they were removed from the dataset prior to further analysis. The resulting data set was normalised using the data-driven NORMA-Gene normalisation method which does not require the use of reference genes (Heckmann et al., 2011). Data were logtransformed to optimise normality and homogeneity of variances. A mixed model with ‘copper’ and ‘freezing’ as fixed factors and ‘population’ as a random factor was used to test for the effect of copper and freezing, and their interaction, on relative normalised expression of the target genes using R (version 3.1.2). 3. Results Copper exposure had a negative effect on transcription of hsp10 and negative effect on cytox close to statistical significance (P = 0.05) whereas other examined genes were not significantly influenced by
100 80 71 127 99
copper exposure (Fig. 1 and Table 2). Freezing increased transcription levels of all tested genes (Fig. 1 and Table 2). Transcription of the genes mt1 and mt2 were two-fold and more than five-fold upregulated, respectively. Transcription of gst was also about five times higher in frozen worms. Finally, for mt1, there was a significant interaction between effects of freezing and copper exposure suggesting that transcription in the combined treatment was higher than expected from the addition of the two separate effects (Fig. 1 and Table 2). 4. Discussion Freezing of body fluids results in a drastic cellular dehydration since solutes are excluded from the growing ice leading to an increasing solute concentration of the unfrozen body water and a consequent osmotic outflux of water from cells and tissues (Zachariassen, 1985; Storey and Storey, 1996). The ongoing molecular processes are therefore taking place under challenging and potentially stressful conditions in the cell. The increased concentration of ions may perturb the conformation of proteins in the cytosol, and as a response, the cells may launch a stress response including molecular chaperones such as heat shock proteins, which will help by stabilising and re-folding the denatured proteins (Ananthan et al., 1986; Feder and Hofmann, 1999). High levels of ROS can in parallel induce denaturation of proteins further elevating the need for molecular chaperones. We observed that transcription of hsp10 and hsp70 was upregulated due to freezing which is an indication
Fig. 1. Transcription of selected target genes (see Table 1 for codes and Table 2 for statistics) in the earthworm Dendrobaena octaedra exposed to control soil or copper-spiked soil (160 mg Cu kg−1 dry soil), and subsequently kept at +2 °C (control temperature) or frozen at −2 °C. All values (mean ± sem) are relative to controls kept at +2 °C (Cu 0; +2 °C).
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
47
Table 2 Nested two-way ANOVA analysis of gene expression (see Table 1 for codes) in Dendrobaena octaedra exposed to either control soil or copper-spiked soil (160 mg Cu kg−1 dry soil), and subsequently either kept at +2 °C (control temperature) or frozen at −2 °C. The effects of copper and freezing were tested including interaction between the two stressors (P-values; df = 1). Source
mt1
mt2
gst
hsp10
hsp70
cytox
Copper Freezing Copper × freezing
0.128 1.4 × 10−6 0.033
0.094 1.7 × 10−7 0.174
0.388 1.05 × 10−11 0.316
0.003 0.009 0.184
0.061 1.3 × 10−9 0.053
0.050 2.55 × 10−5 0.131
of cellular damages such as protein denaturation. Low temperature per se can potentially cause proteins to lose their folded structure (Lopez et al., 2008); however, the temperature lowering from +2 °C to freezing at −2 °C used in the present experiment seems unlikely to have such effects. We suggest that the induction of heat shock proteins is rather due to the aforementioned changes in osmolyte concentration upon freezing of body fluids. In line with this interpretation, several studies have shown that freezing (in freeze-tolerant invertebrates) can induce heat shock proteins (Teets et al., 2011; Zhang et al., 2011) whereas freezeavoiding or chill-susceptible species do not have elevated levels of heat shock proteins during cold exposure (i.e. without ice formation), but often upon recovery from cold exposure (Sejerkilde et al., 2003; Nielsen et al., 2005; Kostal and Tollarová-Borovanská, 2009; Sørensen et al., 2010; Hayward et al., 2014). The transcription of a gene coding for a cytochrome oxidase (cytox) seemed to be downregulated by copper in the present experiment, but not with convincing statistical significance. Similarly, Fisker et al. (2013) found that this gene was not influenced by copper. The copper concentration used in the present study was not causing decreased growth or reproduction rates as compared to control soil (Bindesbøl et al., 2007), so it may be concluded that transcription of cytox is not responsive to the copper concentrations used here. Bundy et al. (2008) studied gene expression in the earthworm Lumbricus rubellus exposed to copper and observed that most cytochrome oxidases involved in the mitochondrial electron transport chain were upregulated and that an increased metabolism of stored carbohydrates occurred as a consequence of copper exposure. The increased expression of cytochrome oxidases could be a response of the organism facilitating oxidative phosphorylation in the metabolism of storage carbohydrates (Bundy et al., 2008). Upon freezing, D. octaedra rapidly catabolises glycogen to glucose, which is then available as a cryoprotectant and as fuel for metabolism (Rasmussen and Holmstrup, 2002; Calderon et al., 2009). We observed that the transcription of cytox in frozen D. octaedra was upregulated, and although we have only studied one gene of many cytochrome oxidases, this response could also be a sign of an increased expression of genes coding for enzymes of the electron transport chain needed for optimal exploitation of available glucose. The two metallothionein genes that have been identified in D. octaedra are homologous to metallothioneins identified in other earthworm species (Spurgeon et al., 2004; Liang et al., 2011). Perhaps surprisingly, we did not observe any induction of transcription of these genes in copper-exposed worms even though worms clearly accumulate copper in significant concentrations when exposed to this or other types of copper-contaminated soil (Fisker et al., 2011a,2011b). Previous investigations show that mt1 is relatively unresponsive to copper whereas mt2 was significantly upregulated after 7 days of exposure to the same concentrations as used in the present study (Fisker et al., 2013). Other authors have also found that metallothioneins of earthworms are not as responsive to copper as to e.g. cadmium (Spurgeon et al., 2004). Another reason for this seeming unresponsiveness could be that body concentration of copper at the time of sampling (i.e. after 6 weeks) had reached steady state and that an early upregulation of mt1 and mt2 had occurred, but that gene transcription at the time of sampling had resumed to normal (Fisker et al., 2013). Interestingly, transcription of both metallothionein genes was significantly upregulated in frozen earthworms. Two different interpretations of
this result may be suggested. Firstly, freeze-induced dehydration of cells is expected to rapidly increase the concentration of free metal ions (e.g. Cd, Cu, and Zn) to potentially toxic concentrations which could induce the transcription of metallothionein genes. With a typical melting point (MP) of earthworm body fluids around −0.4 °C (Holmstrup, 1992), we may roughly estimate that about 80% of freezeable body water is frozen at −2 °C (the fraction of ice, F = 1 − MP/T, where T is ambient temperature). Accordingly, concentrations of free metal ions would increase fivefold and thus perhaps reach toxic levels. Trautsch et al. (2011) found that ice nucleating lipoproteins of freeze-tolerant beetles (Phyto depressus) had 100-fold greater capacity to bind metals (Cu2+, Cd2+, and Zn2+) than albumin and proposed that lipoproteins may aid in detoxification of freezing-induced elevated concentrations of such metal ions during overwintering. These authors noted that the concentrations of lipoproteins of P. depressus were three to four orders of magnitude higher than needed for effectively securing protective freezing at high subzero temperatures and therefore suggested that the lipoproteins had other functions in addition to ice nucleation (Trautsch et al., 2011). Metallothioneins may have a similar role as proposed for ice nucleating lipoproteins in P. depressus. In that case, we expected the combination of freezing and copper exposure to result in a greater upregulation of metallothionein genes than freezing alone would do. In fact, we did observe a significant interaction between freezing and copper exposure resulting in a higher than additive transcription of mt1 in the combined treatment, which supports the hypothesis that freeze-induced elevation of free Cu2+ could be the reason for an increased transcription of metallothionein genes. Although not statistically significant (i.e. no significant interaction term), the same trend was observed for mt2. An alternative, but not mutually exclusive, explanation for freezeinduced elevated transcription of metallothionein genes could be related to hypoxia. As described in the introduction to this study, freezing of body fluids inevitably produces hypoxia of tissues due to the reduced diffusive transport of oxygen when ice is present in the earthworm body. In line with this notion, Calderon et al. (2009) reported that D. octaedra frozen at −2 °C accumulated alanine, which is an indicator of anaerobic metabolism (Storey et al., 2007). If anoxic conditions led to formation of excess ROS, there would be a need for cellular antioxidant agents. Glutathione is an important antioxidant that may be depleted due to oxidative stress (Hermes-Lima, 2004). This, in turn, is related to transcription rate of genes coding for glutathione-S-transferase, which indeed was significantly upregulated in frozen worms. However, metallothioneins can also act as antioxidant agents during hypoxic conditions (Viarengo et al., 1999). Hence, the increased gene transcription of mt1 and mt2 of frozen D. octaedra could be interpreted as a protective response to freezeinduced hypoxia. Only one previous study has indicated this mechanism of metallothionein in a freeze-tolerant invertebrate, the marine gastropod Littorina littorea (English and Storey, 2003). Similar to the observations of the present study, these authors observed a significant upregulation of metallothionein during a 24 h freeze and suggested that metallothionein served as an antioxidant scavenging ROS by thiolate oxidation of the cysteine residues (English and Storey, 2003). In conclusion, the present study has shown that transcription of two metallothionein genes is significantly upregulated in D. octaedra during freezing of body fluids. This cellular response to freezing is likely adaptive and possibly provides protection against freeze-induced elevated metal concentrations in the cytosol and excess ROS levels due to hypoxia during freezing.
48
K.V. Fisker et al. / Comparative Biochemistry and Physiology, Part C 179 (2016) 44–48
Acknowledgments This study was supported by a Sapere Aude DFF-Starting grant from The Danish Council for Independent Research | Natural Sciences (JGS). References Ananthan, J., Goldberg, A., Voellmy, R., 1986. Abnormal proteins serve as eukaryotic stress signals and trigger the activation of heat shock genes. Science 232, 522–524. Bengtsson, G., Rundgren, S., 1988. The Gusum case: a brass mill and the distribution of soil Collembola. Can. J. Zool. 66, 1518–1526. Bengtsson, G., Nordström, S., Rundgren, S., 1983. Population density and tissue metal concentration of lumbricids in forest soils near a brass mill. Environ. Pollut. 30, 87–108. Berman, D., Meshcheryakova, E., Alfimov, A., Leirkh, A., 2002. Distribution of the earthworms Dendrobaena octaedra (Lumbricidae, Oligochaeta) in the northern holarctic is restricted by its insufficient freeze tolerance. Zool. J. 81, 1210–1221. Bindesbøl, A.M., Holmstrup, M., Damgaard, C., Bayley, M., 2005. Stress synergy between environmentally realistic levels of copper and frost in the earthworm Dendrobaena octaedra. Environ. Toxicol. Chem. 24, 1462–1467. Bindesbøl, A.M., Bayley, M., Damgaard, C., Holmstrup, M., 2007. Life-history traits and population growth rate in the laboratory of the earthworm Dendrobaena octaedra cultured in copper-contaminated soil. Appl. Soil Ecol. 35, 46–56. Bindesbøl, A.M., Bayley, M., Damgaard, C., Holmstrup, M., 2009. Impacts of heavy metals, polyaromatic hydrocarbons and pesticides on freeze tolerance of the earthworm Dendrobaena octaedra. Environ. Toxicol. Chem. 28, 2341–2347. Bundy, J.G., Sidhu, J.K., Rana, F., Spurgeon, D.J., Svendsen, C., Wren, J.F., Sturzenbaum, S.R., Morgan, A.J., Kille, P., 2008. 'Systems toxicology' approach identifies coordinated metabolic responses to copper in a terrestrial non-model invertebrate, the earthworm Lumbricus rubellus. BMC Biol. 6. Calderon, S., Holmstrup, M., Westh, P., Overgaard, J., 2009. Dual roles of glucose in the freeze-tolerant earthworm Dendrobaena octaedra: cryoprotection and fuel for metabolism. J. Exp. Biol. 212, 859–866. Dallinger, R., Berger, B., Gruber, C., Hunziker, P., Sturzenbaum, S., 2000. Metallothioneins in terrestrial invertebrates: Structural aspects, biological significance and implications for their use as biomarkers. Cell. Mol. Biol. 46, 331–346. English, T.E., Storey, K.B., 2003. Freezing and anoxia stresses induce expression of metallothionein in the foot muscle and hepatopancreas of the marine gastropod Littorina littorea. J. Exp. Biol. 206, 2517–2524. Feder, M., Hofmann, G., 1999. Heat shock proteins, molecular chaperones, and the stress response. Annu. Rev. Physiol. 61, 243–282. Fisker, K.V., Sorensen, J.G., Damgaard, C., Pedersen, K.L., Holmstrup, M., 2011a. Genetic adaptation of earthworms to copper pollution: is adaptation associated with fitness costs in Dendrobaena octaedra? Ecotoxicology 20, 563–573. Fisker, K.V., Sørensen, J.G., Holmstrup, M., 2011b. No costs on freeze tolerance in genetically copper adapted earthworm populations (Dendrobaena octaedra). Comp. Biochem. Physiol. C 154, 204–207. Fisker, K.V., Holmstrup, M., Sorensen, J.G., 2013. Variation in metallothionein gene expression is associated with adaptation to copper in the earthworm Dendrobaena octaedra. Comp. Biochem. Physiol., C:Toxicol. Pharmacol. 157, 220–226. Hayward, S.A.L., Manso, B., Cossins, A.R., 2014. Molecular basis of chill resistance adaptations in poikilothermic animals. J. Exp. Biol. 217, 6–15. Heckmann, L.H., Sørensen, P.B., Krogh, P.H., Sørensen, J.G., 2011. NORMA-Gene: a simple and robust method for qPCR normalisation based on target gene data. BMC Bioinf. 12. Hermes-Lima, M., 2004. Oxygen in biology and biochemistry: Role of free radicals. In: Storey, K.B. (Ed.), Functional Metabolism: Regulation and Adaptation. John Wiley and Sons, Inc., Hoboken, pp. 319–368. Hermes-Lima, M., Storey, J.M., Storey, K.B., 1998. Antioxidant defenses and metabolic depression. The hypothesis of preparation for oxidative stress in land snails. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 120, 437–448. Holmstrup, M., 1992. Cold hardiness strategy in cocoons of the lumbricid earthworm Dendrobaena octaedra (Savigny). Comp. Biochem. Physiol. 102A, 49–54. Holmstrup, M., Overgaard, J., Bindesbøl, A.M., Pertoldi, C., Bayley, M., 2007a. Adaptations to overwintering in the earthworm Dendrobaena octaedra: genetic differences in glucose mobilisation and freeze tolerance. Soil Biol. Biochem. 39, 2640–2650. Holmstrup, M., Sørensen, L.I., Bindesbøl, A.M., Hedlund, K., 2007b. Cold acclimation and lipid composition in the earthworm Dendrobaena octaedra. Comp. Biochem. Physiol. A 147, 911–919. Holmstrup, M., Bindesbøl, A.M., Oostingh, G.J., Duschl, A., Scheil, V., Köhler, H.R., Loureiro, S., Soares, A., Ferreira, A.L.G., Kienle, C., Gerhardt, A., Laskowski, R., Kramarz, P.E., Bayley, M., Svendsen, C., Spurgeon, D.J., 2010. Interactions between effects of environmental chemicals and natural stressors: a review. Sci. Total Environ. 408, 3746–3762. Hooper, M.J., Ankley, G.T., Cristol, D.A., Maryoung, L.A., Noyes, P.D., Pinkerton, K.E., 2013. Interactions between chemical and climate stressors: a role for mechanistic toxicology in assessing climate change risks. Environ. Toxicol. Chem. 32, 32–48. Joanisse, D.R., Storey, K.B., 1996. Oxidative stress and antioxidants in overwintering larvae of cold-hardy goldenrod gall insects. J. Exp. Biol. 199, 1483–1491.
Kostal, V., Tollarová-Borovanská, M., 2009. The 70 kDa heat shock protein assists during the repair of chilling injury in the insect, Pyrrhocoris apterus. PLoS ONE 4 (2), e4546. Laskowski, R., Bednarska, A.J., Kramarz, P.E., Loureiro, S., Scheil, V., Kudlek, J., Holmstrup, M., 2010. Interactions between toxic chemicals and natural environmental factors – a meta-analysis and case studies. Sci. Total Environ. 408, 3763–3774. Liang, S.H., Chen, S.C., Chen, C.Y., Kao, C.M., Yang, J.I., Shieh, B.S., Chen, J.H., Chen, C.H., 2011. Cadmium-induced earthworm metallothionein-2 is associated with metal accumulation and counteracts oxidative stress. Pedobiologia 54, 333–340. Lopez, C.F., Darst, R.K., Rossky, P.J., 2008. Mechanistic elements of protein cold denaturation. J. Phys. Chem. B 112, 5961–5967. Nielsen, M.M., Overgaard, J., Sørensen, J.G., Holmstrup, M., Justesen, J., Loeschcke, V., 2005. Role of HSF activation for resistance to heat, cold and high-temperature knock-down. J. Insect Physiol. 51, 1320–1329. Noyes, P.D., McElwee, M.K., Miller, H.D., Clark, B.W., Van Tiem, L.A., Walcott, K.C., Erwin, K.N., Levin, E.D., 2009. The toxicology of climate change: environmental contaminants in a warming world. Environ. Int. 35, 971–986. Peirson, S.N., Butler, J.N., Foster, R.G., 2003. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res. 31, e73. Rasmussen, L., Holmstrup, M., 2002. Geographic variation of freeze-tolerance in the earthworm Dendrobaena octaedra. J. Comp. Physiol. B. 172, 691–698. Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386. Sejerkilde, M., Sørensen, J.G., Loeschcke, V., 2003. Effects of cold- and heat hardening on thermal resistance in Drosophila melanogaster. J. Insect Physiol. 49, 719–726. Sørensen, J.G., Heckmann, L.H., Holmstrup, M., 2010. Temporal gene expression profiles in a palaearctic springtail as induced by desiccation, cold exposure and during recovery. Funct. Ecol. 24, 838–846. Spurgeon, D.J., Hopkin, S.P., 1999. Seasonal variation in the abundance, biomass and biodiversity of earthworms in soils contaminated with metal emissions from a primary smelting works. J. Appl. Ecol. 36, 173–183. Spurgeon, D.J., Sturzenbaum, S.R., Svendsen, C., Hankard, P.K., Morgan, A.J., Weeks, J.M., Kille, P., 2004. Toxicological, cellular and gene expression responses in earthworms exposed to copper and cadmium. Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol. 138, 11–21. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal-ions. Free Radic. Biol. Med. 18, 321–336. Storey, K., Storey, J., 1990. Facultative metabolic rate depression: molecular regulation and biochemical adaptation in anaerobiosis, hibernation and estivation. Quat. Rev. Biol. 65, 145–174. Storey, K.B., Storey, J.M., 1996. Natural freezing survival in animals. Annu. Rev. Ecol. Syst. 27, 365–386. Storey, K.B., Storey, J.M., Churchill, T.A., 2007. Freezing and anoxia tolerance of slugs: a metabolic perspective. J. Comp. Physiol. B-Biochem. Syst. Environ. Physiol. 177, 833–840. Storey, K.B., Lant, B., Anozie, O.O., Storey, J.M., 2013. Metabolic mechanisms for anoxia tolerance and freezing survival in the intertidal gastropod, Littorina littorea. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 165, 448–459. Stürzenbaum, S.R., Kille, P., Morgan, A.J., 1998. The identification, cloning and characterization of earthworm metallothionein. FEBS Lett. 431, 437–442. Stürzenbaum, S.R., Georgiev, O., Morgan, A.J., Kille, P., 2004. Cadmium detoxification in earthworms: from genes to cells. Environ. Sci. Technol. 38, 6283–6289. Teets, N.M., Kawarasaki, Y., Lee, R.E., Denlinger, D.L., 2011. Survival and energetic costs of repeated cold exposure in the Antarctic midge, Belgica antarctica: a comparison between frozen and supercooled larvae. J. Exp. Biol. 214, 806–814. Tosza, E., Dumnicka, E., Niklinska, M., Rozen, A., 2010. Enchytraeid and earthworm communities along a pollution gradient near Olkusz (southern Poland). Eur. J. Soil Biol. 46, 218–224. Trautsch, J., Rosseland, B.O., Pedersen, S.A., Kristiansen, E., Zachariassen, K.E., 2011. Do ice nucleating lipoproteins protect frozen insects against toxic chemical agents? J. Insect Physiol. 57, 1123–1126. Valko, M., Morris, H., Cronin, M.T.D., 2005. Metals, toxicity and oxidative stress. Curr. Med. Chem. 12, 1161–1208. Viarengo, A., Burlando, B., Cavaletto, M., Marchi, B., Ponzano, E., Blasco, J., 1999. Role of metallothionein against oxidative stress in the mussel Mytilus galloprovincialis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 277, R1612–R1619. Vijver, M.G., Vink, J.P.M., Miermans, C.J.H., van Gestel, C.A.M., 2003. Oral sealing using glue: a new method to distinguish between intestinal and dermal uptake of metals in earthworms. Soil Biol. Biochem. 35, 125–132. Vulpe, C.D., Packman, S., 1995. Cellular copper transport. In: McCormick, D.B. (Ed.)Annual Review of Nutrition, pp. 293–322. Zachariassen, K.E., 1985. Physiology of cold tolerance in insects. Physiol. Rev. 65, 799–831. Zhang, G., Storey, J.M., Storey, K.B., 2011. Chaperone proteins and winter survival by a freeze tolerant insect. J. Insect Physiol. 57, 1115–1122.