- Email: [email protected]
FSH receptor mRNA is expressed stage-dependently during rat spermatogenesis
Molecular and Cellular Endocrinology, 0 1992 Elsevier Scientific Publishers
MOLCEL
R45
84 t 1992) R45- R49 Ireland. Ltd. OX-7207/92/$05.00
02758
Rapid Paper
FSH receptor mRNA is expressed stage-dependently during rat spermatogenesis S. Kliesch ‘, T.-L. Penttili
‘, J. Gromoll “, P.T.K. Saunders and M. Parvinen h
‘, E. Nieschlag
a
” Institute of Reproducticv Medicine, Uniwrsity of Miinstrr, Miinstrr, Germany, ” Departrnrnt ofAnatomy,Uni~vrsity of Turku, Turku, Finland, and ’ MRC. Centre for Reproductil,e Biology, Edinburgh, &otland, UK (Received
Key words:
Follicle-stimulating
hormone
receptor
3 February
mRNA:
1992; accepted
Hybridization,
7 February
in situ; Sertoli
1992)
cell; Spermatogenesis;
(Rat testis)
Summary
/n situ hybridization was performed on testicular tissue from adult male Sprague-Dawley rats using cRNA antisense and sense probe of the monkey FSH receptor (FSHR) cDNA to determine the cellular site of synthesis, and possible stage-dependent expression of FSHR mRNA during the cycle of the seminiferous epithelium. Using antisense probe specific binding was first detected in Sertoli cells just prior to sperm release at stage VIII. The strongest specific hybridization signal was found during stages IX and X followed by a decrease of signal intensity in stages XI-XII. No specific binding was found in stages XIII-VII. The sequence of events with the maximum expression of FSHR mRNA in Sertoli cells in stages IX and X, before FSH-binding and FSH-stimulated CAMP production reach maximum values, coincides with a new wave of spermatogenesis and indicates an effect of FSH and spermatogenic cells on the regulation of FSHR mRNA expression.
Introduction In the testis Sertoli cells are the main targets for FSH. Its action is mediated by a G-coupled receptor located on the surface of Sertoli cells (Sprengel et al., 1990). FSH is essential for initiation of spermatogenesis as well as for quantitatively normal spermatogenesis (Matsumoto et al., 1986; Bartlett et al., 1989; Niklowitz et al., 1989). During recent years FSH-binding and CAMP response studies on microdissected seminiferous
Correspondence to: Prof. Dr. E. Nieschlag, Reproductive Medicine, University of Miinster, Str. 107, D-4400 Miinster, Germany.
Institute of Steinfurter
tubule sections have revealed a stage-dependent change of FSH receptor levels during the spermatogenic cycle of the rat (Parvinen et al., 1980; Kangasniemi et al., 1990a, b). By Northern blot analysis FSH receptor mRNA was shown to be present primarily in Sertoli cells without any apparent change in the amount of expression in testes from lo- to 60-day-old rats and in cultures of Sertoli cells from 20-day-old or adult rats (Heckert and Griswold, 1991). Until now the morphological localization of FSH receptor mRNA or its stage-dependent expression have not been demonstrated. A cRNA probe prepared from the extracellular domain of the monkey FSH receptor was used to perform in situ hybridization in testicular tis-
R46
sue to examine (1) the cellular localization of FSH receptor mRNA and (2) its stage-specific expression in seminiferous epithelium from the adult rat.
Materials
and methods
Testicular tissue. Testes from three adult male Sprague-Dawley rats were fixed in 4% paraformaldehyde plus 0.5% glutardialdehyde or 2% paraformaldehyde plus 0.25% glutardialdehyde in 0.1 M phosphate-buffered saline (pH 7.41, dehydrated in increasing ethanol concentrations and embedded in paraffin. 5 pm sections were placed on either poly-L-lysine coated (Huang et al., 1983) or Denhardt-treated slides (Denhardt, 1966). Sections were dried at 37°C overnight, dewaxed, rehydrated and used for in situ hybridization. FSH receptor probe. Total RNA from monkey testis tissue was isolated using a guanidium method described elsewhere (Chromczynski and Sacchi, 1987). Two specific oligonucleotides were designed, based on the sequence of the human FSH receptor (Minegish et al., 1991), encoding part of the extracellular domain of the receptor, with the addition of a EcoRI and Hind111 restriction site, respectively: TCGAATTCCATCGGATCTGTCACTGCTC; TCGAAGCTTAATGACTGGTCCAGAGGCTC. First-strand cDNA was prepared by reverse transcription of 5 pg total testis RNA, using the 3’ oligonucleotide as primer. PCR amplification was performed in two stages: (1) 5 cycles with 1 min of denaturation at 94°C 1 min of annealing at 52°C and 2 min extension at 72°C. (2) 40 cycles with 1 min at 94°C 1 min at 65°C and 1.5 min at 72°C. Digestion of the resulting 625 bp fragment with EcoRI and Hind111 led to two fragments, because of an internal restriction site for HindIII, with a size of 118 bp and 503 bp. The 118 bp fragment was subcloned into the pBluescript plasmid (Stratagene, Heidelberg, Germany) and sequenced in both directions (Pharmacia, Uppsala, Sweden) using the dideoxy method (Sanger et al., 1977). It was used as a template for in vitro transcription (Boehringer, Mannheim, Germany) where T7 gave rise to antisense cRNA and T3 to sense cRNA. The specific activity of ([3”S]CTPI-
labelled sense and antisense transcripts was approximately IO’ cpm/Fg probe. In situ hybridization. Prehybridization and hybridization treatments were performed according to Ausubel et al. (1985) with some modification. After treating sections with 0.2 N HCI and heat denaturation in 2 X SSC at 70°C sections were fixed in 4% paraformaldehyde followed by deproteinization for 15 min using 10 pg/ml proteinase K (Sigma, Deisenhofen, Germany). After postfixation sections were acetylated in 0.25% acetic anhydride in 0.1 M triethanolamine (v/v) for 10 min, dehydrated and dried. Hybridization was performed for 5 h at 50°C in a humidified chamber with approximately 1 x 10’ cpm/pl of sense or antisense RNA probe in 20 ~1 hybridization buffer containing 50% formamide (v/v), 10% dextran sulphate, 20 mM Tris-HCI (pH 81, 0.3 M NaCI, 5 mM EDTA, 1 X Denhardt’s solution and 500 Fug E. cofi tRNA/ml. Hybridization was followed by washing at 50°C ribonuclease A (RNase A, 10 pg/ml) (Sigma, Deisenhofen, Germany) digestion for 30 min at 37°C consecutive washing with 2 x SSC at 50°C and dehydration. Sections were air dried. Autoradiography was performed by dipping slides into Kodak NTB-3 emulsion, with exposure for 17-25 days before development and counterstaining with hematoxylin. Two in situ hybridization procedures were performed. Slides were investigated in a Zeiss Axioskop using brightfield and epipolarisation optic systems and photographed. The stages of the seminiferous cpithelium were identified according to Leblond and Clermont (1952). Results Sequence analysis of the 118 bp monkey FSH receptor fragment of the extracellular domain revealed 86% homology with the corresponding sequence of the rat FSH receptor but only approximately 20% with the rat LH receptor. Specific hybridization signals were only seen on tissue sections when using FSH receptor cRNA antisense probe. FSH receptor mRNA expression in normal adult rat testes was localized in Sertoli cell cytoplasm and was first detectable just prior to sperm release at stage VIII of the cycle. Strong hybridization signals were found at stages IX and
Figs. 1-6. Bright-field and epithelium of the rat testis (l-2) Stage IX. Expression signal above background.
corresponding epipolarisation photographs of FSH receptor mRNA expression in the seminiferous at different stages of the cycle (~3601. (I-4) III SI~U hybridization with FSH receptor antisense probe. of FSH receptor mRNA to Sertoli cells (open arrow). 13-4) Early stage of the cycle. No hybridization (5-6) in siru hybridization with FSH receptor sense probe. Stage IX. No specific binding above background.
R4X
X (Figs. 1 and 2). FSH receptor mRNA was mainly detected in the basal parts of the epithelium around the Sertoli cell nucleus. A decrease in the accumulation of hybridization grains was observed during stages XI-XII. In stages XIIII-VII there was no defined localization of specific binding in comparison to background (Figs. 3 and 4). All tissue sections hybridized with the FSH receptor cRNA sense probe showed a homogeneous distribution of silver grains that were considered as backgrounds (Figs. 5 and 6). Discussion In adult rat testicular tissue the expression of FSH receptor mRNA was localized to Sertoli cells. It seems to be highest at only a few stages of the seminiferous epithelial cycle, namely when the new wave of spermatogenesis starts (stages VIII-X). At the same time spermatids elongate (states IX-XIII), while spermatogonia enter their first mitoses (stages IX-XII) (Leblond and Clermont, 1952) thus possibly indicating regulatory functions of germ cells on the FSH or FSH receptor gene. By Northern blot analysis of FSH receptor mRNA expression, Heckert and Griswold (1991) recently found levels to be highest during stages XIII-II with a decrease to a minimum level at stages VII-VIII of the cycle in stage-synchronized testes of vitamin A deficient rats. The diffcrence in results may be due to the more precise localization and morphological identification of defined stages by in situ hybridization. Moreover results found in vitamin A deficient rats may be different from normal adult rats due to the animal model with a predominance of certain stages possibly accompanied by still undefined paracrine mechanisms and unknown metabolic changes. In CAMP response studies using microdissccted testicular tubules from adult rats a significantly lower basal and FSH-stimulated production of CAMP was shown during stages VII-XII in comparison to stages XIII-I-VI (Kangasniemi ct al., 1990a). Measurement of FSH binding in seminiferous tubules from testes of adult rats revealed low values in stages VI and VII and a 3.5fold increase of FSH binding in stages XIII-I (Kangasniemi et al., 1990b). In rlitro FSH binding
and FSH responsiveness are highest in the stages XIII-VI, while in II&Q our findings show that FSH receptor mRNA expression in Sertoli cells is strongest in stages IX and X. Our results indicate high expression of FSH receptor mRNA in Sertoli cells before FSH binding and CAMP production reach their maximum. These results suggest that FSH is involved in the initiation of a new wave of spermatogenesis. The discrepancies between results obtained by in 13itro and in rirw studies make further careful elucidation of FSH receptor gene regulation under defined hormonal conditions necessary. Our observations demonstrate the localization of FSH receptor mRNA to Sertoli cells and suggest that FSH and spermatogenic cells are involved in the regulation of FSH receptor mRNA expression at different stages of the spermatogenic cycle in the rat.
Acknowledgements This study was supported by the Deutsche Forschungsgemeinschaft DFG (Ni 130/l l), the Academy of Finland, and the Sigrid Juselius Foundation. We would like to thank S. Nieschlag, MA for language editing.
References Ausubel, F.M., Brent, R., Kingston. R.E., Moore. D.D.. Seidman, J.G., Smith, J.A. and Struhl, K. (1985) Current Protocols in Molecular Biology. Vol. 2. pp. 14.3.1-14.2.2. Bartlett, J.M.S., Weinbauer, G.F. and Nieschlag, E. (I9H9) J. Endocrinol. 121, 49-58. Chomczynski. P. and Sacchi, N. (19X7) Anat. Biochem. 162, 156m 159. Denhardt. D.T. (1966) Biochem. Biophys. Res. Commun. 23, 641-646. Heckert, L.L. and Griswold, M.D. (1991) Mol. Endocrinol. S. 670-677. Huang, W.M., Gibson, S.J., Facer, P., Gu, J. and Polak, J.M. (1983) Histochemistry 77, 275-279. Kangasniemi, M., Kaipia, A., Toppari, J.. Mali, P., Huhtaniemi, I. and Patvinen. M. (1990a) Anat. Rec. 227. 32-36. Kangasniemi, M., Kaipia, A., Toppari, J., Perheentupa, A.. Huhtaniemi. I. and Parvinen, M. (1990bI J. Androl. I I. 3366343. Leblond, C.P. and Clermont, Y. (1952) Ann. NY Acad. Sci. 5s. 548-573.
R49 Matsumoto, A.M., Karpas, A.E. and Bremner, W.J. (1986) J. Clin. Endocrinol. Metab. 62, 1184-1192. Minegish, T., Nakamura, K., Takahura, Y., Ibuki. Y. and Igarashi, M. (1991) Biochem. Biophys. Res. Commun. 3, 1125-l 130. Niklowitz. P., Khan, S.A., Bergmann, M., Hoffmann, K. and Nieschlag, E. (1989) Biol. Reprod. 41, 871-880. Paninen, M., Marana, R., Robertson, D.M., Hansson, V. and Kit&n, E.M. (1980) in Testicular Development, Structure
and Function (Steinberger, A. and Steinberger, E., eds.), pp. 425-432, Raven Press, New York. Reichert, L.E. and Dattatreyamurty, B. (1989) Biol. Reprod. 40, 13-26. Sanger. F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. Sprengel, R., Braun, T., Nikolics, K., Segaloff, D.L. and Seeburg. P. (1990) Mol. Endocrinol. 4. 5255530.
MOLCEL
R45
84 t 1992) R45- R49 Ireland. Ltd. OX-7207/92/$05.00
02758
Rapid Paper
FSH receptor mRNA is expressed stage-dependently during rat spermatogenesis S. Kliesch ‘, T.-L. Penttili
‘, J. Gromoll “, P.T.K. Saunders and M. Parvinen h
‘, E. Nieschlag
a
” Institute of Reproducticv Medicine, Uniwrsity of Miinstrr, Miinstrr, Germany, ” Departrnrnt ofAnatomy,Uni~vrsity of Turku, Turku, Finland, and ’ MRC. Centre for Reproductil,e Biology, Edinburgh, &otland, UK (Received
Key words:
Follicle-stimulating
hormone
receptor
3 February
mRNA:
1992; accepted
Hybridization,
7 February
in situ; Sertoli
1992)
cell; Spermatogenesis;
(Rat testis)
Summary
/n situ hybridization was performed on testicular tissue from adult male Sprague-Dawley rats using cRNA antisense and sense probe of the monkey FSH receptor (FSHR) cDNA to determine the cellular site of synthesis, and possible stage-dependent expression of FSHR mRNA during the cycle of the seminiferous epithelium. Using antisense probe specific binding was first detected in Sertoli cells just prior to sperm release at stage VIII. The strongest specific hybridization signal was found during stages IX and X followed by a decrease of signal intensity in stages XI-XII. No specific binding was found in stages XIII-VII. The sequence of events with the maximum expression of FSHR mRNA in Sertoli cells in stages IX and X, before FSH-binding and FSH-stimulated CAMP production reach maximum values, coincides with a new wave of spermatogenesis and indicates an effect of FSH and spermatogenic cells on the regulation of FSHR mRNA expression.
Introduction In the testis Sertoli cells are the main targets for FSH. Its action is mediated by a G-coupled receptor located on the surface of Sertoli cells (Sprengel et al., 1990). FSH is essential for initiation of spermatogenesis as well as for quantitatively normal spermatogenesis (Matsumoto et al., 1986; Bartlett et al., 1989; Niklowitz et al., 1989). During recent years FSH-binding and CAMP response studies on microdissected seminiferous
Correspondence to: Prof. Dr. E. Nieschlag, Reproductive Medicine, University of Miinster, Str. 107, D-4400 Miinster, Germany.
Institute of Steinfurter
tubule sections have revealed a stage-dependent change of FSH receptor levels during the spermatogenic cycle of the rat (Parvinen et al., 1980; Kangasniemi et al., 1990a, b). By Northern blot analysis FSH receptor mRNA was shown to be present primarily in Sertoli cells without any apparent change in the amount of expression in testes from lo- to 60-day-old rats and in cultures of Sertoli cells from 20-day-old or adult rats (Heckert and Griswold, 1991). Until now the morphological localization of FSH receptor mRNA or its stage-dependent expression have not been demonstrated. A cRNA probe prepared from the extracellular domain of the monkey FSH receptor was used to perform in situ hybridization in testicular tis-
R46
sue to examine (1) the cellular localization of FSH receptor mRNA and (2) its stage-specific expression in seminiferous epithelium from the adult rat.
Materials
and methods
Testicular tissue. Testes from three adult male Sprague-Dawley rats were fixed in 4% paraformaldehyde plus 0.5% glutardialdehyde or 2% paraformaldehyde plus 0.25% glutardialdehyde in 0.1 M phosphate-buffered saline (pH 7.41, dehydrated in increasing ethanol concentrations and embedded in paraffin. 5 pm sections were placed on either poly-L-lysine coated (Huang et al., 1983) or Denhardt-treated slides (Denhardt, 1966). Sections were dried at 37°C overnight, dewaxed, rehydrated and used for in situ hybridization. FSH receptor probe. Total RNA from monkey testis tissue was isolated using a guanidium method described elsewhere (Chromczynski and Sacchi, 1987). Two specific oligonucleotides were designed, based on the sequence of the human FSH receptor (Minegish et al., 1991), encoding part of the extracellular domain of the receptor, with the addition of a EcoRI and Hind111 restriction site, respectively: TCGAATTCCATCGGATCTGTCACTGCTC; TCGAAGCTTAATGACTGGTCCAGAGGCTC. First-strand cDNA was prepared by reverse transcription of 5 pg total testis RNA, using the 3’ oligonucleotide as primer. PCR amplification was performed in two stages: (1) 5 cycles with 1 min of denaturation at 94°C 1 min of annealing at 52°C and 2 min extension at 72°C. (2) 40 cycles with 1 min at 94°C 1 min at 65°C and 1.5 min at 72°C. Digestion of the resulting 625 bp fragment with EcoRI and Hind111 led to two fragments, because of an internal restriction site for HindIII, with a size of 118 bp and 503 bp. The 118 bp fragment was subcloned into the pBluescript plasmid (Stratagene, Heidelberg, Germany) and sequenced in both directions (Pharmacia, Uppsala, Sweden) using the dideoxy method (Sanger et al., 1977). It was used as a template for in vitro transcription (Boehringer, Mannheim, Germany) where T7 gave rise to antisense cRNA and T3 to sense cRNA. The specific activity of ([3”S]CTPI-
labelled sense and antisense transcripts was approximately IO’ cpm/Fg probe. In situ hybridization. Prehybridization and hybridization treatments were performed according to Ausubel et al. (1985) with some modification. After treating sections with 0.2 N HCI and heat denaturation in 2 X SSC at 70°C sections were fixed in 4% paraformaldehyde followed by deproteinization for 15 min using 10 pg/ml proteinase K (Sigma, Deisenhofen, Germany). After postfixation sections were acetylated in 0.25% acetic anhydride in 0.1 M triethanolamine (v/v) for 10 min, dehydrated and dried. Hybridization was performed for 5 h at 50°C in a humidified chamber with approximately 1 x 10’ cpm/pl of sense or antisense RNA probe in 20 ~1 hybridization buffer containing 50% formamide (v/v), 10% dextran sulphate, 20 mM Tris-HCI (pH 81, 0.3 M NaCI, 5 mM EDTA, 1 X Denhardt’s solution and 500 Fug E. cofi tRNA/ml. Hybridization was followed by washing at 50°C ribonuclease A (RNase A, 10 pg/ml) (Sigma, Deisenhofen, Germany) digestion for 30 min at 37°C consecutive washing with 2 x SSC at 50°C and dehydration. Sections were air dried. Autoradiography was performed by dipping slides into Kodak NTB-3 emulsion, with exposure for 17-25 days before development and counterstaining with hematoxylin. Two in situ hybridization procedures were performed. Slides were investigated in a Zeiss Axioskop using brightfield and epipolarisation optic systems and photographed. The stages of the seminiferous cpithelium were identified according to Leblond and Clermont (1952). Results Sequence analysis of the 118 bp monkey FSH receptor fragment of the extracellular domain revealed 86% homology with the corresponding sequence of the rat FSH receptor but only approximately 20% with the rat LH receptor. Specific hybridization signals were only seen on tissue sections when using FSH receptor cRNA antisense probe. FSH receptor mRNA expression in normal adult rat testes was localized in Sertoli cell cytoplasm and was first detectable just prior to sperm release at stage VIII of the cycle. Strong hybridization signals were found at stages IX and
Figs. 1-6. Bright-field and epithelium of the rat testis (l-2) Stage IX. Expression signal above background.
corresponding epipolarisation photographs of FSH receptor mRNA expression in the seminiferous at different stages of the cycle (~3601. (I-4) III SI~U hybridization with FSH receptor antisense probe. of FSH receptor mRNA to Sertoli cells (open arrow). 13-4) Early stage of the cycle. No hybridization (5-6) in siru hybridization with FSH receptor sense probe. Stage IX. No specific binding above background.
R4X
X (Figs. 1 and 2). FSH receptor mRNA was mainly detected in the basal parts of the epithelium around the Sertoli cell nucleus. A decrease in the accumulation of hybridization grains was observed during stages XI-XII. In stages XIIII-VII there was no defined localization of specific binding in comparison to background (Figs. 3 and 4). All tissue sections hybridized with the FSH receptor cRNA sense probe showed a homogeneous distribution of silver grains that were considered as backgrounds (Figs. 5 and 6). Discussion In adult rat testicular tissue the expression of FSH receptor mRNA was localized to Sertoli cells. It seems to be highest at only a few stages of the seminiferous epithelial cycle, namely when the new wave of spermatogenesis starts (stages VIII-X). At the same time spermatids elongate (states IX-XIII), while spermatogonia enter their first mitoses (stages IX-XII) (Leblond and Clermont, 1952) thus possibly indicating regulatory functions of germ cells on the FSH or FSH receptor gene. By Northern blot analysis of FSH receptor mRNA expression, Heckert and Griswold (1991) recently found levels to be highest during stages XIII-II with a decrease to a minimum level at stages VII-VIII of the cycle in stage-synchronized testes of vitamin A deficient rats. The diffcrence in results may be due to the more precise localization and morphological identification of defined stages by in situ hybridization. Moreover results found in vitamin A deficient rats may be different from normal adult rats due to the animal model with a predominance of certain stages possibly accompanied by still undefined paracrine mechanisms and unknown metabolic changes. In CAMP response studies using microdissccted testicular tubules from adult rats a significantly lower basal and FSH-stimulated production of CAMP was shown during stages VII-XII in comparison to stages XIII-I-VI (Kangasniemi ct al., 1990a). Measurement of FSH binding in seminiferous tubules from testes of adult rats revealed low values in stages VI and VII and a 3.5fold increase of FSH binding in stages XIII-I (Kangasniemi et al., 1990b). In rlitro FSH binding
and FSH responsiveness are highest in the stages XIII-VI, while in II&Q our findings show that FSH receptor mRNA expression in Sertoli cells is strongest in stages IX and X. Our results indicate high expression of FSH receptor mRNA in Sertoli cells before FSH binding and CAMP production reach their maximum. These results suggest that FSH is involved in the initiation of a new wave of spermatogenesis. The discrepancies between results obtained by in 13itro and in rirw studies make further careful elucidation of FSH receptor gene regulation under defined hormonal conditions necessary. Our observations demonstrate the localization of FSH receptor mRNA to Sertoli cells and suggest that FSH and spermatogenic cells are involved in the regulation of FSH receptor mRNA expression at different stages of the spermatogenic cycle in the rat.
Acknowledgements This study was supported by the Deutsche Forschungsgemeinschaft DFG (Ni 130/l l), the Academy of Finland, and the Sigrid Juselius Foundation. We would like to thank S. Nieschlag, MA for language editing.
References Ausubel, F.M., Brent, R., Kingston. R.E., Moore. D.D.. Seidman, J.G., Smith, J.A. and Struhl, K. (1985) Current Protocols in Molecular Biology. Vol. 2. pp. 14.3.1-14.2.2. Bartlett, J.M.S., Weinbauer, G.F. and Nieschlag, E. (I9H9) J. Endocrinol. 121, 49-58. Chomczynski. P. and Sacchi, N. (19X7) Anat. Biochem. 162, 156m 159. Denhardt. D.T. (1966) Biochem. Biophys. Res. Commun. 23, 641-646. Heckert, L.L. and Griswold, M.D. (1991) Mol. Endocrinol. S. 670-677. Huang, W.M., Gibson, S.J., Facer, P., Gu, J. and Polak, J.M. (1983) Histochemistry 77, 275-279. Kangasniemi, M., Kaipia, A., Toppari, J.. Mali, P., Huhtaniemi, I. and Patvinen. M. (1990a) Anat. Rec. 227. 32-36. Kangasniemi, M., Kaipia, A., Toppari, J., Perheentupa, A.. Huhtaniemi. I. and Parvinen, M. (1990bI J. Androl. I I. 3366343. Leblond, C.P. and Clermont, Y. (1952) Ann. NY Acad. Sci. 5s. 548-573.
R49 Matsumoto, A.M., Karpas, A.E. and Bremner, W.J. (1986) J. Clin. Endocrinol. Metab. 62, 1184-1192. Minegish, T., Nakamura, K., Takahura, Y., Ibuki. Y. and Igarashi, M. (1991) Biochem. Biophys. Res. Commun. 3, 1125-l 130. Niklowitz. P., Khan, S.A., Bergmann, M., Hoffmann, K. and Nieschlag, E. (1989) Biol. Reprod. 41, 871-880. Paninen, M., Marana, R., Robertson, D.M., Hansson, V. and Kit&n, E.M. (1980) in Testicular Development, Structure
and Function (Steinberger, A. and Steinberger, E., eds.), pp. 425-432, Raven Press, New York. Reichert, L.E. and Dattatreyamurty, B. (1989) Biol. Reprod. 40, 13-26. Sanger. F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. Sprengel, R., Braun, T., Nikolics, K., Segaloff, D.L. and Seeburg. P. (1990) Mol. Endocrinol. 4. 5255530.