Leukemia Virus integrase

Virology 421 (2011) 42–50

Contents lists available at SciVerse ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Functional analyses of mutants of the central core domain of an Avian Sarcoma/ Leukemia Virus integrase Julie Charmetant a, 1, Karen Moreau a, b, c, d, e, 1, Kathy Gallay a, b, c, d, e, Allison Ballandras a, c, f, Patrice Gouet a, c, f, Corinne Ronfort a, b, c, d, e,⁎ a

Université de Lyon, Lyon, France INRA, UMR754 Rétrovirus et Pathologie Comparée, UMS 3444/US8 Biosciences Gerland-Lyon Sud, Lyon, France Université Lyon 1, Lyon F-69007, France d Ecole Nationale Vétérinaire de Lyon, Marcy L'étoile F-69000, France e Ecole Pratique des Hautes Etudes, Lyon, France f CNRS, Institut de Biologie et Chimie des Protéines, Lyon F-69007, France b c

a r t i c l e

i n f o

Article history: Received 30 May 2011 Returned to author for revision 14 June 2011 Accepted 8 September 2011 Available online 6 October 2011 Keywords: ASLV Retrovirus Integrase Concerted DNA integration Mutants

a b s t r a c t Integrase (IN) is the enzyme responsible for the integration of the retroviral genome into the host cell DNA. Herein, three mutants of conserved residues (V79, S85 and I146) of the central core domain (CCD) of an Avian Sarcoma/Leukemia Virus IN were analyzed in vitro. Our data revealed (i) the inability of S85T mutant to form dimers and tetramers in the absence of DNA and (ii) a slightly reduced ability of V79A IN in tetramers formation. Surprisingly, both mutants were still able to efficiently achieve concerted DNA integration. This could be explained by the ability of the two mutants to form complexes in the presence of DNA. These data suggest a strong structural role of the region encompassing V79 and S85 residues (β2/β3 turn-β3 strands) following binding to viral DNA and highlight the dynamic nature of IN. © 2011 Elsevier Inc. All rights reserved.

Introduction Integration of genetic material into the host cell genome is common to all retroviruses and is indispensable for a productive retroviral infection (Engelman, 2010). Following retrovirus entry into the cell, the viral RNA genome is reversely transcribed into a double-stranded linear DNA in the cytoplasm. The resulting DNA molecule is actively transported to the nucleus as a component of the pre-integration complex (PIC), and serves as an immediate precursor for the integration reaction. The integration process can be subdivided into three steps. Firstly, during the initial 3′-processing step (which proceeds in the cytoplasm), the two 3′-terminal nucleotides of each viral end are cleaved to create the characteristic CA\OH 3′-ends, with a two-bases 5′ overhang. Secondly, during the strand transfer reaction (that proceeds in the nucleus), the 3′-hydroxyl ends of the viral DNA attack the phosphodiester bond in each strand of the cellular DNA at cleavage sites separated by 4–6 base pairs, depending on the retrovirus (Engelman, 2010). Finally, during the gap filling step, the 5′-overhanging dinucleotides of the viral DNA ends are removed and single-stranded DNA gaps are repaired, ⁎ Corresponding author at: INRA, UMR754 Rétrovirus et Pathologie Comparée, UMS 3444/US8 Biosciences Gerland-Lyon Sud, Lyon, France. Fax: + 33 437 287 605. E-mail address: [email protected] (C. Ronfort). 1 JC and KM contributed equally to this work. 0042-6822/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2011.09.008

creating a short duplication of host sequence. The size of the duplication is 4 to 6 bp; however, examples of size variations have been reported (Moreau et al., 2000). The 3′-processing and strand transfer steps are catalyzed by the viral integrase (IN) enzyme whereas the repair of DNA gaps most probably involves cellular enzymes (Espeseth et al., 2011; Smith and Daniel, 2006). The integration process is termed “concerted” because it allows the coupled integration of a pair of viral ends at the same site (within 4–6 bp) of the host DNA. Only two viral elements i.e. the IN protein and specific sequences at the ends, known as att (attachment) sequences are required for integration. A number of cellular proteins have been identified as binding partners for the IN of Avian Sarcoma/Leukemia viruses (ASLV) (Andrake et al., 2008; Greger et al., 2005), Moloney Murine Leukemia virus (Studamire and Goff, 2008) and Human Immunodeficiency Virus type 1 (HIV-1) (Al-Mawsawi and Neamati, 2007; Van Maele et al., 2006). Among them, the lens epithelium-derived growth factor (LEDGF/p75) is a critical factor that acts as a chromosomal receptor that tethers lentiviral IN and viral DNA to host DNA (Meehan and Poeschla, 2010). The IN enzyme consists of three domains, the N-terminal domain (NTD), the central core domain (CCD) and the C-terminal domain (CTD); all are necessary for its activities (Engelman et al., 1993; van Gent et al., 1993). The CCD is the most conserved domain (Bujacz et al., 1995). It contains a highly conserved motif composed of two aspartic

J. Charmetant et al. / Virology 421 (2011) 42–50

acids and one glutamic acid, the second aspartate invariably being separated from glutamic acid by 35 residues. This D,D(35)E motif constitutes the active site of the protein and has been shown to bind catalytic metal cations (Mg2+, Mn2+) (Bujacz et al., 1996). The CCD is involved in recognizing viral ends (Esposito and Craigie, 1998; Jenkins et al., 1997), binding to host DNA and influences the choice of the integration site (Diamond and Bushman, 2005; Konsavage et al., 2007). In the CCD, an active-site loop (144–153 in ASLV IN; 141–149 in HIV-1 IN) is found in close proximity to the catalytic site in the structures (Esposito and Craigie, 1998; Heuer and Brown, 1997). The formation of multimeric molecules is essential to correct IN function, as shown by trans-complementation experiments in vitro (Engelman et al., 1993; van Gent et al., 1993) and in vivo (Fletcher et al., 1997). Most data accumulated recently suggest that the IN complex functions as a tetramer (Faure et al., 2005; Hare et al., 2009a, 2009b, 2010; Kotova et al., 2010; Li et al., 2006; Maertens et al., 2003, 2010; Michel et al., 2009). Structures of fragments of IN from several different viral sources were solved by either crystallography or solution NMR methods (see Jaskolski et al., 2009 for review). Among them, single or double-domain structures of ASLV INs were published (Bujacz et al., 1995, 1996, 1997; Lubkowski et al., 1998a, 1998b, 1999; Yang et al., 2000). We have recently determined a new structure of the CCD of RAV-1 to 1.8 Å resolution which exhibited an unexpected new dimeric arrangement (Ballandras et al., 2011). Structures and images of the full-length IN complex were available only recently. At first, a particle image reconstruction by electronic microscopy of a tetramer of HIV-1 IN bound to DNA, at 27 Å resolution was published (Ren et al., 2007). After that, 3D models of negatively stained full-length HIV-1 IN, alone or complexed with the cellular cofactor LEDGF/p75 and either viral or cellular DNA, were proposed by electron microscopy (Michel et al., 2009). Last year, the crystal structure of the full-length IN from Prototype Foamy Virus (PFV) complexed with its cognate viral DNA (Hare et al., 2010) and with both viral and target DNA (Maertens et al., 2010) was determined. These structures led the authors to propose a model for the HIV-1 intasome (i.e. the minimal DNA-IN functional IN complex) assembled using the PFV structure as template (Krishnan et al., 2010). The architecture of the PFV intasome was markedly different from all previously reported models and the dimer–dimer interface stabilized by intermolecular NTD–CTD interactions. Finally, the use of small X-ray scattering (SAXS) and biochemical cross-linking analyses coupled with mass spectrometry showed that the full-length ASLV IN dimer in solution resembled that of the DNA-binding “inner” domain of the PFV intasome (Bojja et al., 2011). Altogether, these recent data suggest that the association of the intasome may be different from all previously reported models. IN mutants provide valuable tools both for deciphering the integration reaction and for further studying the multimeric complex. We previously introduced 30 single amino acid substitutions into an Avian Leukemia Virus named Rous-Associated Virus type 1 (RAV-1) IN and analyzed 3′-processing, strand transfer, and disintegration activities, as well as the DNA binding properties, of the resulting mutants (Moreau et al., 2002, 2003, 2004). In the present work, we chose three IN mutants carrying mutations on residues which are well-conserved in INs of retroviruses and retrotransposons (V79A, S85T and I146A) (Bujacz et al., 1995; Moreau et al., 2002). We examined the activities of these mutants on concerted DNA integration as well as the oligomeric status of the resulting proteins. Our data suggest an important structural role of the DNA in the formation of the oligomers. Results Structure-based description and activities features of the mutants The NTD, CCD and CTD of RAV-1 IN encompass residues 1–50, 51–207 and 208–286 respectively (Fig. 1A). Residues Val-79, Ser-85

43

and Ile-146 in the CCD are conserved residues among retroviruses and retrotransposons INs (Bujacz et al., 1995; Moreau et al., 2002) (Fig. 1A). Although no structural data for the full-length Rous-Associated Virus type 1 (RAV-1) IN is currently available, a dimeric structure containing the CCD–CTD of Rous Sarcoma Virus (RSV) IN has been determined at 2.5 Å resolution (PDB 1C0M) (Yang et al., 2000). The CCD consists of a five-stranded mixed β-sheet flanked by five α-helices and the two CCDs are related by a 2-fold symmetry axis in 1C0M, whereas the CTDs have a similar fold but associate in an asymmetric manner (Bujacz et al., 1995; Yang et al., 2000). RAV-1 IN has a 98% sequence identity with RSV IN and the 1C0M structure was used as the best model (Table 1). The crystal structure of PFV IN in complex with viral and target DNAs is known (Maertens et al., 2010). RAV-1 and PFV INs show a limited sequence identity of 15% on the entire protein and 23% on the CCD. Consequently, the CCDs were superimposed with an rmsd of 2.3 Å between Cα pairs and the macromolecular structure of PFV IN and DNAs was used as additional structural support in the study of RAV-1 IN mutants. The Val-79 residue is a buried residue which belongs to the β2 strand of the CCD in RSV IN (Fig. 1B). The main-chain carbonyl and the amide groups of Val-79 are hydrogen-bonded with those of the catalytic Asp-64 of strand β1 (catalytic residue, close-up view of Fig. 1B). Furthermore, the side-chain of Val-79 makes a van der Waals contact with that of residue Asp-64 (Table 1). Residue Val-79 corresponds to Val-144 in PFV IN, which side chain is also involved in a similar contact with the catalytic residue Asp-128. The hydrogen bonding pattern should be kept in the V79A mutant, whereas the contact between side chains of Ala-79 and Asp-64 should be lost (Table 1). Val-79 residue also has contacts with residue Ile-88 and Asn-160. The V79A mutation does not remove these contacts (Table 1). In contrast, contacts between residue Val-79 and surrounding residues Thr-66, Val-156, Leu-163 are also apparently lost in the mutant. Thus, the V79A substitution can have a direct effect on the conformation of Asp-64 and the activity of IN, as reflected by the reduction of the 3′ processing activity (30–60%) (Moreau et al., 2002). The Ser-85 residue is held in a tight β-turn which separates the β2 and β3 strands of the CCD (Fig. 1B). Its hydroxyl group stabilizes this turn by interacting with the main-chain amide of Ala-87 (Table 1). It is also hydrogen bonded to the imidazole ring of His-212 (Table 1 and close-up view of Fig. 1B) which belongs to the α6 helix connecting the CCD to the CTD. Residue Ser-85 corresponds to Thr-150 in PFV IN, which determines a van der Waals contact with Leu-269. This last corresponds to residue His-212 in RAV-1 IN and is equally part of the α6 helix. α6 is considered to be a hotspot in retroviral INs, because it could orientate the CTD with respect to the CCD during the integration process (Yang et al., 2000). The structural features of RAV-1 IN might be conserved in the S85T mutant as suggested by our 1C0M-based model (Table 1). However, the deficiency of S85T in DNA binding (Moreau et al., 2002) suggests that the S85T structure differs from that of the wild type. Ile-146 is a highly conserved residue located on the active-site loop (Acevedo et al., 2010). This loop is well ordered in 1C0M, the twodomain CCD–CTD structure of RSV IN (Yang et al., 2000). There, the side-chain of Ile-146 is exposed to the solvent and its main-chain is close to the fundamental Asp-121 of the catalytic site (Fig. 1B). Ile-146 residue has van der Waals contacts with residue Asn-122, Pro-147 and Ser-150 (Table 1). The I146A mutation removes the contacts with Ser-150 and Asn-122 (Table 1). Interestingly, residue Ile-146 corresponds to Thr-210 in PFV IN, within the active-site loop (PFV IN residues 211–220) which is involved in separating viral DNA strands in the vicinity of the active site (Hare et al., 2010). V79A, S85T and I146A have been characterized previously for their 3′-processing, strand transfer and disintegration activities using oligonucleotides that mimic the final 15 bp of the att sequence and compared with activities of the wild-type protein (Moreau et al., 2002). The level of 3′-processing activity of the V79A, S85T and I146A mutants was slightly reduced (30–60%) comparatively to that of the WT IN. The strand transfer activities of V79A and S85T were 60–90% to that of the WT while the

44

J. Charmetant et al. / Virology 421 (2011) 42–50

Fig. 1. Description of the IN mutants analyzed. (A). Structure-based sequence alignment between RAV-1 IN (personal sequence (GenBank ID: JF514545)) and HIV-1 IN (Uniprot P04585). Identities are written in white on a red background; similarities are written in red and boxed in blue. Secondary structural elements presented on the top of the aligned sequences have been calculated from the CCD–CTD structure of RSV IN (PDB 1C0M) using the program DSSP (Kabsch and Sander, 1983). Secondary structure elements presented on the bottom have been calculated from the NTD–CCD and the CCD–CTD structures of HIV-1 IN (PDB 1K6Y and 1EX4). Secondary structure elements observed in the NTD, CCD and CTD are colored in blue, green and red respectively. Helices, strands and turns are represented by squiggles, arrows and TT letters respectively. Green triangles on top of the aligned sequences mark the three studied mutations V79A, S85T and I146A in RAV-1 IN. Red stars show the invariant catalytic residues (DDE) of INs. The figure was drawn with ESPript (Gouet et al., 2003). (B). Ribbon representation of the dimeric CCD–CTD structure of RSV IN (PDB code 1C0M). The ribbon is color-ramped from the N-terminal part (blue) to the C-terminal (red) in the proximal monomer B. Mutation sites (green sticks) and catalytic residues (red sticks) are indicated. The three close-up views on the right hand side highlight important intramolecular contacts in the mutation sites Ser-85, Ile-146 and Val-79. Hydrogen-bonds are shown by a dashed line. Figure was created with PyMOL (DeLano, 2002).

transfer activity of the I146A IN mutant was close to that of the WT IN (N90%). Disintegration activities of all three mutants were also close to that of the wild-type protein (60–90% for S85T and N90% for V79A and I146A). The mutants were also tested for their ability to bind a small DNA substrate containing the att sequence. The viral DNA binding efficiency of I146A was similar to that of the wild type IN whereas that of the S85T mutant was reduced to 42% of the wild type protein IN. A slight

decrease of 20% in DNA binding efficiency was also observed with the V79A mutant (Moreau et al., 2002). Effects of IN mutations on concerted DNA integration The IN mutants were analyzed for their ability to perform two-ended concerted DNA integration using a reconstituted in vitro assay (Fig. 2).

J. Charmetant et al. / Virology 421 (2011) 42–50 Table 1 List of intramolecular contacts between side-chains in RAV-1 IN mutations sites. Contacts are for monomers A and B. No intermolecular contact was observed in these sites. Maximum contact distance between side-chains is 4 Å, residues in italic show contact distances b3.2 Å. V79 (A, B) Contacts

1C0M structure D64(B) T66(B) I88(B) V156(A,B) N160(A,B) L163(A,B)

1C0M-based model of V79A I88(B) N160(A,B)

S85 (A, B) Contacts

1C0M structure D82(A,B) A87(A,B) H212(A,B)

1C0M-based model of S85T D82(A,B) A87(A,B) H212(A,B)

I146 (A, B) Contacts

1C0M structure N122(B) P147(A,B) S150(A)

1C0M-based model of I146A P147(A,B)

The in vitro retroviral concerted integration assay has been previously described for ASLV by others (Aiyar et al., 1996; Chiu and Grandgenett, 2000, 2003; Grandgenett et al., 2009; Hindmarsh et al., 1999, 2001; Vora et al., 2004; Vora and Grandgenett, 2001) and by us (Moreau et al., 2003, 2004, 2009) as well as for HIV-1, Simian Immunodeficiency Virus (SIV) and PFV. Briefly, the system is composed of a linear donor DNA (D), a plasmid acceptor DNA, and recombinant IN. A donor DNA of 326 bp containing 15 bp of the terminal U3 att sequence at one end and 12 bp of the U5 att sequence at the other end (Fig. 2A) (Moreau et al., 2003, 2004) was used in this study. Products of the integration reaction can arise from concerted or non-concerted integration DNA processes (Fig. 2B). Concerted integration products include those that

A

result (i) from two-ended integration of both viral ends from a single donor at the same integration site (generating a circular product named circular full-site (cFS)) or (ii) from two one-ended integrations of two viral ends from two donors at the same integration site (generating a linear product (linear full-site (lin FS))). Non-concerted integration products result from one-ended donor integration of either a single donor (named half-site integration product (HS)) or of two or more donors at different sites on the acceptor DNA (multiple half-site products (mHS)). Other products resulting from two-ended integration of a single donor with insertion at different sites on the acceptor DNA (cHS) are also observed (Moreau et al., 2003, 2004). Autointegration products, which result from integration of one donor DNA into a second donor DNA, are also generated (D–D product). The in vitro integration products were analyzed in two ways. In the first assay, radiolabeled donor DNA was used and the integration products were separated on agarose gel and visualized by autoradiography. No integration products was observed when IN was absent (data not shown; refer to Moreau et al., 2003, 2009). By contrast, three characteristic mixes of bands were revealed with the WT IN (Fig. 3A, lane 1). The slowest migrating bands corresponded to a mix of circular forms (cFS, HS, cHS and mHS), the middle band corresponded to the linear linFS product, and the fastest migrating band corresponded to D–D autointegration products, as previously described (Moreau et al., 2003, 2004). The integration efficiency of each mutant was determined on gel by quantifying the intensity of bands corresponding to cFS, HS, cHS, mHS and linFS and in comparison to that of the wild-type protein (Fig. 3B, black bars).

U3

U5

AATGTAGTCTTATAC TTACATCAGAATATG

B

45

U3

supF

GAAGGCTTCATT CTTCCGAAGTAA

U5

donor DNA (D)

target DNA IN

INTEGRATION

circular full-site integration product (cFS)

linear full-site Integration product (linFS)

concerted integration

half-site integration products (HS)

multiple half-site Integration products (mHS)

two half-site and circular integration products (cHS)

D-D integration product

non-concerted integration

Fig. 2. Principle of the in vitro concerted DNA integration assay. (A). Representation of the donor DNA with 15 bp of the U3 viral end and 12 bp of the U5 viral end. The highly conserved CA dinucleotides are underlined. The closed rectangle represents the supF tRNA transcription unit. (B). In vitro assay. Schematic representation of the reconstituted integration reaction with the donor DNA (D), target plasmid and purified IN protein (Moreau et al., 2003, 2004). Concerted integration products include those that result from integration of both viral ends from a single donor (circular full-site integration product (cFS)) and those that result from integration of two viral ends from two donors at the same integration site (generating the linear fullsite integration product (linFS)). Non-concerted integration products result from one-ended integration of a single donor DNA (half-site integration product (HS)), from one-ended integration of two donor DNAs (multiple half-site integration product (mHS)) and from integration of two viral ends from one donor at two different sites (generating the circular Half-Site product (cHS)). Auto-integrants result from integration of donor DNA into a second donor DNA (D–D product).

46

J. Charmetant et al. / Virology 421 (2011) 42–50

B

I146A

S85T

mHS

V79A

WT

A

cFS

cHS

HS

140

linFS

percent of WT

120 100 80 60 40

D-D

20 0 WT

V79A

S85T

I146A

D 1

2

3

4

Fig. 3. Analysis of the integration products. (A). Integration reactions performed with wild type IN and mutants were analyzed by gel electrophoresis and visualized by autoradiography as previously described (Moreau et al., 2003, 2004, 2009). Schematized integration products are shown on the right (B). Quantification of integration products shown in (A), corresponding to linFS + cFS + HS + cHS + mHS integration products (black bars) and total number of colonies recovered after the reaction products were introduced into MC1061/P3 bacteria (white bars). Integration efficiency of the wild-type protein was set as 100%. The experiment was repeated at least three times and the standard deviation is indicated.

Gel analyses showed that the V79A and S85T mutations significantly reduced the whole integration efficiency (11% and 7% that of the wild-type IN, respectively) (lanes 2 and 3). Mutant I146A displayed lower integration efficiency than the wild-type protein (52%) (lane 4). In the second assay, the integration products were directly used to transform MC1061/P3 E. coli bacteria. These bacteria contain drug-resistance markers with amber mutations. Only DNA products carrying the amber mutation suppressor gene (supF) should be able to replicate and form colonies under drug selection. Among the different integration products, one-ended (HS) and multiple oneended donor integration products (mHS) and the linear products (linFS) are lost. Only circular two-ended forms of the integration products (cFS and cHS) are able to replicate (after repair of the gaps and overhangs in bacteria). Thus, the efficiency of IN proteins to mediate the two-ended integration process, whether concerted (cFS) or not (cHS), can be estimated by cloning analysis. Thus, the two-ended integration efficiency of each mutant was determined from the number of clones obtained in relation to the number of clones obtained with the wild type protein. Between 98 and 324 resistant colonies were obtained according to the experiment with the wild-type IN. The mutations of residue I146 drastically reduced the two-ended integration process (to 25% that of the wild type IN) (Fig. 3B; white bars). In contrast, the efficiency of the S85T mutant for two-ended donor integration was slightly reduced (80%) compared to that of the wild type IN. That of the V79A mutant was even less efficient (47% of the efficiency of the wild-type IN) (Fig. 3B). The difference in clones number between WT and S85T INs is not significant (Student test p = 0.81) but the difference between WT IN and V79A or I146A INs is significant (p = 0.0079 and p b 0.0001, respectively).

Cloning and sequencing of integration products The previous data suggest that mutants V79A and S85T are perturbed for overall integration activity (as determined by gel electrophoresis), but are still particularly adapted in two-ended concerted integration (as determined by bacterial transformation efficiency). To check the accuracy of integration performed by both mutants, several clones were picked up and the donor DNA–acceptor plasmid junctions of isolated integration products were sequenced. We could therefore discriminate between concerted (cFS) and non-concerted (cHS) integration products. With WT IN, eighteen clones were amplified and sequenced at the donor–target DNA junctions (Table 2). Eight clones exhibited a characteristic duplication of 6 bp of target DNA and five clones a duplication of other size (Table 2) that is 13 clones were of type cFS. Five clones (of type cHS), exhibited a deletion of target DNA at the integration sites varying from 317 to 1398 bp in size. Thus, most of the two-ended integration products obtained with the U3–U5 donor DNA and amplified in bacteria (13/18 i.e. 72.2%) (Table 2) resulted from a two-ended and concerted DNA integration event. With V79A and S85T INs, seventeen clones were sequences. 88.2% and 82.3% of clones generated by V79A and S85T INs were the result of a concerted integration process, respectively. The difference in clones number between each IN and another is not significant (Fisher's test p = 0.56). Therefore, both V79A and S85T INs were able to integrate the U3–U5 donor by an accurate two-ended concerted integration process as the WT IN. Effects of IN mutations on IN oligomerization ASLV and HIV INs are present as mono-, di-, and tetramers in solution, as shown by size exclusion chromatography, analytical

DNA-induced association of V79A and S85T INs

-BS3

Our results showed that two-ended DNA integration remained efficient (47% and 80% that of the WT IN for V79A and S85T, respectively)

KDa

M

+ BS3

WT WT

V79A S85T I146A

tetramer

150 100 75

dimer

50 37

monomer 1

2

3

4

5

Fig. 4. Protein–protein cross-linking of wild type IN and mutants. Proteins were incubated in the presence of BS3. Reaction products were analyzed on an 8% SDS polyacrylamide gel and revealed by silver staining. The migrations of monomers, dimers and tetramers are marked. −BS3: without BS3. M: mass marker with sizes (in kDa).

target high order forms tetramer

200 150 120 100 85 70 60 50 40

dimer

B

2

3

4

5

6

target

monomer 1

KDa M ultracentrifugation, and cross-linking (Andrake and Skalka, 1995; Bao et al., 2003; Coleman et al., 1999; Jones et al., 1992; Moreau et al., 2003, 2004). The three mutants were tested for their ability to form a complex by protein–protein cross-linking. In this experiment, the proteins were incubated with the Bis SulfoSuccinimidyl Suberate cross-linker (BS 3) and the reaction products were analyzed on SDS PAGE and revealed by silver staining. With wild-type IN and in the absence of the cross-linker, only the monomeric form of IN was observed (Fig. 4, lane 1). In the presence of BS 3, products with the expected molecular weights of IN monomers, dimers and tetramers as well as higher-order oligomeric forms (at the top of gel) were observed (Fig. 4, lane 2). Dimers were the main IN form. V79A IN was revealed as monomeric and dimeric complexes and a faint signal indicated that the proportion of tetrameric forms was reduced (Figs. 4, lane 3 and 5, lane 1). In contrast, the S85T protein was not crosslinked by BS 3 and only the monomeric form and a few dimers were observed on gel (Fig. 4, lane 4). I146A mutant was revealed as monomeric, dimeric and tetrameric complexes but a fainter signal indicated that the proportion of tetrameric forms may be slightly reduced (lane 5).

D2 + target

M

D2 + target

a After cloning integration reaction products into MC1061/P3 E. coli bacteria, several integration products were amplified and sequenced. Both donor–target DNA junctions were sequenced. The duplication of a short sequence of target DNA is the mark of a two-ended and concerted DNA integration process (having generated clones of type cFS). b A deletion of target DNA is the mark of a two-ended and non-concerted DNA integration process (having generated clones of type cHS). Deletions range from 317 to 1398 bp, 133 to 170 bp, and 254 to 1969 bp for WT, V79A and S85T INs, respectively. c Number of clones with a duplication of target sequences divided by total number of clones × 100.

KDa

D + target

8 6 3 17 82.3

D2

9 6 2 17 88.2

D + target

c

8 5 5 18 72.2

D2

Duplication of 6 bp Other size of duplication (2–7 bp) a Deletion b Total number of clones Percent of clones that are concerted

S85T

D

a

V79A

D

IN WT

no DNA

Target DNA at the integration site

A

no BS3

Table 2 Sequencing of donor–target junctions from clones obtained with the different INs.

47

no DNA

J. Charmetant et al. / Virology 421 (2011) 42–50

200 150 120 100 85 70 60 50 40

dimer

monomer 0

1

2

3

4

5

6

Fig. 5. Protein–protein cross-linking of IN mutants in presence of DNA substrates. 1.5 μg of IN proteins (45 pmol) were incubated overnight at 4 °C without (lane 1) or in presence of different DNAs substrates (0.6 pmol): the D donor DNA (lane 2), the D2 (pU3–ΔU5 (Moreau et al., 2009)) donor DNA (lane 3), the D + target DNAs (lane 4), the D2 + target DNAs (lane 5) and the target DNA alone (line 6). Reactions products were then analyzed as in Fig. 4. (A). V79A IN. (B). S85T IN. Here is shown a representative gel experiment.

(Fig. 3) despite the observation that S85T and V79A were impaired in dimer/tetramer and tetramers formation, respectively. It was previously observed that the assembly of the ASLV tetramer was induced upon interaction with a “disintegration” substrate, which represented a viral-host DNA integration intermediate (Bao et al., 2003). The oligomeric state of HIV-1 IN could also be affected by the presence of DNA (Deprez et al., 2001; Faure et al., 2005; Vercammen et al., 2002). Assuming that two-ended concerted integration is carried out by a tetramer (Faure et al., 2005; Hare et al., 2009a, 2009b, 2010; Kotova et al., 2010; Li et al., 2006; Maertens et al., 2003, 2010; Michel et al., 2009), our data could be explained by considering a role of viral DNA in assembling catalytically active V79A and S85T IN complexes. Thus, we used the crosslink approach to analyze the oligomeric forms of WT IN, V79A and S85T INs after binding to different DNA substrates: the U3– U5 (D) donor DNA, the D2 substrate (corresponding to pseudoU3–ΔU5 (Moreau et al., 2009) in which U3 was replaced by a mutated U3 and U5 was deleted) and the target DNA. IN proteins were mixed with donor or target DNAs or both and were incubated overnight at 4 °C before being cross-linked with the BS3. For WT IN, the addition of DNA did not change the equilibrium between monomers, dimers and tetramers (data not shown). In the absence of DNA, V79A IN exists in the solution in equilibrium between monomer and dimers (Figs. 4, lane 3 and 5A, lane 1). Addition of the U3–U5 donor DNA (lane 2), the D2 donor (lane 3), the target DNA (lane 6), the D + target DNA (lane 4), or the D2+ target DNA (lane 5) enhanced its oligomerization. Products with the expected molecular weights of IN tetramers as well as higherorder oligomeric forms were observed on the gel (Fig. 5A, lane 2 to 6). These results clearly indicate that binding of DNA (viral or not) induces V79A IN oligomerization. In the absence of DNA, S85T IN exists in the

48

J. Charmetant et al. / Virology 421 (2011) 42–50

solution mainly in the monomeric form (Figs. 4, lane 4 and 5B, lane 1). The incubation of S85T with DNA reproducibly led to a slight increase in the formation of dimeric forms (Fig. 5B, lanes 2 to 6), but the effect is less strong than the effect of DNA on enhancing the formation of higher oligomers of V79A.

Discussion The CCD domain of retrovirus INs have several features in common: (i) it contains a catalytic site formed by three acidic residues arranged in a highly conserved D,D(35)E and this motif has been shown to bind catalytic metal cations; (ii) it contains an active-site loop in the 35 residues spacer and (iii) it consists of a five-stranded mixed β-sheet flanked by five/six α-helices. Within the CCD, the active-site loop (144–153 in ASLV IN; 141–149 in HIV-1 IN; 211–220 in PFV IN) is found in close proximity to the catalytic site in the structures. This loop may achieve a fixed conformation when a DNA substrate (Yang et al., 2000) or an IN inhibitor (Lubkowski et al., 1998b) is bound. This loop is involved in viral DNA binding in the tetrameric models of HIV IN (Michel et al., 2009) and in the PFV intasome structure (Maertens et al., 2010). In the Rous Sarcoma Virus (RSV) IN, mutations were designed to alter the length the loop: most of the mutants had enzymatic activity in the presence of Mn2+ but were inactive with Mg2+ (Konsavage et al., 2008). In view of the importance of this loop, we further analyzed a mutant carrying a mutation in a conserved residue of the loop (I146A which corresponds to I141 in HIV1 IN and T210 in PFV IN). It was initially assumed that the mobility of the loop would not be drastically altered by substituting an isoleucine with a smaller residue such as alanine. Accordingly, the I146A IN displayed strand transfer and disintegration activities similar to those of the WT IN. The mutant also bound viral DNA with an efficiency similar to that of the WT IN (Moreau et al., 2002). However, the I146A IN was less efficient than the WT IN in performing the 3′-processing reaction (Moreau et al., 2002), the one-ended and two-ended concerted DNA integrations (Fig. 3) and was present as a mix of monomers, dimers and tetramers but with a slightly reduced ability to assemble as tetramers (Fig. 4). Finally, the decrease in one- and two-ended integration efficiencies might be related to its reduced efficiency in performing 3′-processing. The CCD has always been solved as a dimer in partial or entire IN structures (Jaskolski et al., 2009) and was shown to be involved in dimerization of the protein (Bujacz et al., 1995; Lubkowski et al., 1999). Accordingly, the S85G mutation of the RAV-1 IN produced a severe defect in multimerization (Andrake and Skalka, 1995). The relationship between IN oligomerization and activities, especially two-ended DNA integration activity, was further examined using two previously described V79A and S85T mutant (Moreau et al., 2002). These mutations have noticeable effects on IN properties: (i) the V79A and S85T mutants display a weak and strong reduction of DNA binding, respectively (Moreau et al., 2002); this observation was also previously reported for another S85 mutant (Katz et al., 1992); (ii) V79A and S85T INs displayed quite efficient strand transfer and disintegration activities (60–90% to that of the WT IN (Moreau et al., 2002)). V79A and S85T were also able to carry out 3′-processing of the DNA but less efficiently than the WT (efficiency is 30–60% that of the WT IN); furthermore, for both mutants, one-ended DNA integration was strongly reduced (Fig. 3); (iii) conversely, two-ended DNA integration remained efficient (47% and 80% that of the WT IN for V79A and S85T, respectively) (Fig. 3A); (iv) mutation of the S85 residue drastically impaired dimer and tetramer formation as revealed by cross-linking experiments (Fig. 4) and size exclusion chromatography (data not shown and (Andrake and Skalka, 1995)) while mutation of the V79 residue also reduced tetramer formation (although to a lesser extent than in S85T). According to the crystal structure of this CCD (either as an isolated domain or in the two domains RSV IN (CCD + CTD) (Bujacz et al., 1995; Yang et al., 2000)) and in the light of the PFV IN intasome

structure (Maertens et al., 2010), these two residues are not involved in contacts with another monomer (Table 1). Assuming that two-ended concerted DNA integration may be performed by a tetrameric form of IN (Bao et al., 2003; Faure et al., 2005; Li and Craigie, 2005; Li et al., 2006), the results with mutant S85T, and to a lesser extend with mutant V79A are striking. Based on our data, we speculate that V79A and S85T might recover a correct fold by forming high-order complexes in the presence of DNA. Interestingly, several other data suggested protein conformational changes after DNA substrate binding (Bao et al., 2003; Deprez et al., 2001; Vercammen et al., 2002; Zhao et al., 2008), or cleavage (Gao et al., 2001) or after metalbinding (Asante-Appiah and Skalka, 1997). A similar folding process can be observed during the binding of intrinsically non-structured proteins to their ligands (Dyson and Wright, 2005). Thus, we used the crosslink approach to analyze the oligomeric forms of these INs after binding to different DNA substrates and showed that binding of DNA (viral or not) induced V79A IN oligomerization (Fig. 5). Although the results were less clear for S85T, they suggested that binding of viral DNA could stimulate S85T dimers formation. Altogether, these data pointed to a role of DNA in assembling catalytically active IN complexes. Therefore, we hypothesize that binding of IN to DNA may induce a conformational change which would allow the recruitment of other IN molecules to form an active IN–DNA complex able to catalyze concerted integration of both ends. In that case, the β-turn between β2 and β3 strands of RAV-1 IN may play a critical role in this DNA-induced assembly. Conclusion Several recent data point to the dynamic nature of the IN complex, mainly modulated by linkers connecting the NTD, CCD and CTD domains (Bojja et al., 2011; Michel et al., 2009; Zhao et al., 2008). Our observations dissect further the dynamic nature of the IN by suggesting a DNA-induced assembly of IN complexes involving a CCD internal region (i.e. the β-turn between β2 and β3 strands). This part of IN may constitute a new target for anti-viral drugs developments. Materials and methods Molecular modeling Structural models of RAV-1 IN mutants were generated using the homology-modeling web server Geno3D (Combet et al., 2002). As RAV-1 IN shares 281 of its 286 amino acids with the Rous Sarcoma Virus (RSV) IN, the CCD–CTD structure of RSV IN (PDB 1C0M (Yang et al., 2000)) was used as a template by Geno3D for substitutions targeting the CCD of RAV-1 IN. The models obtained with Geno3D were displayed and analyzed on a graphic station using the program PyMOL (DeLano, 2002). Purification of proteins The RAV-1 IN coding sequences (wild type or mutants) were cloned into the pET30a plasmid (Invitrogen) downstream of the six histidine tag (Moreau et al., 2002). The INs were expressed in BL21 bacteria (Invitrogen), and purified as previously described (Moreau et al., 2004). DNAs The pBSK-Zeo (target DNA) and pBSK-supF plasmids have been described previously (Moreau et al., 2004). The U3–U5 donor DNA (D) was amplified from pBSK-supF by PCR using pfu turbo polymerase (Promega) and the following primers: U3bis (AATGTAGTCTTATACGTT GCCCGGATCCGG 3′) and U5bis (5′ AATGAAGCCTTCTGCTTTGAGCGTCGATTTTTG 3′) primers. The pU3–ΔU5 donor DNA (D2) was amplified with primers SUP1 (5′ AACGTTGCCCGGATCCGGTC 3′) and SUP3 (5′

J. Charmetant et al. / Virology 421 (2011) 42–50

CGCCGAATTCTTTCTCAACG 3′) (Moreau et al., 2009) The PCR product was purified on a Qiaquick column (Qiagen) as described by the supplier. The high-fidelity pfu turbo DNA polymerase (Promega) that generates bluntended PCR products was used. When necessary, donor DNA was radiolabeled all along the molecule by including 8 μCi of dCTPα32P in the PCR amplification mixture (Moreau et al., 2004). Integration reaction, gel analysis of the integration reaction and cloning of coupled integration products Integration reaction, gel analysis of the integration reaction and cloning of coupled integration products were carried out as previously described (Moreau et al., 2003, 2004) except that HMGI(Y) was omitted from the reaction. Protein–protein cross-linking Wild type or mutant INs were treated with BS3 [bis (Disuccinimidyl suberate)] (Pierce), as previously described (Moreau et al., 2003, 2004). Covalently linked multimers were detected by separation on 8% SDSpolyacrylamide gels and silver staining. In Fig. 5, IN (1.5 μg) was incubated overnight with 0.6 pmol of DNA (i.e. 125 ng of D or D2 and/or 1.25 μg of target DNA) before being treated with BS3. Acknowledgments This work was supported by research grants from the Institut National de la Recherche Agronomique and from the Region RhôneAlpes (Emergence grants). We thank Françoise Gounel for technical assistance and Dr Saw-See Hong for helpful discussions. References Acevedo, M.L., Arbildua, J.J., Monasterio, O., Toledo, H., Leon, O., 2010. Role of the 207– 218 peptide region of Moloney murine leukemia virus integrase in enzyme catalysis. Arch. Biochem. Biophys. 495 (1), 28–34. Aiyar, A., Hindmarsh, P., Skalka, A.M., Leis, J., 1996. Concerted integration of linear retroviral DNA by the avian sarcoma virus integrase in vitro: dependence on both long terminal repeat termini. J. Virol. 70 (6), 3571–3580. Al-Mawsawi, L.Q., Neamati, N., 2007. Blocking interactions between HIV-1 integrase and cellular cofactors: an emerging anti-retroviral strategy. Trends Pharmacol. Sci. 28 (10), 526–535. Andrake, M.D., Skalka, A.M., 1995. Multimerization determinants reside in both the catalytic core and C terminus of avian sarcoma virus integrase. J. Biol. Chem. 270 (49), 29299–29306. Andrake, M.D., Sauter, M.M., Boland, K., Goldstein, A.D., Hussein, M., Skalka, A.M., 2008. Nuclear import of Avian Sarcoma Virus integrase is facilitated by host cell factors. Retrovirology 5, 73. Asante-Appiah, E., Skalka, A.M., 1997. A metal-induced conformational change and activation of HIV-1 integrase. J. Biol. Chem. 272 (26), 16196–16205. Ballandras, A., Moreau, K., Robert, X., Confort, M., Merceron, R., Haser, R., Ronfort, C., Gouet, P., 2011. A Crystal Structure of the Catalytic Core Domain of an Avian Sarcoma and Leukemia Virus Integrase Suggests an Alternate Dimeric Assembly. PLoS One 6 (8), e23032. Bao, K.K., Wang, H., Miller, J.K., Erie, D.A., Skalka, A.M., Wong, I., 2003. Functional oligomeric state of avian sarcoma virus integrase. J. Biol. Chem. 278 (2), 1323–1327. Bojja, R.S., Andrake, M.D., Weigand, S., Merkel, G., Yarychkivska, O., Henderson, A., Kummerling, M., Skalka, A.M., 2011. Architecture of a full-length retroviral integrase monomer and dimer, revealed by small angle X-ray scattering and chemical cross-linking. J. Biol. Chem. 286 (19), 17047–17059. Bujacz, G., Jaskolski, M., Alexandratos, J., Wlodawer, A., Merkel, G., Katz, R.A., Skalka, A.M., 1995. High-resolution structure of the catalytic domain of avian sarcoma virus integrase. J. Mol. Biol. 253 (2), 333–346. Bujacz, G., Jaskolski, M., Alexandratos, J., Wlodawer, A., Merkel, G., Katz, R.A., Skalka, A.M., 1996. The catalytic domain of avian sarcoma virus integrase: conformation of the active-site residues in the presence of divalent cations. Structure 4 (1), 89–96. Bujacz, G., Alexandratos, J., Wlodawer, A., Merkel, G., Andrake, M., Katz, R.A., Skalka, A.M., 1997. Binding of different divalent cations to the active site of avian sarcoma virus integrase and their effects on enzymatic activity. J. Biol. Chem. 272 (29), 18161–18168. Chiu, R., Grandgenett, D.P., 2000. Avian retrovirus DNA internal attachment site requirements for full-site integration in vitro. J. Virol. 74 (18), 8292–8298. Chiu, R., Grandgenett, D.P., 2003. Molecular and genetic determinants of rous sarcoma virus integrase for concerted DNA integration. J. Virol. 77 (11), 6482–6492. Coleman, J., Eaton, S., Merkel, G., Skalka, A.M., Laue, T., 1999. Characterization of the self association of Avian sarcoma virus integrase by analytical ultracentrifugation. J. Biol. Chem. 274 (46), 32842–32846.

49

Combet, C., Jambon, M., Deleage, G., Geourjon, C., 2002. Geno3D: automatic comparative molecular modelling of protein. Bioinformatics 18 (1), 213–214. DeLano, W.L., 2002. PyMOL User's Manual DeLano Scientific, Palo Alto, CA, USA. Deprez, E., Tauc, P., Leh, H., Mouscadet, J.F., Auclair, C., Hawkins, M.E., Brochon, J.C., 2001. DNA binding induces dissociation of the multimeric form of HIV-1 integrase: a time-resolved fluorescence anisotropy study. Proc. Natl. Acad. Sci. U. S. A. 98 (18), 10090–10095. Diamond, T.L., Bushman, F.D., 2005. Division of labor within human immunodeficiency virus integrase complexes: determinants of catalysis and target DNA capture. J. Virol. 79 (24), 15376–15387. Dyson, H.J., Wright, P.E., 2005. Intrinsically unstructured proteins and their functions. Nat. Rev. Mol. Cell Biol. 6 (3), 197–208. Engelman, A., 2010. Reverse transcription and integration. In: Kurth, R., Bannert, N. (Eds.), Retroviruses: Molecular Biology, Genomics and Pathogenesis. Caister Academic Press, Norfolk, UK, pp. 129–159. Engelman, A., Bushman, F.D., Craigie, R., 1993. Identification of discrete functional domains of HIV-1 integrase and their organization within an active multimeric complex. EMBO J. 12 (8), 3269–3275. Espeseth, A.S., Fishel, R., Hazuda, D., Huang, Q., Xu, M., Yoder, K., Zhou, H., 2011. siRNA screening of a targeted library of DNA repair factors in HIV infection reveals a role for base excision repair in HIV integration. PLoS One 6 (3), e17612. Esposito, D., Craigie, R., 1998. Sequence specificity of viral end DNA binding by HIV-1 integrase reveals critical regions for protein–DNA interaction. EMBO J. 17 (19), 5832–5843. Faure, A., Calmels, C., Desjobert, C., Castroviejo, M., Caumont-Sarcos, A., Tarrago-Litvak, L., Litvak, S., Parissi, V., 2005. HIV-1 integrase crosslinked oligomers are active in vitro. Nucleic Acids Res. 33 (3), 977–986. Fletcher, T.M.r., Soares, M.A., McPhearson, S., Hui, H., Wiskerchen, M., Muesing, M.A., Shaw, G.M., Leavitt, A.D., Boeke, J.D., Hahn, B.H., 1997. Complementation of integrase function in HIV-1 virions. EMBO J. 16 (16), 5123–5138. Gao, K., Butler, S.L., Bushman, F., 2001. Human immunodeficiency virus type 1 integrase: arrangement of protein domains in active cDNA complexes. EMBO J. 20 (13), 3565–3576. Gouet, P., Robert, X., Courcelle, E., 2003. ESPript/ENDscript: extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic Acids Res. 31 (13), 3320–3323. Grandgenett, D.P., Bera, S., Pandey, K.K., Vora, A.C., Zahm, J., Sinha, S., 2009. Biochemical and biophysical analyses of concerted (U5/U3) integration. Methods 47 (4), 229–236. Greger, J.G., Katz, R.A., Ishov, A.M., Maul, G.G., Skalka, A.M., 2005. The cellular protein daxx interacts with avian sarcoma virus integrase and viral DNA to repress viral transcription. J. Virol. 79 (8), 4610–4618. Hare, S., Di Nunzio, F., Labeja, A., Wang, J., Engelman, A., Cherepanov, P., 2009a. Structural basis for functional tetramerization of lentiviral integrase. PLoS Pathog. 5 (7), e1000515. Hare, S., Shun, M.C., Gupta, S.S., Valkov, E., Engelman, A., Cherepanov, P., 2009b. A novel co-crystal structure affords the design of gain-of-function lentiviral integrase mutants in the presence of modified PSIP1/LEDGF/p75. PLoS Pathog. 5 (1), e1000259. Hare, S., Gupta, S.S., Valkov, E., Engelman, A., Cherepanov, P., 2010. Retroviral intasome assembly and inhibition of DNA strand transfer. Nature 464 (7289), 232–236. Heuer, T.S., Brown, P.O., 1997. Mapping features of HIV-1 integrase near selected sites on viral and target DNA molecules in an active enzyme–DNA complex by photocross-linking. Biochemistry 36 (35), 10655–10665. Hindmarsh, P., Ridky, T., Reeves, R., Andrake, M., Skalka, A.M., Leis, J., 1999. HMG protein family members stimulate human immunodeficiency virus type 1 and avian sarcoma virus concerted DNA integration in vitro. J. Virol. 73 (4), 2994–3003. Hindmarsh, P., Johnson, M., Reeves, R., Leis, J., 2001. Base-pair substitutions in avian sarcoma virus U5 and U3 long terminal repeat sequences alter the process of DNA integration in vitro. J. Virol. 75 (3), 1132–1141. Jaskolski, M., Alexandratos, J.N., Bujacz, G., Wlodawer, A., 2009. Piecing together the structure of retroviral integrase, an important target in AIDS therapy. FEBS J. 276 (11), 2926–2946. Jenkins, T.M., Esposito, D., Engelman, A., Craigie, R., 1997. Critical contacts between HIV-1 integrase and viral DNA identified by structure-based analysis and photocrosslinking. EMBO J. 16 (22), 6849–6859. Jones, K.S., Coleman, J., Merkel, G.W., Laue, T.M., Skalka, A.M., 1992. Retroviral integrase functions as a multimer and can turn over catalytically. J. Biol. Chem. 267 (23), 16037–16040. Kabsch, W., Sander, C., 1983. Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 22 (12), 2577–2637. Katz, R.A., Mack, J.P., Merkel, G., Kulkosky, J., Ge, Z., Leis, J., Skalka, A.M., 1992. Requirement for a conserved serine in both processing and joining activities of retroviral integrase. Proc. Natl. Acad. Sci. U. S. A. 89 (15), 6741–6745. Konsavage Jr., W.M., Sudol, M., Lee, N.E., Katzman, M., 2007. Retroviral integrases that are improved for processing but impaired for joining. Virus Res. 125 (2), 198–210. Konsavage Jr., W.M., Sudol, M., Katzman, M., 2008. Effects of varying the spacing within the D, D-35-E motif in the catalytic region of retroviral integrase. Virology 379 (2), 223–233. Kotova, S., Li, M., Dimitriadis, E.K., Craigie, R., 2010. Nucleoprotein intermediates in HIV-1 DNA integration visualized by atomic force microscopy. J. Mol. Biol. 399 (3), 491–500. Krishnan, L., Li, X., Naraharisetty, H.L., Hare, S., Cherepanov, P., Engelman, A., 2010. Structure-based modeling of the functional HIV-1 intasome and its inhibition. Proc. Natl. Acad. Sci. U. S. A. 107 (36), 15910–15915. Li, M., Craigie, R., 2005. Processing of viral DNA ends channels the HIV-1 integration reaction to concerted integration. J. Biol. Chem. 280 (32), 29334–29339. Li, M., Mizuuchi, M., Burke Jr., T.R., Craigie, R., 2006. Retroviral DNA integration: reaction pathway and critical intermediates. EMBO J. 25 (6), 1295–1304.

50

J. Charmetant et al. / Virology 421 (2011) 42–50

Lubkowski, J., Yang, F., Alexandratos, J., Merkel, G., Katz, R.A., Gravuer, K., Skalka, A.M., Wlodawer, A., 1998a. Structural basis for inactivating mutations and pH-dependent activity of avian sarcoma virus integrase. J. Biol. Chem. 273 (49), 32685–32689. Lubkowski, J., Yang, F., Alexandratos, J., Wlodawer, A., Zhao, H., Burke, T.R.J., Neamati, N., Pommier, Y., Merkel, G., Skalka, A.M., 1998b. Structure of the catalytic domain of avian sarcoma virus integrase with a bound HIV-1 integrase-targeted inhibitor. Proc. Natl. Acad. Sci. U. S. A. 95 (28), 4831–4836. Lubkowski, J., Dauter, Z., Yang, F., Alexandratos, J., Merkel, G., Skalka, A.M., Wlodawer, A., 1999. Atomic resolution structures of the core domain of avian sarcoma virus integrase and its D64N mutant. Biochemistry 38 (41), 13512–13522. Maertens, G., Cherepanov, P., Pluymers, W., Busschots, K., De Clercq, E., Debyser, Z., Engelborghs, Y., 2003. LEDGF/p75 is essential for nuclear and chromosomal targeting of HIV-1 integrase in human cells. J. Biol. Chem. 278 (35), 33528–33539. Maertens, G.N., Hare, S., Cherepanov, P., 2010. The mechanism of retroviral integration from X-ray structures of its key intermediates. Nature 468 (7321), 326–329. Meehan, A.M., Poeschla, E.M., 2010. Chromatin tethering and retroviral integration: recent discoveries and parallels with DNA viruses. Biochim. Biophys. Acta 1799 (3–4), 182–191. Michel, F., Crucifix, C., Granger, F., Eiler, S., Mouscadet, J.F., Korolev, S., Agapkina, J., Ziganshin, R., Gottikh, M., Nazabal, A., Emiliani, S., Benarous, R., Moras, D., Schultz, P., Ruff, M., 2009. Structural basis for HIV-1 DNA integration in the human genome, role of the LEDGF/P75 cofactor. EMBO J. 28 (7), 980–991. Moreau, K., Torne-Celer, C., Faure, C., Verdier, G., Ronfort, C., 2000. In vivo retroviral integration: fidelity to size of the host DNA duplication might be reduced when integration occurs near sequences homologous to LTR ends. Virology 278 (1), 133–136. Moreau, K., Faure, C., Verdier, G., Ronfort, C., 2002. Analysis of conserved and nonconserved amino acids critical for ALSV (Avian leukemia and sarcoma viruses) integrase functions in vitro. Arch. Virol. 147 (9), 1761–1778. Moreau, K., Faure, C., Violot, S., Verdier, G., Ronfort, C., 2003. Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro. Eur. J. Biochem. 270 (22), 4426–4438. Moreau, K., Faure, C., Violot, S., Gouet, P., Verdier, G., Ronfort, C., 2004. Mutational analyses of the core domain of Avian Leukemia and Sarcoma Viruses integrase: critical residues for concerted integration and multimerization. Virology 318 (2), 566–581.

Moreau, K., Charmetant, J., Gallay, K., Faure, C., Verdier, G., Ronfort, C., 2009. Avian sarcoma and leukemia virus (ASLV) integration in vitro: mutation or deletion of integrase (IN) recognition sequences does not prevent but only reduces the efficiency and accuracy of DNA integration. Virology 392 (1), 94–102. Ren, G., Gao, K., Bushman, F.D., Yeager, M., 2007. Single-particle image reconstruction of a tetramer of HIV integrase bound to DNA. J. Mol. Biol. 366 (1), 286–294. Smith, J.A., Daniel, R., 2006. Following the path of the virus: the exploitation of host DNA repair mechanisms by retroviruses. ACS Chem. Biol. 1 (4), 217–226. Studamire, B., Goff, S.P., 2008. Host proteins interacting with the Moloney murine leukemia virus integrase: multiple transcriptional regulators and chromatin binding factors. Retrovirology 5, 48. van Gent, D.C., Vink, C., Groeneger, A.A., Plasterk, R.H., 1993. Complementation between HIV integrase proteins mutated in different domains. EMBO J. 12 (8), 3261–3267. Van Maele, B., Busschots, K., Vandekerckhove, L., Christ, F., Debyser, Z., 2006. Cellular co-factors of HIV-1 integration. Trends Biochem. Sci. 31 (2), 98–105. Vercammen, J., Maertens, G., Gerard, M., De Clercq, E., Debyser, Z., Engelborghs, Y., 2002. DNA-induced polymerization of HIV-1 integrase analyzed with fluorescence fluctuation spectroscopy. J. Biol. Chem. 277 (41), 38045–38052. Vora, A., Grandgenett, D.P., 2001. DNase protection analysis of retrovirus integrase at the viral DNA ends for full-site integration in vitro. J. Virol. 75 (8), 3556–3567. Vora, A., Bera, S., Grandgenett, D., 2004. Structural organization of avian retrovirus integrase in assembled intasomes mediating full-site integration. J. Biol. Chem. 279 (18), 18670–18678. Yang, Z.N., Mueser, T.C., Bushman, F.D., Hyde, C.C., 2000. Crystal structure of an active two-domain derivative of Rous sarcoma virus integrase. J. Mol. Biol. 296 (2), 535–548. Zhao, Z., McKee, C.J., Kessl, J.J., Santos, W.L., Daigle, J.E., Engelman, A., Verdine, G., Kvaratskhelia, M., 2008. Subunit-specific protein footprinting reveals significant structural rearrangements and a role for N-terminal Lys-14 of HIV-1 Integrase during viral DNA binding. J. Biol. Chem. 283 (9), 5632–5641.