- Email: [email protected]
Full genomic sequence analysis of swine genotype 3 hepatitis E virus isolated from Shanghai
Virus Research 144 (2009) 290–293
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Short communication
Full genomic sequence analysis of swine genotype 3 hepatitis E virus isolated from Shanghai Fu-sheng Si a,c , Yu-min Zhu a,b , Shi-juan Dong a,b , Shui-sheng Yu a,b , Rui-song Yu a,b , Shi-yuan Shen a,b , Qian Yang c , Zhen Li a,b,∗ a b c
Institute of Animal Science and Veterinary Medicine, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China Shanghai Key Laboratory of Agricultural Genetics and Breeding, Shanghai 201106, China Veterinary College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China
a r t i c l e
i n f o
Article history: Received 27 January 2009 Received in revised form 11 April 2009 Accepted 14 April 2009 Available online 23 April 2009 Keywords: Hepatitis E virus Genotype 3 Full genomic sequence Phylogenetic analysis Swine viral isolates
a b s t r a c t The full genomic nucleotide sequence of a previously identified genotype 3 hepatitis E virus (HEV), strain SAAS-JDY5, was obtained using RT-PCR and rapid amplification of cDNA ends (RACE). The genome consisted of 7225 nucleotides, excluding a poly-A tail at the 3 terminus, and contained three open reading frames (ORFs), ORF-1, ORF-2 and ORF-3, encoding 1702, 660 and 113 amino acids, respectively. Phylogenetic analysis confirmed that SAAS-JDY5 belonged to genotype 3 HEV and was most closely related to the Japanese isolate wbJYG1 (AB222184). SAAS-JDY5 shared approximately 87% nucleotide similarity to human and swine strains from the United States, compared with 74–75% similarity to Asian (genotype 4) and Mexican strains (genotype 2). Alignment of the SAAS-JDY5 genomic sequence with reference sequences of the same genotype revealed one nucleotide substitution and one deletion at positions 5145 and 7189 (3 UTR), respectively. Moreover, SAAS-JDY5 contained two additional nucleotides (AC) at the very end of the 3 -terminus preceding the poly-A tail of the genome. Comparison of the putative amino acid sequence encoded by the SAAS-JDY5 genome with sequences of other genotype 3 isolates revealed 15 unique amino acid substitutions and one deletion in ORF-1, and three substitutions in ORF-2. © 2009 Elsevier B.V. All rights reserved.
Hepatitis E is an important public health problem in many developing countries of Asia and Africa, and also occurs sporadically in some industrialized countries. The disease mainly affects young adults and has a relatively high mortality (up to 25%) in affected pregnant women (Emerson and Purcell, 2003). Hepatitis E is transmitted primarily by the fecal–oral route, often through contaminated water (Purcell, 1996; Bradley, 1992). Hepatitis E virus (HEV), a member of the genus Hepevirus, is a single-stranded, positive-sense RNA virus without an envelope (Purcell and Emerson, 2001). The genome of HEV is approximately 7.2 kb, and contains a short 5 untranslated region (UTR), three open reading frames (ORFs), and a short 3 UTR terminated by a poly(A) tract (Reyes et al., 1990). ORF-1 is located at the 5 end of the genome and encodes non-structural proteins including a methyltransferase, a papain-like cysteine protease, RNA helicase, and RNA-dependent RNA polymerase (RdRp). ORF-2 maps to the
∗ Corresponding author at: Institute of Animal Science and Veterinary Medicine, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China. Tel.: +86 21 62206391; fax: +86 21 62207858. E-mail address: [email protected] (Z. Li). 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.04.009
3 terminus and encodes for a major structural protein (Tam et al., 1991; Purcell and Emerson, 2001). ORF-3, which overlaps with ORF2 (Graff et al., 2006; Huang et al., 2007), encodes a smaller protein which interacts with the ORF2 protein (Tyagi et al., 2002) and a number of cellular signal transduction pathway proteins (Korkaya et al., 2001; Tyagi et al., 2004). The first swine strain of HEV was isolated and characterized in the US (Meng et al., 1997), followed by similar findings in Japan (Okamoto et al., 2001; Nishizawa et al., 2003), Taiwan (Hsieh et al., 1999; Wu et al., 2002), New Zealand (Garkavenko et al., 2001), and mainland China (Wang et al., 2002). Other animals such as goats, cattle and rodents are also reported to be infected with HEV (Usmanov et al., 1994; Favorov et al., 1996, 2000; Maneerat et al., 1996; Tsarev et al., 1998). These studies have gradually confirmed that HEV is a zoonotic pathogen, and that pigs are a major reservoir (Zheng et al., 2006). Based on sequence analysis, HEVs have been classified into four major genotypes (1–4). Genotype 1 is the main cause of hepatitis E in developing countries in Asia and Africa. Genotype 2 has been documented in Mexico and a number of African countries. Genotype 3 strains originated mainly from North America, Europe, New Zealand and some Asian countries including Japan, South Korea, Taiwan and Thailand, and genotype 4 has mainly been associated with Asian
F.-s. Si et al. / Virus Research 144 (2009) 290–293
countries including China, Japan, India and Vietnam (Schlauder and Mushahwar, 2001). Although previous epidemiological research on HEV had reported that strains circulating in China belonged to genotypes 1 and 4 (Wang et al., 1999; Wei et al., 2006), our more recent studies have demonstrated the widespread existence of genotype 3 HEV strains in Shanghai pig farms (Ning et al., 2007; Ning et al., 2008). This finding has generated considerable interest in the origins, genomic characteristics and zoonotic nature of genotype 3 HEV in Shanghai. We now report the first full-length sequence of a genotype 3 swine HEV strain, SAAS-JDY5, from China. The strain of HEV, designated SAAS-JDY5, was isolated from a fecal specimen collected from a pig farm located in a Shanghai suburb. The strain was identified as genotype 3 HEV by RT-PCR and sequencing of the ORF-2 150 bp fragment (Li et al., 2009). Viral RNA was extracted with TRIZOL reagent (Invitrogen, USA) in accordance with the manufacturer’s protocol. The extracted RNA was dissolved in 10 l RNase-free pure water for use in determining the full genomic sequence of the HEV strain. Different primer sets were used for the amplification of the entire SAAS-JDY5 genomic sequence. First strand cDNA of the whole genomic RNA was synthesized with the SuperScriptTM III Firststrand Synthesis System (Invitrogen, USA). First round PCR was carried out using 5 l of the synthesized cDNA and an external set of forward and reverse primers with Ex Taq DNA polymerase (TakaRa, Japan). Nested PCR was carried out with an internal primer set and 5 l of the first PCR product. The resulting PCR products were excised from agarose gels, purified using the Axyprep DNA Gel Extraction Kit (Axygen, USA), and cloned into PMD18-T vector (TakaRa, Japan) using T4 DNA ligase (TakaRa, Japan). Recombinant plasmid DNA was transformed into Escherichia coli DH5␣ cells (TakaRa, Japan), and plasmids containing the insert fragment were identified by PCR. At least three of the positive clones were sequenced. Amplification of the extreme 5 end sequence was carried out using the SMARTTM RACE cDNA Amplification Kit (Clontech Laboratories, Japan) according to the manufacturer’s protocol. Briefly, extracted RNA was treated with 1 l SMART TM A Oligonucleotide (supplied with the kit) and used as the template to synthesize cDNA. First-strand cDNA was synthesized by reverse transcription using 5 RACE CDS primer A (supplied with the kit) and the SuperScriptTM III First-strand Synthesis System. This cDNA was then amplified by two rounds of PCR with Ex Taq DNA polymerase (TakaRa, Japan) using 10× Universal Primer A Mix and Nested Universal Primer A (supplied with the kit) as forward primers, and specific genotype 3 HEV primers 5 EA and 5 IA as reverse primers, respectively. Purified PCR products were TA-cloned and sequenced. Amplification of the extreme 3 end was also carried out with SMARTTM RACE cDNA Amplification Kit (Clontech Laboratories, Japan). cDNA was synthesized by incubating 10 l HEV RNA template solution with the SuperScriptTM III First-strand Synthesis System at 50 ◦ C for 50 min. Reactions were terminated by exposure to 85 ◦ C for 5 min. The external reverse primer, 3 RACE CDS primer A (supplied with the kit), which has a poly(T) tract, was used to prime the cDNA synthesis. The resultant cDNA was then amplified by two rounds of PCR using the 10× Universal Primer A Mix and Nested Universal Primer A (supplied with the kit) as reverse primers, and the specific HEV primers 3 ES and 3 IS as forward primers, respectively. The PCR reaction mixture and amplification conditions were the same as for 5 RACE. Sequence assembly was accomplished and percent identity was calculated using Lasergene (version 7.10; DNAstar). Sequence alignments were generated by CLUSTAL-W (version 1.8). Genetic distances between pairs of viral isolates were calculated with MEGA software (version 4.0) and the phylogenetic tree was con-
291
structed using the neighbor-joining method and an avian HEV strain (AY535004) (Huang et al., 2004) as the outgroup. Nine RT-PCR fragments of SAAS-JDY5 genomic RNA were obtained, and the overlapping cDNA sequences were cloned and sequenced to construct the full-length genome. The full-length genome of SAAS-JDY5 consisted of 7225 nucleotides (nt), excluding the poly(A) tail at the 3 terminus, and contained three major ORFs. The genome comprised a 5 UTR of 26 nt (1–26), ORF-1 of 5109 nt (27–5135), ORF-2 of 1983 nt (5170–7152), ORF-3 of 342 nt (5159–5500) and a 3 UTR of 73 nt (7153–7225), followed by a poly(A) tail of 30 residues. ORF-2 and ORF-3 were defined according to Graff et al. (2006) and Huang et al. (2007). Phylogenetic analysis confirmed the classification of SAAS-JDY5 into genotype 3 HEV (Fig. 1). Similar topologies were obtained with ORF-1, 2- and 3-based phylogenetic analyses (data not shown). The phylogenetic tree revealed that SAAS-JDY5 was most closely related (90.8% sequence similarity) to a Japanese strain, wbJYG1 (AB222184), isolated from a wild boar. The ORF-1, ORF-2 and ORF-3 sequences of the two strains were 90.3%, 92.0% and 97.0% similar, respectively. The similarity between SAAS-JDY5 and the USA HEV strain Meng (AF082843), isolated from swine, was 87.0%. The percent nucleotide identity (PNI) of SAAS-JDY5 with isolates of genotype 1 ranged between 74.1% and 75.3%, between 75.5% and 76.3% for genotype 4 isolates, and was 74.6% in the case of a genotype 2 isolate from Mexico. The 26 nt of the 5 UTR and the 73 nt of the 3 UTR were obtained by 5 and 3 RACE, respectively. The 5 UTR sequence was ACGCGGGGGCAGACCACGTATGTGGTCGATGCC and the 3 UTR sequence was TTAATTCCTCCTGTGCCCCCTTCGTAGTCTTCTTTGCTTTATTTCTCTTTTCTGCTTTCCGCGCTCCCCGGAC. Alignment of the SAAS-JDY5 5 UTR with those of other available genotype 3 HEV strains revealed a high level of conservation. However, alignment of the 3 UTR of SAAS-JDY5 with six other genotype 3 HEV strains revealed the existence of several mutations in this part of the genome. SAAS-JDY5 resembled other genotype 3 isolates in having an ORF-2 with a TAA termination codon, but also had two additional nucleotides (AC) at the very end of the 3 -terminal preceding the poly-A tail. Furthermore, SAAS-JDY5 had a nucleotide deletion within this region at nt position 7189 whereas a G or C was present in other genotype 3 sequences. ORF-1 consisted of 5109 nucleotides (nt 27–5135) capable of encoding a protein of 1702 amino acids. This was four residues longer than the ORF-1 of HEV-US1 (genotype 3) but shorter than other genotype 3 swine and human isolates. SAAS-JDY5 exhibited only 76.4–84.5% identity with other genotype 3 isolates at the hyper-variable region of ORF-1 (date no shown). Percent nucleotide and amino acid identities of SAAS-JDY5 ORF-1 with ORF1 sequences of other human genotype 3 isolates ranged between 86.1–88.7% and 96.3–96.9%, respectively. When compared independently with the Japanese strain, wbJYG1, percent nucleotide identity and amino acid similarity values were 90.3% and 96.5%, respectively. ORF-1 motifs, i.e. the NTP-binding domains GVPGSGKS and DEAP in the putative helicase region, and the GDD site found in the RNA-dependent RNA polymerase, were conserved. When compared to other genotype 3 isolates, 15 unique amino acid substitutions and one deletion were observed. Substitutions were observed at the following amino acid positions: 465 (K to R), 598 (R to H), 739 (D to E), 766 (L to P), 870 (V to A), 929 (A to V), 930 (A to T), 961 (A to T), 969 (A to T), 1017 (R to W), 1298 (T to P), 1443 (F to L), 1558 (K to R), 1693 (L to P) and 1696 (S to P), and the Leu residue at position 1048 was deleted. ORF-2 of SAAS-JDY5 potentially encoded a protein of 660 amino acids of identical size to the corresponding protein of other human and swine genotype 3 HEVs. The N-terminal (residues 1–113) and Cterminal (residues 481–660) regions of the protein exhibited more variability than the central (residues 114–480) region. Substitutions
292
F.-s. Si et al. / Virus Research 144 (2009) 290–293
unique to SAAS-JDY5 were evident at positions 102 (S to P), 632 (T to A) and 649 (R to P). Percent nucleotide and amino acid identities of SAAS-JDY5 ORF-2 with ORF-2 sequences of other human genotype 3 isolates ranged between 88.7–90.8% and 97.6–98.9% respectively. When compared independently with the Japanese strain, wbJYG1, percent nucleotide identity and amino acid similarity values were 92% and 98%, respectively. The nucleotide homology between SAAS-JDY5 and SW-SH05, another strain isolated from a pig farm located in the Shanghai suburban area (Ning et al., 2007), was 93.3% when a 150 bp ORF-2 fragment was compared (data not shown). This suggests that either there were genetic variants among genotype 3 HEVs circulating within Shanghai pig farms or the strains were originally different. Alignment of the 150 bp ORF-2 fragments from wbJYG1 and SWSH05 revealed a nucleotide identity of 96.7% (data not shown), well above the 92.7% value observed when SW-SH05 and a US swine strain (AF082843) were compared (Ning et al., 2007). From these facts we postulate that genotype 3 HEVs in Shanghai were originally identical but underwent genetic changes during the environmental adaptation process. ORF-3 of SAAS-JDY5 consisted of 342 nucleotides (nt 5159–5500) encoding a protein of 113 amino acids. SAAS-JDY5 ORF-3 was defined here according to Graff et al. (2006) and Huang et al. (2007) and consequently was nine amino acids shorter than the formerly recognized consensus sequence of ORF-3 of genotype 3 HEVs. There was a C to T substitution at nt position 5145 in front of ORF-3. When compared with ORF-3 sequences of human genotype 3 isolates and with the Japanese strain, wbJYG1, the SAAS-JDY5 ORF-3 exhibited percent nucleotide identity values ranging between 93.8–98.1% and 97.0%, respectively. The amino acid sequence of SAAS-JDY5 ORF-3 was 92.6–98.4% and 94.3–98.4% identical to human and swine genotype 3 isolates, respectively. Although both genotypes 3 and 4 HEV exist in Shanghai, there was no obvious evidence to suggest that SAAS-JDY5 had integrated large pieces of genetic material from genotype 4 HEV. However, in the present study, unique features were found associated with the SAAS-JDY5 genome. For example, in addition to its length of 7225 nt, the SAAS-JDY5 genome had a single amino acid deletion within ORF-1 and 18 amino acid substitutions across all three ORFs. At the nucleotide level, SAAS-JDY5 exhibited one substitution and one deletion at positions 5145 and 7189 (3 UTR), respectively and contained an additional two nucleotides (AC) at the very end of the 3 -terminus preceding the poly-A tail of the genome. However, although all these deletions, mutations or substitutions demonstrated the variability of the genotype 3 HEVs in Shanghai, further studies are necessary to explore the underlying biological meaning of all these genomic variations.
Acknowledgements We thank Dr John Buswell, Institute of Edible Fungi, for linguistic revision of the manuscript. This work was supported by grants from the Shanghai Science and Technology Committee and from the Shanghai Agricultural Committee.
References
Fig. 1. Phylogenetic tree constructed by the neighbor-joining method based on the full-length nucleotide sequences of 88 hepatitis E virus isolates, using a chicken HEV isolate (AY535004) as the outgroup. GenBank accession numbers for the full genome are shown at each branch. Percent bootstrap support is indicated at each node. Bootstrap values are indicated for the major nodes as a percentage of the data obtained from 1000 re-samplings. The scale bar indicates a genetic distance of 0.05%
Bradley, D.W., 1992. Hepatitis E: epidemiology, aetiology and molecular biology. Rev. Med. Virol. 2, 19–28. Emerson, S.U., Purcell, R.H., 2003. Hepatitis E virus. Rev. Med. Virol. 13, 145–154. Favorov, M.O., Kosoy, M.Y., Tsarev, S.A., Childs, J.E., Margolis, H.S., 2000. Prevalence of antibody to hepatitis E virus among rodents in the United States. J. Infect. Dis. 181, 449–455. Favorov, M.O., Nazarova, O.K., Yashina, T.L., McCaustland, K., Fields, H.A., Margolis, H.S., 1996. Cattle as a possible reservoir of hepatitis E virus infection. In: Ninth Triennial International Symposium on Viral Hepatitis and Liver Disease, Rome, 21–25 April (Abstract A140).
F.-s. Si et al. / Virus Research 144 (2009) 290–293 Garkavenko, O., Obriadina, A., Meng, J., Anderson, D.A., Bernard, H.J., Schroeder, B.A., Khudyakov, Y.E., Fields, H.A., Croxson, M.C., 2001. Detection and characterization of swine hepatitis E virus in New Zealand. J. Med. Virol. 65, 525–529. Graff, J., Torian, U., Nguyen, H., Emerson, S., 2006. A bicistronic subgenomic mRNA encodes both the ORF2 and ORF3 proteins of hepatitis E virus. J. Virol. 80, 5919–5926. Hsieh, S.Y., Meng, X.J., Wu, Y.H., Liu, S.T., Tam, A.W., Lin, D.Y., Liaw, Y.F., 1999. Identity of a novel swine hepatitis E virus in Taiwan forming a monophyletic group with Taiwan isolates of human hepatitis E virus. J. Clin. Microbiol. 37, 3828–3834. Huang, F.F., Sun, Z.F., Emerson, S.U., Purcell, R., Shivaprasad, H.L., Pierson, F.W., Toth, T.E., Meng, X.J., 2004. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 85, 1609–1618. Huang, Y.W., Opriessnig, T., Meng, X.J., 2007. Initiation at the third in-frame AUG codon of open reading frame 3 of the hepatitis E virus is essential for viral infectivity in vivo. J. Virol. 81, 3018–3026. Korkaya, H., Jameel, S., Gupta, D., Tyagi, S., Kumar, R., Zafrullah, M., Mazumdar, M., Lal, S.K., Xiaofang, L., Sehgal, D., Das, S.R., Sahal, D., 2001. The ORF3 protein of hepatitis E virus binds to Src homology 3 domains and activates MAPK. J. Biol. Chem. 276, 42389–42400. Li, Z., Yu, S., Dong, S., Zhu, Y., Si, F., Shen, S., Jiang, Z., Yu, R., Zou, S., 2009. Reduced prevalence of genotype 3 HEV in Shanghai pig farms and hypothetical homeostasis of porcine HEV reservoir. Vet. Microbiol. 137, 184–189. Maneerat, Y., Clayson, E.T., Myint, K.S., Young, G.D., Innis, B.L., 1996. Experimental infection of the laboratory rat with the hepatitis E virus. J. Med. Virol. 48, 121–128. Meng, X.J., Purcell, R.H., Haubur, P.G., Lehman, J.R., Webb, D.M., Tsareva, T.S., Haynes, J.S., Thacker, B.J., Emerson, S.U., 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. USA 94, 9860–9865. Ning, H., Niu, Z., Yu, R., Zhang, P., Dong, S., Li, Z., 2007. Identification of genotype 3 hepatitis E virus in fecal samples from a pig farm located in a Shanghai suburb. Vet. Microbiol. 121, 125–130. Ning, H., Yu, S., Zhu, Y., Dong, S., Yu, R., Shen, S., Niu, Z., Li, Z., 2008. Genotype 3 hepatitis E has been widespread in pig farms of Shanghai suburbs. Vet. Microbiol. 126, 257–263. Nishizawa, T., Takahashi, M., Mizuo, H., Miyajima, H., Gotanda, Y., Okamoto, H., 2003. Characterization of Japanese swine and human hepatitis E virus isolates of genotype IV with 99% identity over the entire genome. J. Gen. Virol. 84, 1245–1251. Okamoto, H., Takahashi, M., Nishizawa, T., Fukai, K., Muramatsu, U., Yoshikawa, A., 2001. Analysis of the complete genome of indigenous swine hepatitis E virus isolated in Japan. Biochem. Biophys. Res. Commun. 289, 929–936.
293
Purcell, R.H., 1996. Hepatitis E virus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, third ed. Lippincott-Raven, Philadelphia, PA, pp. 2831–2843. Purcell, R.H., Emerson, S.U., 2001. Hepatitis E virus. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Martin, M.A., Lamb, R.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, fourth ed. Lippincott Williams and Wilkins, Philadelphia, PA, pp. 3051–3061. Reyes, G.R., Purdy, M.A., Kim, J.P., Luk, K.C., Young, L.M., Fry, K.E., Bradley, D.W., 1990. Isolation of cDNA from the virus responsible for enterically transmitted non-A, non-B hepatitis. Science 247, 1336–1339. Schlauder, G.G., Mushahwar, I.K., 2001. Genetic heterogeneity of hepatitis E virus. J. Med. Virol. 65, 282–292. Tam, A.W., Smith, M.M., Guerra, M.E., Huang, C.C., Bradley, D.W., Fry, K.E., Reyes, G.R., 1991. Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 185, 120–131. Tsarev, S.A., Shrestha, M.P., He, J., Scott, R.M., Vaughn, D.M., Clayson, E.T., Gigliotti, S., Longer, C.F., Innis, B.L., 1998. Naturally acquired hepatitis E virus (HEV) infection in Nepalese rodents. Am. J. Trop. Med. Hyg. 59 (Suppl.), 242. Tyagi, S., Korkaya, H., Zafrullah, M., Jameel, S., Lal, S.K., 2002. The phosphorylated form of the ORF3 protein of hepatitis E virus interacts with its non-glycosylated form of the major capsid protein, ORF2. J. Biol. Chem. 277, 22759–22767. Tyagi, S., Surjit, M., Roy, A.K., Jameel, S., Lal, S.K., 2004. The ORF3 protein of hepatitis E virus interacts with liver-specific alpha1-microglobulin and its precursor alpha1-microglobulin/bikunin precursor (AMBP) and expedites their export from the hepatocyte. J. Biol. Chem. 279, 29308–29319. Usmanov, R.K., Balaian, M.S., Dvoinikova, O.V., Alymbaeva, D.B., Zamiatina, N.A., Kazachkov, IuA., Belov, V.I., 1994. An experimental infection in lambs by hepatitis E virus. Vopr. Virusol. 39, 165–168. Wang, Y., Ling, R., Erker, J.C., Zhang, H., Li, H., Desai, S., Mushahwar, I.K., Harrison, T.J., 1999. A divergent genotype of hepatitis E virus in Chinese patients with acute hepatitis. J. Gen. Virol. 80, 169–177. Wang, Y.C., Zhang, H.Y., Xia, N.S., Peng, G., Lan, H.Y., Zhuang, H., Zhu, Y.H., Li, S.W., Tian, K.G., Gu, W.J., Lin, J.X., Wu, X., Li, H.M., Harrison, T.J., 2002. Prevalence, isolation, and partial sequence analysis of hepatitis E virus from domestic animals in China. J. Med. Virol. 67, 516–521. Wei, S., Xu, Y., Wang, M., To, S.S., 2006. Phylogenetic analysis of hepatitis E virus isolates in southern China (1994–1998). J. Clin. Virol. 36, 103–110. Wu, J.C., Chen, C.M., Chiang, T.Y., Tsai, W.H., Jeng, W.J., Sheen, I.J., Lin, C.C., Meng, X.J., 2002. Spread of hepatitis E virus among different-aged pigs: two-year survey in Taiwan. J. Med. Virol. 66, 488–492. Zheng, Y., Ge, S., Zhang, J., Guo, Q., Ng, M.H., Wang, F., Xia, N., Jiang, Q., 2006. Swine as a principal reservoir of hepatitis E virus that infects humans in Eastern China. J. Infect. Dis. 193, 1643–1649.
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Short communication
Full genomic sequence analysis of swine genotype 3 hepatitis E virus isolated from Shanghai Fu-sheng Si a,c , Yu-min Zhu a,b , Shi-juan Dong a,b , Shui-sheng Yu a,b , Rui-song Yu a,b , Shi-yuan Shen a,b , Qian Yang c , Zhen Li a,b,∗ a b c
Institute of Animal Science and Veterinary Medicine, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China Shanghai Key Laboratory of Agricultural Genetics and Breeding, Shanghai 201106, China Veterinary College, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China
a r t i c l e
i n f o
Article history: Received 27 January 2009 Received in revised form 11 April 2009 Accepted 14 April 2009 Available online 23 April 2009 Keywords: Hepatitis E virus Genotype 3 Full genomic sequence Phylogenetic analysis Swine viral isolates
a b s t r a c t The full genomic nucleotide sequence of a previously identified genotype 3 hepatitis E virus (HEV), strain SAAS-JDY5, was obtained using RT-PCR and rapid amplification of cDNA ends (RACE). The genome consisted of 7225 nucleotides, excluding a poly-A tail at the 3 terminus, and contained three open reading frames (ORFs), ORF-1, ORF-2 and ORF-3, encoding 1702, 660 and 113 amino acids, respectively. Phylogenetic analysis confirmed that SAAS-JDY5 belonged to genotype 3 HEV and was most closely related to the Japanese isolate wbJYG1 (AB222184). SAAS-JDY5 shared approximately 87% nucleotide similarity to human and swine strains from the United States, compared with 74–75% similarity to Asian (genotype 4) and Mexican strains (genotype 2). Alignment of the SAAS-JDY5 genomic sequence with reference sequences of the same genotype revealed one nucleotide substitution and one deletion at positions 5145 and 7189 (3 UTR), respectively. Moreover, SAAS-JDY5 contained two additional nucleotides (AC) at the very end of the 3 -terminus preceding the poly-A tail of the genome. Comparison of the putative amino acid sequence encoded by the SAAS-JDY5 genome with sequences of other genotype 3 isolates revealed 15 unique amino acid substitutions and one deletion in ORF-1, and three substitutions in ORF-2. © 2009 Elsevier B.V. All rights reserved.
Hepatitis E is an important public health problem in many developing countries of Asia and Africa, and also occurs sporadically in some industrialized countries. The disease mainly affects young adults and has a relatively high mortality (up to 25%) in affected pregnant women (Emerson and Purcell, 2003). Hepatitis E is transmitted primarily by the fecal–oral route, often through contaminated water (Purcell, 1996; Bradley, 1992). Hepatitis E virus (HEV), a member of the genus Hepevirus, is a single-stranded, positive-sense RNA virus without an envelope (Purcell and Emerson, 2001). The genome of HEV is approximately 7.2 kb, and contains a short 5 untranslated region (UTR), three open reading frames (ORFs), and a short 3 UTR terminated by a poly(A) tract (Reyes et al., 1990). ORF-1 is located at the 5 end of the genome and encodes non-structural proteins including a methyltransferase, a papain-like cysteine protease, RNA helicase, and RNA-dependent RNA polymerase (RdRp). ORF-2 maps to the
∗ Corresponding author at: Institute of Animal Science and Veterinary Medicine, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China. Tel.: +86 21 62206391; fax: +86 21 62207858. E-mail address: [email protected] (Z. Li). 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.04.009
3 terminus and encodes for a major structural protein (Tam et al., 1991; Purcell and Emerson, 2001). ORF-3, which overlaps with ORF2 (Graff et al., 2006; Huang et al., 2007), encodes a smaller protein which interacts with the ORF2 protein (Tyagi et al., 2002) and a number of cellular signal transduction pathway proteins (Korkaya et al., 2001; Tyagi et al., 2004). The first swine strain of HEV was isolated and characterized in the US (Meng et al., 1997), followed by similar findings in Japan (Okamoto et al., 2001; Nishizawa et al., 2003), Taiwan (Hsieh et al., 1999; Wu et al., 2002), New Zealand (Garkavenko et al., 2001), and mainland China (Wang et al., 2002). Other animals such as goats, cattle and rodents are also reported to be infected with HEV (Usmanov et al., 1994; Favorov et al., 1996, 2000; Maneerat et al., 1996; Tsarev et al., 1998). These studies have gradually confirmed that HEV is a zoonotic pathogen, and that pigs are a major reservoir (Zheng et al., 2006). Based on sequence analysis, HEVs have been classified into four major genotypes (1–4). Genotype 1 is the main cause of hepatitis E in developing countries in Asia and Africa. Genotype 2 has been documented in Mexico and a number of African countries. Genotype 3 strains originated mainly from North America, Europe, New Zealand and some Asian countries including Japan, South Korea, Taiwan and Thailand, and genotype 4 has mainly been associated with Asian
F.-s. Si et al. / Virus Research 144 (2009) 290–293
countries including China, Japan, India and Vietnam (Schlauder and Mushahwar, 2001). Although previous epidemiological research on HEV had reported that strains circulating in China belonged to genotypes 1 and 4 (Wang et al., 1999; Wei et al., 2006), our more recent studies have demonstrated the widespread existence of genotype 3 HEV strains in Shanghai pig farms (Ning et al., 2007; Ning et al., 2008). This finding has generated considerable interest in the origins, genomic characteristics and zoonotic nature of genotype 3 HEV in Shanghai. We now report the first full-length sequence of a genotype 3 swine HEV strain, SAAS-JDY5, from China. The strain of HEV, designated SAAS-JDY5, was isolated from a fecal specimen collected from a pig farm located in a Shanghai suburb. The strain was identified as genotype 3 HEV by RT-PCR and sequencing of the ORF-2 150 bp fragment (Li et al., 2009). Viral RNA was extracted with TRIZOL reagent (Invitrogen, USA) in accordance with the manufacturer’s protocol. The extracted RNA was dissolved in 10 l RNase-free pure water for use in determining the full genomic sequence of the HEV strain. Different primer sets were used for the amplification of the entire SAAS-JDY5 genomic sequence. First strand cDNA of the whole genomic RNA was synthesized with the SuperScriptTM III Firststrand Synthesis System (Invitrogen, USA). First round PCR was carried out using 5 l of the synthesized cDNA and an external set of forward and reverse primers with Ex Taq DNA polymerase (TakaRa, Japan). Nested PCR was carried out with an internal primer set and 5 l of the first PCR product. The resulting PCR products were excised from agarose gels, purified using the Axyprep DNA Gel Extraction Kit (Axygen, USA), and cloned into PMD18-T vector (TakaRa, Japan) using T4 DNA ligase (TakaRa, Japan). Recombinant plasmid DNA was transformed into Escherichia coli DH5␣ cells (TakaRa, Japan), and plasmids containing the insert fragment were identified by PCR. At least three of the positive clones were sequenced. Amplification of the extreme 5 end sequence was carried out using the SMARTTM RACE cDNA Amplification Kit (Clontech Laboratories, Japan) according to the manufacturer’s protocol. Briefly, extracted RNA was treated with 1 l SMART TM A Oligonucleotide (supplied with the kit) and used as the template to synthesize cDNA. First-strand cDNA was synthesized by reverse transcription using 5 RACE CDS primer A (supplied with the kit) and the SuperScriptTM III First-strand Synthesis System. This cDNA was then amplified by two rounds of PCR with Ex Taq DNA polymerase (TakaRa, Japan) using 10× Universal Primer A Mix and Nested Universal Primer A (supplied with the kit) as forward primers, and specific genotype 3 HEV primers 5 EA and 5 IA as reverse primers, respectively. Purified PCR products were TA-cloned and sequenced. Amplification of the extreme 3 end was also carried out with SMARTTM RACE cDNA Amplification Kit (Clontech Laboratories, Japan). cDNA was synthesized by incubating 10 l HEV RNA template solution with the SuperScriptTM III First-strand Synthesis System at 50 ◦ C for 50 min. Reactions were terminated by exposure to 85 ◦ C for 5 min. The external reverse primer, 3 RACE CDS primer A (supplied with the kit), which has a poly(T) tract, was used to prime the cDNA synthesis. The resultant cDNA was then amplified by two rounds of PCR using the 10× Universal Primer A Mix and Nested Universal Primer A (supplied with the kit) as reverse primers, and the specific HEV primers 3 ES and 3 IS as forward primers, respectively. The PCR reaction mixture and amplification conditions were the same as for 5 RACE. Sequence assembly was accomplished and percent identity was calculated using Lasergene (version 7.10; DNAstar). Sequence alignments were generated by CLUSTAL-W (version 1.8). Genetic distances between pairs of viral isolates were calculated with MEGA software (version 4.0) and the phylogenetic tree was con-
291
structed using the neighbor-joining method and an avian HEV strain (AY535004) (Huang et al., 2004) as the outgroup. Nine RT-PCR fragments of SAAS-JDY5 genomic RNA were obtained, and the overlapping cDNA sequences were cloned and sequenced to construct the full-length genome. The full-length genome of SAAS-JDY5 consisted of 7225 nucleotides (nt), excluding the poly(A) tail at the 3 terminus, and contained three major ORFs. The genome comprised a 5 UTR of 26 nt (1–26), ORF-1 of 5109 nt (27–5135), ORF-2 of 1983 nt (5170–7152), ORF-3 of 342 nt (5159–5500) and a 3 UTR of 73 nt (7153–7225), followed by a poly(A) tail of 30 residues. ORF-2 and ORF-3 were defined according to Graff et al. (2006) and Huang et al. (2007). Phylogenetic analysis confirmed the classification of SAAS-JDY5 into genotype 3 HEV (Fig. 1). Similar topologies were obtained with ORF-1, 2- and 3-based phylogenetic analyses (data not shown). The phylogenetic tree revealed that SAAS-JDY5 was most closely related (90.8% sequence similarity) to a Japanese strain, wbJYG1 (AB222184), isolated from a wild boar. The ORF-1, ORF-2 and ORF-3 sequences of the two strains were 90.3%, 92.0% and 97.0% similar, respectively. The similarity between SAAS-JDY5 and the USA HEV strain Meng (AF082843), isolated from swine, was 87.0%. The percent nucleotide identity (PNI) of SAAS-JDY5 with isolates of genotype 1 ranged between 74.1% and 75.3%, between 75.5% and 76.3% for genotype 4 isolates, and was 74.6% in the case of a genotype 2 isolate from Mexico. The 26 nt of the 5 UTR and the 73 nt of the 3 UTR were obtained by 5 and 3 RACE, respectively. The 5 UTR sequence was ACGCGGGGGCAGACCACGTATGTGGTCGATGCC and the 3 UTR sequence was TTAATTCCTCCTGTGCCCCCTTCGTAGTCTTCTTTGCTTTATTTCTCTTTTCTGCTTTCCGCGCTCCCCGGAC. Alignment of the SAAS-JDY5 5 UTR with those of other available genotype 3 HEV strains revealed a high level of conservation. However, alignment of the 3 UTR of SAAS-JDY5 with six other genotype 3 HEV strains revealed the existence of several mutations in this part of the genome. SAAS-JDY5 resembled other genotype 3 isolates in having an ORF-2 with a TAA termination codon, but also had two additional nucleotides (AC) at the very end of the 3 -terminal preceding the poly-A tail. Furthermore, SAAS-JDY5 had a nucleotide deletion within this region at nt position 7189 whereas a G or C was present in other genotype 3 sequences. ORF-1 consisted of 5109 nucleotides (nt 27–5135) capable of encoding a protein of 1702 amino acids. This was four residues longer than the ORF-1 of HEV-US1 (genotype 3) but shorter than other genotype 3 swine and human isolates. SAAS-JDY5 exhibited only 76.4–84.5% identity with other genotype 3 isolates at the hyper-variable region of ORF-1 (date no shown). Percent nucleotide and amino acid identities of SAAS-JDY5 ORF-1 with ORF1 sequences of other human genotype 3 isolates ranged between 86.1–88.7% and 96.3–96.9%, respectively. When compared independently with the Japanese strain, wbJYG1, percent nucleotide identity and amino acid similarity values were 90.3% and 96.5%, respectively. ORF-1 motifs, i.e. the NTP-binding domains GVPGSGKS and DEAP in the putative helicase region, and the GDD site found in the RNA-dependent RNA polymerase, were conserved. When compared to other genotype 3 isolates, 15 unique amino acid substitutions and one deletion were observed. Substitutions were observed at the following amino acid positions: 465 (K to R), 598 (R to H), 739 (D to E), 766 (L to P), 870 (V to A), 929 (A to V), 930 (A to T), 961 (A to T), 969 (A to T), 1017 (R to W), 1298 (T to P), 1443 (F to L), 1558 (K to R), 1693 (L to P) and 1696 (S to P), and the Leu residue at position 1048 was deleted. ORF-2 of SAAS-JDY5 potentially encoded a protein of 660 amino acids of identical size to the corresponding protein of other human and swine genotype 3 HEVs. The N-terminal (residues 1–113) and Cterminal (residues 481–660) regions of the protein exhibited more variability than the central (residues 114–480) region. Substitutions
292
F.-s. Si et al. / Virus Research 144 (2009) 290–293
unique to SAAS-JDY5 were evident at positions 102 (S to P), 632 (T to A) and 649 (R to P). Percent nucleotide and amino acid identities of SAAS-JDY5 ORF-2 with ORF-2 sequences of other human genotype 3 isolates ranged between 88.7–90.8% and 97.6–98.9% respectively. When compared independently with the Japanese strain, wbJYG1, percent nucleotide identity and amino acid similarity values were 92% and 98%, respectively. The nucleotide homology between SAAS-JDY5 and SW-SH05, another strain isolated from a pig farm located in the Shanghai suburban area (Ning et al., 2007), was 93.3% when a 150 bp ORF-2 fragment was compared (data not shown). This suggests that either there were genetic variants among genotype 3 HEVs circulating within Shanghai pig farms or the strains were originally different. Alignment of the 150 bp ORF-2 fragments from wbJYG1 and SWSH05 revealed a nucleotide identity of 96.7% (data not shown), well above the 92.7% value observed when SW-SH05 and a US swine strain (AF082843) were compared (Ning et al., 2007). From these facts we postulate that genotype 3 HEVs in Shanghai were originally identical but underwent genetic changes during the environmental adaptation process. ORF-3 of SAAS-JDY5 consisted of 342 nucleotides (nt 5159–5500) encoding a protein of 113 amino acids. SAAS-JDY5 ORF-3 was defined here according to Graff et al. (2006) and Huang et al. (2007) and consequently was nine amino acids shorter than the formerly recognized consensus sequence of ORF-3 of genotype 3 HEVs. There was a C to T substitution at nt position 5145 in front of ORF-3. When compared with ORF-3 sequences of human genotype 3 isolates and with the Japanese strain, wbJYG1, the SAAS-JDY5 ORF-3 exhibited percent nucleotide identity values ranging between 93.8–98.1% and 97.0%, respectively. The amino acid sequence of SAAS-JDY5 ORF-3 was 92.6–98.4% and 94.3–98.4% identical to human and swine genotype 3 isolates, respectively. Although both genotypes 3 and 4 HEV exist in Shanghai, there was no obvious evidence to suggest that SAAS-JDY5 had integrated large pieces of genetic material from genotype 4 HEV. However, in the present study, unique features were found associated with the SAAS-JDY5 genome. For example, in addition to its length of 7225 nt, the SAAS-JDY5 genome had a single amino acid deletion within ORF-1 and 18 amino acid substitutions across all three ORFs. At the nucleotide level, SAAS-JDY5 exhibited one substitution and one deletion at positions 5145 and 7189 (3 UTR), respectively and contained an additional two nucleotides (AC) at the very end of the 3 -terminus preceding the poly-A tail of the genome. However, although all these deletions, mutations or substitutions demonstrated the variability of the genotype 3 HEVs in Shanghai, further studies are necessary to explore the underlying biological meaning of all these genomic variations.
Acknowledgements We thank Dr John Buswell, Institute of Edible Fungi, for linguistic revision of the manuscript. This work was supported by grants from the Shanghai Science and Technology Committee and from the Shanghai Agricultural Committee.
References
Fig. 1. Phylogenetic tree constructed by the neighbor-joining method based on the full-length nucleotide sequences of 88 hepatitis E virus isolates, using a chicken HEV isolate (AY535004) as the outgroup. GenBank accession numbers for the full genome are shown at each branch. Percent bootstrap support is indicated at each node. Bootstrap values are indicated for the major nodes as a percentage of the data obtained from 1000 re-samplings. The scale bar indicates a genetic distance of 0.05%
Bradley, D.W., 1992. Hepatitis E: epidemiology, aetiology and molecular biology. Rev. Med. Virol. 2, 19–28. Emerson, S.U., Purcell, R.H., 2003. Hepatitis E virus. Rev. Med. Virol. 13, 145–154. Favorov, M.O., Kosoy, M.Y., Tsarev, S.A., Childs, J.E., Margolis, H.S., 2000. Prevalence of antibody to hepatitis E virus among rodents in the United States. J. Infect. Dis. 181, 449–455. Favorov, M.O., Nazarova, O.K., Yashina, T.L., McCaustland, K., Fields, H.A., Margolis, H.S., 1996. Cattle as a possible reservoir of hepatitis E virus infection. In: Ninth Triennial International Symposium on Viral Hepatitis and Liver Disease, Rome, 21–25 April (Abstract A140).
F.-s. Si et al. / Virus Research 144 (2009) 290–293 Garkavenko, O., Obriadina, A., Meng, J., Anderson, D.A., Bernard, H.J., Schroeder, B.A., Khudyakov, Y.E., Fields, H.A., Croxson, M.C., 2001. Detection and characterization of swine hepatitis E virus in New Zealand. J. Med. Virol. 65, 525–529. Graff, J., Torian, U., Nguyen, H., Emerson, S., 2006. A bicistronic subgenomic mRNA encodes both the ORF2 and ORF3 proteins of hepatitis E virus. J. Virol. 80, 5919–5926. Hsieh, S.Y., Meng, X.J., Wu, Y.H., Liu, S.T., Tam, A.W., Lin, D.Y., Liaw, Y.F., 1999. Identity of a novel swine hepatitis E virus in Taiwan forming a monophyletic group with Taiwan isolates of human hepatitis E virus. J. Clin. Microbiol. 37, 3828–3834. Huang, F.F., Sun, Z.F., Emerson, S.U., Purcell, R., Shivaprasad, H.L., Pierson, F.W., Toth, T.E., Meng, X.J., 2004. Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV. J. Gen. Virol. 85, 1609–1618. Huang, Y.W., Opriessnig, T., Meng, X.J., 2007. Initiation at the third in-frame AUG codon of open reading frame 3 of the hepatitis E virus is essential for viral infectivity in vivo. J. Virol. 81, 3018–3026. Korkaya, H., Jameel, S., Gupta, D., Tyagi, S., Kumar, R., Zafrullah, M., Mazumdar, M., Lal, S.K., Xiaofang, L., Sehgal, D., Das, S.R., Sahal, D., 2001. The ORF3 protein of hepatitis E virus binds to Src homology 3 domains and activates MAPK. J. Biol. Chem. 276, 42389–42400. Li, Z., Yu, S., Dong, S., Zhu, Y., Si, F., Shen, S., Jiang, Z., Yu, R., Zou, S., 2009. Reduced prevalence of genotype 3 HEV in Shanghai pig farms and hypothetical homeostasis of porcine HEV reservoir. Vet. Microbiol. 137, 184–189. Maneerat, Y., Clayson, E.T., Myint, K.S., Young, G.D., Innis, B.L., 1996. Experimental infection of the laboratory rat with the hepatitis E virus. J. Med. Virol. 48, 121–128. Meng, X.J., Purcell, R.H., Haubur, P.G., Lehman, J.R., Webb, D.M., Tsareva, T.S., Haynes, J.S., Thacker, B.J., Emerson, S.U., 1997. A novel virus in swine is closely related to the human hepatitis E virus. Proc. Natl. Acad. Sci. USA 94, 9860–9865. Ning, H., Niu, Z., Yu, R., Zhang, P., Dong, S., Li, Z., 2007. Identification of genotype 3 hepatitis E virus in fecal samples from a pig farm located in a Shanghai suburb. Vet. Microbiol. 121, 125–130. Ning, H., Yu, S., Zhu, Y., Dong, S., Yu, R., Shen, S., Niu, Z., Li, Z., 2008. Genotype 3 hepatitis E has been widespread in pig farms of Shanghai suburbs. Vet. Microbiol. 126, 257–263. Nishizawa, T., Takahashi, M., Mizuo, H., Miyajima, H., Gotanda, Y., Okamoto, H., 2003. Characterization of Japanese swine and human hepatitis E virus isolates of genotype IV with 99% identity over the entire genome. J. Gen. Virol. 84, 1245–1251. Okamoto, H., Takahashi, M., Nishizawa, T., Fukai, K., Muramatsu, U., Yoshikawa, A., 2001. Analysis of the complete genome of indigenous swine hepatitis E virus isolated in Japan. Biochem. Biophys. Res. Commun. 289, 929–936.
293
Purcell, R.H., 1996. Hepatitis E virus. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, third ed. Lippincott-Raven, Philadelphia, PA, pp. 2831–2843. Purcell, R.H., Emerson, S.U., 2001. Hepatitis E virus. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Martin, M.A., Lamb, R.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, fourth ed. Lippincott Williams and Wilkins, Philadelphia, PA, pp. 3051–3061. Reyes, G.R., Purdy, M.A., Kim, J.P., Luk, K.C., Young, L.M., Fry, K.E., Bradley, D.W., 1990. Isolation of cDNA from the virus responsible for enterically transmitted non-A, non-B hepatitis. Science 247, 1336–1339. Schlauder, G.G., Mushahwar, I.K., 2001. Genetic heterogeneity of hepatitis E virus. J. Med. Virol. 65, 282–292. Tam, A.W., Smith, M.M., Guerra, M.E., Huang, C.C., Bradley, D.W., Fry, K.E., Reyes, G.R., 1991. Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 185, 120–131. Tsarev, S.A., Shrestha, M.P., He, J., Scott, R.M., Vaughn, D.M., Clayson, E.T., Gigliotti, S., Longer, C.F., Innis, B.L., 1998. Naturally acquired hepatitis E virus (HEV) infection in Nepalese rodents. Am. J. Trop. Med. Hyg. 59 (Suppl.), 242. Tyagi, S., Korkaya, H., Zafrullah, M., Jameel, S., Lal, S.K., 2002. The phosphorylated form of the ORF3 protein of hepatitis E virus interacts with its non-glycosylated form of the major capsid protein, ORF2. J. Biol. Chem. 277, 22759–22767. Tyagi, S., Surjit, M., Roy, A.K., Jameel, S., Lal, S.K., 2004. The ORF3 protein of hepatitis E virus interacts with liver-specific alpha1-microglobulin and its precursor alpha1-microglobulin/bikunin precursor (AMBP) and expedites their export from the hepatocyte. J. Biol. Chem. 279, 29308–29319. Usmanov, R.K., Balaian, M.S., Dvoinikova, O.V., Alymbaeva, D.B., Zamiatina, N.A., Kazachkov, IuA., Belov, V.I., 1994. An experimental infection in lambs by hepatitis E virus. Vopr. Virusol. 39, 165–168. Wang, Y., Ling, R., Erker, J.C., Zhang, H., Li, H., Desai, S., Mushahwar, I.K., Harrison, T.J., 1999. A divergent genotype of hepatitis E virus in Chinese patients with acute hepatitis. J. Gen. Virol. 80, 169–177. Wang, Y.C., Zhang, H.Y., Xia, N.S., Peng, G., Lan, H.Y., Zhuang, H., Zhu, Y.H., Li, S.W., Tian, K.G., Gu, W.J., Lin, J.X., Wu, X., Li, H.M., Harrison, T.J., 2002. Prevalence, isolation, and partial sequence analysis of hepatitis E virus from domestic animals in China. J. Med. Virol. 67, 516–521. Wei, S., Xu, Y., Wang, M., To, S.S., 2006. Phylogenetic analysis of hepatitis E virus isolates in southern China (1994–1998). J. Clin. Virol. 36, 103–110. Wu, J.C., Chen, C.M., Chiang, T.Y., Tsai, W.H., Jeng, W.J., Sheen, I.J., Lin, C.C., Meng, X.J., 2002. Spread of hepatitis E virus among different-aged pigs: two-year survey in Taiwan. J. Med. Virol. 66, 488–492. Zheng, Y., Ge, S., Zhang, J., Guo, Q., Ng, M.H., Wang, F., Xia, N., Jiang, Q., 2006. Swine as a principal reservoir of hepatitis E virus that infects humans in Eastern China. J. Infect. Dis. 193, 1643–1649.