Functional analysis and tissue-differential expression of four FAD2 genes in amphidiploid Brassica napus derived from Brassica rapa and Brassica oleracea

Gene 531 (2013) 253–262

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Functional analysis and tissue-differential expression of four FAD2 genes in amphidiploid Brassica napus derived from Brassica rapa and Brassica oleracea Kyeong-Ryeol Lee a, Soo In Sohn a, Jin Hee Jung b, Sun Hee Kim a, Kyung Hee Roh a, Jong-Bum Kim a, Mi Chung Suh b, Hyun Uk Kim a,⁎ a b

Department of Agricultural Biotechnology, National Academy of Agricultural Science, RDA, Suwon 441-707, Republic of Korea Department of Bioenergy Science and Technology, Chonnam National University, Gwangju 500-757, Republic of Korea

a r t i c l e

i n f o

Article history: Accepted 29 August 2013 Available online 9 September 2013 Keywords: Brassica napus Brassica oleracea Brassica rapa FAD2 Oilseed rape Oleate 12-desaturase

a b s t r a c t Fatty acid desaturase 2 (FAD2), which resides in the endoplasmic reticulum (ER), plays a crucial role in producing linoleic acid (18:2) through catalyzing the desaturation of oleic acid (18:1) by double bond formation at the delta 12 position. FAD2 catalyzes the first step needed for the production of polyunsaturated fatty acids found in the glycerolipids of cell membranes and the triacylglycerols in seeds. In this study, four FAD2 genes from amphidiploid Brassica napus genome were isolated by PCR amplification, with their enzymatic functions predicted by sequence analysis of the cDNAs. Fatty acid analysis of budding yeast transformed with each of the FAD2 genes showed that whereas BnFAD2-1, BnFAD2-2, and BnFAD2-4 are functional enzymes, and BnFAD2-3 is nonfunctional. The four FAD2 genes of B. napus originated from synthetic hybridization of its diploid progenitors Brassica rapa and Brassica oleracea, each of which has two FAD2 genes identical to those of B. napus. The BnFAD2-3 gene of B. napus, a nonfunctional pseudogene mutated by multiple nucleotide deletions and insertions, was inherited from B. rapa. All BnFAD2 isozymes except BnFAD2-3 localized to the ER. Nonfunctional BnFAD2-3 localized to the nucleus and chloroplasts. Four BnFAD2 genes can be classified on the basis of their expression patterns. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Plant fatty acids are always synthesized from acetyl-CoA in plastids, and then acylated to glycerols to form glycerolipids, such as polar lipids and neutral lipids (Ohlrogge and Browse, 1995). In general, polyunsaturated fatty acids (PUFAs), such as linoleic acid (LA; 18:2Δ9,12) and αlinolenic acid (ALA; 18:3Δ9,12,15), are abundant in plant lipids. Because LA is a precursor of ALA, the synthesis of LA is the most important step for PUFA synthesis. Microsomal oleate 12-desaturase, commonly called fatty acid desaturase 2 (FAD2; EC 1.3.1.35), is responsible for the synthesis of LA (Okuley et al., 1994). This enzyme is localized in the endoplasmic reticulum (ER), accepts electrons from cytochrome b5, and then converts sn-2-oleoyl phosphatidylcholine (PC) into sn-2linoleoyl-PC (Shanklin and Cahoon, 1998). Therefore, the Arabidopsis fad2-1 mutant has low levels of PUFAs in phospholipids (Miquel and Abbreviations: PUFA, polyunsaturated fatty acid; LA, linoleic acid; ALA, α-linolenic acid; ER, endoplasmic reticulum; PC, phosphatidylcholine; UTR, untranslated region; MYA, million years ago; eYFP, enhanced yellow fluorescent protein; cDNA, DNA complementary to RNA; FAME, fatty acid methyl ester; BSA, bovine serum albumin; EDTA, ethylenediaminetetraacetic acid; SSC, sodium chloride-sodium citrate; SDS, sodium dodecylsulfate; kb, kilo base; nt, nucleotide; bp, base pair; aa, amino acid; QTL, quantitative trait loci; ORF, open reading frame; TM, transmembrane; DAP, days after pollination. ⁎ Corresponding author. Tel.: +82 31 299 1703; fax: +82 31 299 1672. E-mail address: [email protected] (H.U. Kim). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.08.095

Browse, 1992), and the limited fluidity of its cell membranes prevent this mutant from surviving at a low temperature (6 °C) (Miquel et al., 1993). The FAD2 gene was first identified from Arabidopsis thaliana (Okuley et al., 1994), with FAD2 genes subsequently identified from oil crops such as soybean (Glycine max; Heppard et al., 1996; Li et al., 2007; Tang et al., 2005), sunflower (Helianthus annuus; Hongtrakul et al., 1998), cotton (Gossypium hirsutum; Liu et al., 1999; Pirtle et al., 2001; Zhang et al., 2009), sesame (Sesamum indicum; Jin et al., 2001), peanut (Arachis hypogaea; Lopez et al., 2000; Jung et al., 2000), olive (Olea europaea; Hernandez et al., 2005), flax (Linum usitatissimum; Krasowska et al., 2007; Khadake et al., 2009), camelina (Camelina sativa; Kang et al., 2011), Chinese cabbage (B. rapa ssp. pekinensis; Jung et al., 2011), and table grape (Vitis labrusca; Lee et al., 2012). Two or more FAD2 genes were cloned and characterized in all of these plants, except sesame. Nonetheless, Southern blot analysis suggested that additional FAD2 genes might exist in sesame (Jin et al., 2001). Plant FAD2 genes comprise two exons and one intron that are located in the 5′untranslated region (UTR; Okuley et al., 1994). Three histidine boxes (H boxes) are crucial for FAD2 desaturase activity. Displacement of even one of the histidines in these three H boxes can disrupt desaturase activity (Shanklin et al., 1994; Kurdrid et al., 2005). The biotechnological relevance of FAD2 relates to its importance in controlling the level of unsaturation of seed oil. High oleic vegetable oils, which are stable to oxidation and have a low potential to turn

254

K.-R. Lee et al. / Gene 531 (2013) 253–262

rancid, are favored for food and industrial purposes, such as for frying food at high temperatures and producing biodiesel (Warner and Knowlton, 1997; Graef et al., 2009). Several Brassica species, including oilseed rape, mustard, cabbage, Chinese cabbage, broccoli, cauliflower, and turnip, are commercially important vegetable crops throughout the world. In particular, rapeseed oil obtained from Brassica napus is one of the most important vegetable oils. According to the Food and Agriculture Organization (FAO), in 2012 the global cultivation area of oilseed rape was 34,257,051 ha, and the production quantity of oilseed rape was 64,813,233 M/T (http://faostat3. fao.org/home/index.html). Almost all seeds from members of the Brassicaceae contain large proportions of very-long-chain monounsaturated fatty acids, including erucic acid (22:1Δ13). In conventional rapeseed oil, erucic acid accounts for about 50% of the fatty acids. Although the high-erucic rapeseed oil is useful for certain industrial applications, consumption of erucic acid causes heart disease in humans and animals. In addition, conventional rapeseed contains glucosinolates, another antinutritional component. Varieties of B. napus with a low content of erucic acid and glucosinolates were bred by mutation of FAE1, with the process culminating in the generation of canola, which has limited amounts of erucic acid and glucosinolates (Stefansson et al., 1961). Oleic acid levels in canola seed are about 60–70%, with the increase occurring at the expense of reduced levels of the antinutritional component erucic acid (Katavic et al., 2002). B. napus (AACC genome, 2n = 38) is an amphidiploid (or allotetraploid) species that originated from spontaneous hybridization of B. rapa (AA genome, 2n = 20) and B. oleracea (CC genome, 2n = 18) (U, 1935). It is estimated that the Arabidopsis genus and Brassica genus diverged from a common ancestral plant at 17–18 million years ago (MYA; Yang et al., 2006). After this event, whole genome triplication was estimated to have first occurred at approximately 13–17 MYA in Brassicaceae (Yang et al., 2006) and then B. oleracea and B. rapa diverged at approximately 3.75 MYA (Inaba and Nishio, 2002). Finally, B. napus emerged as a consequence of synthetic hybridization of these two species at approximately 5000–10,000 years ago (U.N., 1935; Rana et al., 2004; Xiong et al., 2011). This suggests that B. napus has multiple FAD2 genes. Scheffler et al. (1997) reported that the B. napus genome encodes four FAD2 genes and six FAD3 genes. Schierholt et al. (2000) attributed that the high oleic acid content in mutant oilseed rape is attributed to a fad2 mutation, and estimated that B. napus may have either four or six FAD2 genes. The recent release of a draft genome sequence of B. rapa (The Brassica rapa Genome Sequencing Project Consortium, 2011) has facilitated the ease with which genetic information, such as the nucleotide sequence on Brassica crops, can be obtained. Based on the genome sequence database for B. rapa and B. oleracea (Cheng et al., 2011; http://brassicadb.org/brad), Yang et al. (2012) reported that B. napus may have four FAD2 genes originated from two genes of B. rapa and B. oleracea, respectively. Resolution of the copy number and other features of BnFAD2 genes should be of value in efforts to control the expression of FAD2 in B. napus seed for industrial purposes. In this study, we cloned four FAD2 genes from B. napus, and also analyzed the FAD2 genes of B. rapa and B. oleracea. The production of LA in yeast transformed with three of the BnFAD2 genes confirmed their predicted functions, although one of the genes was nonfunctional. Our findings confirm that B. napus has four FAD2 genes, and that these originated from two FAD2 genes from B. rapa and two FAD2 genes from B. oleracea.

Center, National Institute of Crop Science (NICS), Rural Development Administration (RDA) and the National Agrobiodiversity Center, National Academy of Agricultural Science (NAAS), RDA, respectively. Chinese cabbage seed was kindly provided by Dr. Jin A. Kim, Department of Agricultural Biotechnology, NAAS, RDA. Nicotiana tabacum cv. Xanthi plants that were approximately four week old were used for transient expression of FAD2 genes to determine the subcellular localizations of the enzymes they encode. 2.2. Preparation of genomic DNA and total RNA Tissues of B. napus, B. rapa, and B. oleracea were ground under liquid nitrogen. The Plant RNA Purification Reagent (Invitrogen, CA, USA) was used for RNA preparation following the manufacturer's protocol. Extraction of DNA preparation was performed as described by Dellaporta et al. (1983). 2.3. Gene cloning Given that all putative BnFAD2 genes have identical 20-bp sequences at the 5′ and 3′ ends of their coding sequences, all of the BnFAD2 genes could be amplified with the same pair of primers, KOD+ polymerase (Toyobo, Japan), and genomic DNA as a template. The primers used in this research are listed in Table 1. The PCR products were extracted using a QIAEX II gel extraction kit (Qiagen, Germany), and the eluted DNA was cloned into pCR-Blunt II-TOPO vector (Invitrogen, CA, USA), following the manufacturer's instructions. 2.4. Sequence analysis and phylogenetic analysis DNASTAR MegAlign (Ver. 7.2.1) was used to assess the similarities of FAD2 genes, and the ClustalW method was used to establish the phylogenetic relationships between FAD2 isozymes. Amino acid sequences were analyzed using a program in the Aramemnon Plant Membrane Protein Database (http://aramemnon.botanik.uni-koeln.de/seq_viewBlast.ep) and TMHMM server (http://www.cbs.dtu.dk/services/TMHMM/), as well as the TMpred server (http://www.ch.embnet.org/software/ TMPRED_form.html) to identify transmembrane domains. Subcellular sites of localization were predicted using the PSORT prediction (http:// psort.hgc.jp/form.html) and WoLF PSORT (http://wolfpsort.org/). 2.5. Gene-specific PCR and semi-quantitative RT-PCR to characterize FAD2 isozymes Primer sequences and amplicon sizes are listed in Table 1. For genomic PCR, FAD2 isozyme gene-specific PCR condition was as follows: 94 °C for 5 min, 25 cycles of 94 °C for 20 s, 54 °C for 30 s, and 72 °C for 30 s, and an additional extension at 72 °C for 5 min. For RT-PCR, the number of cycles was increased to 30 cycles. Semi-quantitative RT-PCR reactions were carried out as follows. First strand cDNA synthesis included 2 μg of total RNA and components of the PrimeScript II 1st strand cDNA synthesis kit (Takara, Japan) provided at the concentrations recommended by the manufacturer. After the first strand cDNA synthesis, PCR was performed with 2 μl of cDNA and 1 U of Ex Taq polymerase (Takara, Japan) in 20 μl of reaction volume. PCR conditions and primers were identical to those described above. Bactin primers (Yao et al., 2005) can amplify the highly conserved region of all Brassica actin genes.

2. Materials and methods 2.6. Vector construction 2.1. Plant materials Oilseed rape (B. napus cv. Youngsan), Chinese cabbage (B. rapa ssp. pekinensis var. Chiifu), and cabbage (B. oleracea var. capitata IT100498) were grown under greenhouse conditions at approximately 25 °C. Rapeseed and cabbage seed were obtained from the Bioenergy Crop Research

The BnFAD2 in. F and R primers were designed for the subcloning of BnFAD2 genes into a yeast expression vector using the In-fusion enzyme (Clontech, CA, USA) (Table 1). The PCR products were cloned into pENTR/D-TOPO (Invitrogen, CA, USA) digested with NotI and AscI through the In-fusion reaction. The pENTR/BnFAD2s and pYES-DEST52

K.-R. Lee et al. / Gene 531 (2013) 253–262

255

Table 1 Primers used in this research. Capital letters and small letters of nucleotide sequences represent gene-specific sequences and sequences used for subcloning, respectively. ‘n’ in the sequence represents any nucleotide, A, C, G, or T. Numbers in parentheses indicate amplicon sizes for the BnFAD2-3 gene. Primer name

Sequence (5′-3′)

Amplicon size (bp)

Purpose

BnFAD2 F BnFAD2 R BnFAD2 in. F BnFAD2 in. R Sc-BnFAD2 F Sm-BnFAD2-1,2,4R Sm-BnFAD2-3R BnFAD2-1 sp F BnFAD2-1 sp R BnFAD2-2 sp F BnFAD2-2 sp R BnFAD2-3 sp F BnFAD2-3 sp R BnFAD2-4 sp F BnFAD2-4 sp R Bactin F Bactin R

ATGGGTGCAGGTGGAAGAATGCAA TCATAACTTATTGTTGTACCAGAA gcaggctccgcggccATGGGTGCAGGTGGAAGAAT agctgggtcggcgcgTCATAACTTATTGTTGTACCAGAAC nngagctcATGGGTGCAGGTGGAAGA nncccgggTAACTTATTGTTGTACCAGAACACA nncccgggTGGATGTACTTCCAGGAGAAGT GTCCCCAAGAAGAAGTCACA CAATCCCACTCAGACGAGT GTCCCCAAGAAGAAGTCAGA GATCAACACGAGGAAACCA CCTCTTCGACATCATCATCTC TCCGTAGACACAGACCACAG CTAACCGTCCAGTTCACG GAGGAAACAGTTGACAATCAT TGGCATCACACTTTTCTACAA CAACGGAATCTCTCAGCTCC

1155 (1141) 1185 (1171) 1168 (422)

Cloning of ORF

vectors (Invitrogen, CA, USA), which each contains the galactoseinducible Gal promoter, URA3 gene, and elements essential to the Gateway method, were then reacted with LR clonase (Invitrogen, CA, USA). Finally, the destination vector pYES-BnFAD2s was used to express BnFAD2 genes in Saccharomyces cerevisiae. In-fusion reaction and the LR reaction were performed according to the manufacturer's protocol. To observe subcellular localization of BnFAD2 isozymes, BnFAD2 genes without stop codons were subcloned into the pFAST plant binary vector, which harbors the CaMV 35S promoter and enhanced yellow fluorescent protein (eYFP). These were inserted between the SmaI and SacI sites upstream of eYFP.

Subcloning into yeast expression vector Subcloning into transient expression vector

398

FAD2 isozyme gene-specific

339

PCR

613 258 515

Amplification of Brassica actin gene

2.10. Fatty acid analysis For lipid extraction, harvested yeast cells were lyophilized for 24 h. Samples were transmethylated at 90 °C for 90 min in 0.3 ml of toluene and 1 ml of 5% H2SO4 (v/v) in methanol. After transmethylation, 1.5 ml of 0.9% NaCl solution was added, and the fatty acid methyl esters (FAMEs) were transferred to a new tube for three sequential extractions with 1.5 ml of n-hexane. The FAMEs were analyzed by gas chromatography using a GC-2010 plus instrument (Shimadzu, Japan) with a 30 m × 0.25 mm (inner diameter) HP-FFAP column (Agilent, USA) while increasing the oven temperature from 170 °C to 180 °C at 1 °C/min. Nitrogen was used as carrier gas at a flow rate of 1.4 ml/min.

2.7. Transient expression and subcellular localization 3. Results and discussion Four Agrobacterium tumefaciens GV3101 clones that each contained one of the BnFAD2 coding regions cloned in-frame into pBnFAD2:eYFP were infiltrated into the abaxial sides of the leaves of N. tabacum cv. Xanthi using a 1 ml syringe without a needle (Sparkes et al., 2006). Transient expression in epidermal tissues of the infiltrated region was assessed. Fluorescence signal was evaluated 48 h after infiltration, and analyzed using a TCS SP5 AOBS/Tandem laser confocal scanning microscope (Leica, Germany). 2.8. Southern blot analysis Approximately 20 μg of genomic DNA was digested with HindIII, SacI, and XbaI for 20 h, and was then electrophoresed through a 0.8% agarose gel. The gel was sequentially soaked in depurination solution (0.2 M HCl) for 15 min, in denaturation solution (0.4 M NaOH, 1 M NaCl) for 20 min, and then in neutralization solution [0.5 M Tris–HCl (pH 7.5), 1 M NaCl], before being blotted onto a Hybond-N+ nylon membrane (GE Healthcare, USA). Transferred DNA was hybridized in Church buffer [1% BSA, 7% EDTA, 7% SDS, 0.5 M phosphate buffer (pH 7.2)] containing 100 pg/ml denatured salmon sperm DNA and the BnFAD2-1 gene probe labeled with [α-32P]dCTP, for 20 h at 65 °C. The membrane was washed in 2× SSC, 0.5% SDS for 20 min at 65 °C, and then in 0.5× SSC, 0.1% SDS for 20 min at 37 °C. It was exposed to Xray film for more than 12 h. 2.9. Yeast transformation S. cerevisiae INVSc-1 (Invitrogen, CA, USA) was used for the expression of BnFAD2 and subsequent production of LA. Yeast transformation was carried out in accordance with the manufacturer's manual, and yeast culture and induction of BnFAD2 were performed following Covello and Reed (1996).

3.1. Sequence analysis of four FAD2 genes from B. napus Interrogation of GenBank (http://www.ncbi.nlm.nih.gov/genbank/) using the Arabidopsis FAD2 gene sequence as the query sequence identified three putative full-length FAD2 genes from B. napus: GenBank ID AF243045, AY577313, and AY592975. The nucleotide sequences of the three BnFAD2 genes, and amino acid sequences of the proteins they encode are very similar. In particular, more than 20 bp at the 5′ and 3′ ends of the coding sequences of all three BnFAD2 genes are identical. This enabled us to design primers that can be used to amplify all BnFAD2 genes. An approximately 1.1-kb PCR product was cloned into the pCR-Blunt II TOPO vector. Sequencing results of 22 randomly selected clones showed that B. napus actually has four FAD2 genes, named BnFAD2-1 through BnFAD2-4. Whereas the BnFAD2-1, BnFAD2-2, and BnFAD2-4 genes have the intact FAD2 gene structure and each encode proteins that are 384 amino acids long, BnFAD2-3 is a pseudogene with a range of nucleotide deletions (1 nt at 164 bp, 15 nt at 231 bp, and 1 nt at 409 bp) and insertions (2 nt at 180 bp and 1 nt at 1009 bp). Translation of the coding sequence of BnFAD2-3 is predicted to be terminated by a stop codon formed at 411 bp as a result of a frameshift starting at the 164 bp position (Fig. 1A; Yang et al., 2012). The nucleotide identity between BnFAD2-1 and BnFAD2-2 is 97.2%, and that between BnFAD2-3 and BnFAD2-4 is 96.8% (Fig. 1B). In contrast, the nucleotide identities between BnFAD2-1 and either BnFAD2-3 or BnFAD2-4 are less than 90%. Unlike the nucleotide identity, the deduced amino acid of BnFAD2-3 shows at most 60.3% identity with those of the three BnFAD2 genes because of frame shifts caused by mutations. In contrast, the three functional BnFAD2 genes show at least 90.4% amino acid identity (Fig. 1B). The single-copy AtFAD2 gene of Arabidopsis shows higher nucleotide and amino acid identities with BnFAD2-1 and BnFAD2-2 than with BnFAD2-3 and BnFAD2-4 (Fig. 1B). For genomic

256

K.-R. Lee et al. / Gene 531 (2013) 253–262

(a)

ATG

BnFAD2-1 BnFAD2-2 BnFAD2-4

* 384 AA 1155

1

ATG

*

BnFAD2-3 (non-function)

136AA 1 164 231 180

409 411

1009

(b)

(c)

(kb) H3 Xb Sc 21

97.2 88.2 89.2 85.5

BnFAD2-1

88.9 89.7 86.2

BnFAD2-2 99.0 BnFAD2-3 54.4 54.4

96.8 81.4 (nt)

BnFAD2-4 90.4 90.6 60.3 AtFAD2

1141

82.5

5 4.3

90.3 90.6 50.7 84.9

3.5

(aa)

Fig. 1. Structures of the ORFs of BnFAD2 genes and identities among BnFAD2 genes. (a) The ORFs of the BnFAD2-1, BnFAD2-2, and BnFAD2-4 genes are 1155 bp each in size, and each is predicted to encode a 384-amino-acid size protein. However, the size of the BnFAD2-3 ORF is only 411 bp owing to several nucleotide insertion and deletion events. Open circles, solid circles, and asterisks represent deletions, insertions, and stop codons, respectively. (b) Sequence identity (%) at the levels of nucleotide (nt) sequences and their deduced amino acid (aa) sequences of AtFAD2 gene and BnFAD2 genes. (c) Genomic Southern blot analysis of B. napus DNA. Four hybridizing bands were detected. H3, HindIII; Xb, XbaI; Sc, SacI.

Southern blot, HindIII, SacI, and XbaI that do not cut within coding region of four BnFAD2 genes were used to digest genomic DNA. Genomic Southern blot of B. napus using BnFAD2-1 gene as a probe revealed at least four hybridizing bands (Fig. 1C). 3.2. Confirmation of the origins of BnFAD2 genes by isozyme gene-specific PCR Analysis of BnFAD2 genes using the BLASTN suggested that the BnFAD2-1 and BnFAD2-3 genes originated from B. rapa and that the BnFAD2-2 and BnFAD2-4 genes originated from B. oleracea (Table 2). In spite of the extensive identity between BnFAD2 genes, it was possible to design gene-specific primer pairs that amplified differently sized gene-specific amplicons using the same PCR amplification conditions (Materials and Methods section). Accordingly, four bands with the expected sizes were amplified from B. napus genomic DNA using the isozyme gene-specific primers, and two sets of distinctive bands were amplified from genomic DNA prepared from each of B. rapa and B. oleracea. Collectively, the four fragments amplified from each of B. rapa and B. oleracea corresponded in size with those amplified from B. napus (Fig. 2). Sequencing of these gene-specific PCR products demonstrated that all PCR products were identical to their specific genes.

99.8% identical. The BrFAD2-1 and BrFAD2-2 genes are located between 21,375,638 and 21,376,792 bp of chromosome A5, and between 26,538,478 and 26,539,618 bp of chromosome A1, respectively. Whereas BoFAD2-1 is 99.5% identical to BnFAD2-2, BoFAD2-2 is 99.9% identical to BnFAD2-4. The BoFAD2-1 and BoFAD2-2 genes are located between 30,350,782 and 30,351,936 bp of chromosome C5, and between 36,185,278 and 36,186,432 bp of chromosome C1, respectively. Reported data support the location and the number of BnFAD2 genes. Scheffler et al. (1997) reported that BnFAD2 genes mapped to linkage groups N1, N5, N11, and N15, which correspond with B. napus Table 2 Comparison of homologous FAD2 genes from B. napus, B. rapa, and B. oleracea obtained from GenBank and this research (GenBank ID JN859550-3). The identities between the BnFAD2 gene and each homologous FAD2 gene are almost 100% at both the nucleotide and amino acid levels. In case of BnFAD2-3 and its homologous genes, the deduced amino acid sequence is predicted to be truncated prematurely at 136 amino acid residue, however the deduced sequences of the truncated proteins are identical. Gene

Homologous gene

Accession no.

BnFAD2-1

B. napus FAD2 B. rapa FAD2 B. rapa FAD2-1 B. napus FAD2 B. napus FAD2 B. oleracea FAD2-1 B. napus FAD2 B. rapa FAD2-2 B. napus FAD2 B. oleracea FAD2-2

FJ907398 AJ459107 JN859550 FJ952144 FJ907397 JN859552 GQ259897 JN859551 FJ907401 JN859553

BnFAD2-2

3.3. Identification of FAD2 genes of B. rapa and B. oleracea BnFAD2-3

Interrogation of the Brassica database (http://brassicadb.org/brad/) with the sequences of the four BnFAD2 revealed that BnFAD2-1 and BrFAD2-1 are 98.4% identical, and that BnFAD2-3 and BrFAD2-2 are

BnFAD2-4

Identity (%) Nucleotide

Amino acid

99.3 99.2 98.3 100.0 99.9 99.6 99.8 99.8 99.9 99.3

99.2 99.2 99.2 100.0 100.0 100.0 100.0 100.0 100.0 99.2

K.-R. Lee et al. / Gene 531 (2013) 253–262

B. napus (bp)

1

2

3

B. rapa 4

1

2

3

257

B. oleracea 4

1

2

3

4

700 600 500 400 300 200

(bp) 700 600 500 400 300 200

Fig. 2. BnFAD2 gene-specific PCR of B. napus, B. rapa, and B. oleracea. It was carried out using their genomic DNA as template. Lanes 1 to 4 indicate BnFAD2-1 through BnFAD2-4, respectively, each amplified using gene-specific primers. The sizes of amplicons generated by gene-specific PCR are listed in Table 1.

chromosomes A1, A5, C1, and C5, respectively. Hu et al. (2006) identified two quantitative trait loci (QTL) for LA content in B. napus, whereas a QTL with a major effect mapped to A5, a QTL with a minor effect mapped to A1. Smooker et al. (2011) reported that BnFAD2 loci mapped to A5, C1, and C5. However, the effect on LA content of BnFAD2 genes in C genome was not clear. Yang et al. (2012) also identified four FAD2 genes in A1, A5, C1, and C5 chromosomes of B. napus. In addition, they reported that the FAD2 gene in A1 is a pseudogene that can have little effect on the level of LA and that FAD2 gene in A5 has a strong effect on the level of LA inferring from a cultivar which this gene was mutated contains low level of LA and high level of oleic acid. Sequence analysis shows that BrFAD2-2 and BnFAD2-3 shared all of the same mutations described above. It has been suggested that the BrFAD2-2 gene had already mutated before the generation of B. napus, with mutations estimated to have occurred between 3.75 MYA (the estimated time of divergence of today's Brassica crops; Inaba and Nishio, 2002) and 10,000 years ago (the estimated time of B. napus hybridization; Cheung et al., 2009). To predict the nucleotide sequence and structures of BnFAD2 genes, BrFAD2 and BoFAD2 genes were analyzed. The 1152-bp ORF of AtFAD2 encodes a 383-amino acid protein. A 1344-bp intron lies within the 92-bp 5′-UTR (Okuley et al., 1994). Similarly, the BrFAD2-1 gene comprises a 1155-bp ORF than encodes 384 amino acids, with a 1088-bp intron from position −1092 to position −5 within the 5′-UTR (Fig. 3). The 409-bp ORF of BrFAD2-2 gene encodes a 136-amino acid product (Fig. 1A; Yang et al., 2012), with a 618-bp intron from position −626 to position −9 within the 5′-UTR (Fig. 3). Because the respective nucleotide sequences of BrFAD2-1 and BrFAD2-2 are highly similar to those of BnFAD2-1 and BnFAD2-3, it is presumed that BnFAD2-1 and BnFAD2-3 were originated from BrFAD2-1 and BrFAD2-2, respectively. In particular, the deletions and the insertions of nucleotide that occur at precisely the same positions in BnFAD2-3 and BrFAD2-2 suggested that BnFAD2-3 originated from BrFAD2-2, which represents a pseudogene arising after mutation. The sizes of the ORFs of BoFAD2-1 and BoFAD2-2 are identical (each 1155 bp and encoding 384 amino acids), and they each have a single intron within their 5′ UTRs. The 1125-bp intron in BoFAD2-1 extends from position −1129 to position −5 relative to the start codon, whereas the 972-bp intron in BoFAD2-2 extends from position −980 to position −9 relative to the start codon (Fig. 3). The BoFAD2-1 and BnFAD2-2 coding sequences differ by only 5 nt, and share nucleotide and amino acid identities of 99.6% and 100%, respectively. The BoFAD2-2 and BnFAD2-4 coding sequences differ by 8 nt, and share nucleotide and amino acid identities of 99.3% and 99.2%, respectively. Sequences of BrFAD2-1 and BrFAD2-2 were registered in NCBI GenBank, with the GenBank ID JN859550 and JN859551, respectively. Sequences of BoFAD2-1 and BoFAD2-2 were registered in NCBI GenBank, with the GenBank ID JN859552 and JN859553, respectively.

1998). Fig. 4 shows that BnFAD2-1, BnFAD2-2, and BnFAD2-4 have the same transmembrane domains and H boxes as those found in AtFAD2. In case of BnFAD2-3 the deduced amino acid sequence differs from that of BnFAD2-1, BnFAD2-2 and BnFAD2-4 to residue 136 after which a stop codon is predicted to result in a premature truncation of the BnFAD2-3 protein. The H box motif is found in all acyl-lipid desaturases, with the conserved motifs HX(3–4)HH, HX(2–3)HH, and HX(2–3)HH, found sequentially from the N-terminus to the C-terminus (Okuley et al., 1994; Los and Murata, 1998). The sequences of the H boxes of BnFAD2 isozymes are HECGHH (closest to the N-terminus), HRRHH, and HVAHH (closest to the C-terminus), with all of these sequences aligning with the conserved motifs (Fig. 4). Sequence analysis predicts that, like AtFAD2, BnFAD2 contains six TM domains, as previously reported for AtFAD2. Notwithstanding its location in ER membranes, FAD2 lacks an ER retention signal peptide with the consensus motif (H/R/K)DEL at its C-terminus. Arabidopsis FAD2 localizes to the ER membrane by virtue of the aromatic-amino-acid-enriched signal peptide YNNKL at its Cterminus (Okuley et al., 1994). McCartney et al. (2004) reported that the ER retrieval motif of ER membrane-bound fatty acid desaturase in plant is ΦXX(K/R/D/E)Φ at their C-termini, where Φ is the hydrophobic

-1092

-5

Intron (1088 bp) ATG

-626

-9 Intron

Plant FAD2 is an ER-localized membrane-bound protein with six transmembrane (TM) domains and the histidines in three H boxes bound with two Fe2+ ions (Okuley et al., 1994; Shanklin and Cahoon,

Stop

411

1141

A1

BrFAD2-2

(618 bp) ATG

-1129

A5

BrFAD2-1

Stop

-5

1155

Intron (1125 bp)

C5

BoFAD2-1 ATG

Stop

-980 -9 Intron (972 bp)

1155

BoFAD2-2 ATG

3.4. Sequence analysis of the deduced amino acid sequences encoded by BnFAD2 genes

1155

C1 Stop

Fig. 3. The structures of BrFAD2 genes and BoFAD2 genes including introns within their 5′UTRs. A5, A1, C5, and C1 indicate chromosomes in B. rapa (A genome) or B. oleracea (C genome). The BrFAD2-2 gene is a pseudogene owing to early termination of its translation in the same position (at 411 bp) as that of the BnFAD2-3 gene. Chromosome number and the intron/exon junction site are similar between orthologs the BrFAD2-1 and BoFAD2-1, as well as the orthologs BrFAD2-2 and BoFAD2-2. Gray indicates 5′-UTR.

258

K.-R. Lee et al. / Gene 531 (2013) 253–262

Fig. 4. Alignment of deduced amino acids of BnFAD2 and AtFAD2. Black and gray backgrounds represent the identical and similar amino acid residues, respectively. Gray and open boxes indicate transmembrane domains (TM) and H boxes, respectively. The broken line at the C-terminal end of the alignment denotes the ER retrieval motif.

amino acid such as F, Y, W, I, L and V. The ER retrieval motif of all three BnFAD2 isozymes (YNNKL) is the same as that of Arabidopsis. 3.5. Analysis of phylogenetic relationships The phylogenetic relationships between deduced amino acid of plant FAD2 genes have, in general, indicate that FAD2 isozymes are differently grouped in accordance with their expression pattern, although two or more FAD2 genes are usually found in the same plant species. However, the FAD2 isozymes found in the members of the Brassicaceae are highly similar and they appear to belong to the FAD2 group of constitutive type only (Fig. 5). The data also suggest that an ancestral plant of Brassica and Arabidopsis might have lost its seed type FAD2 gene prior to 17–18 MYA, which is the estimated time since the divergence of Brassica and Arabidopsis (Yang et al., 2006). 3.6. Expression patterns of FAD2 genes of B. napus, B. rapa, and B. oleracea To confirm the expression pattern of FAD2 genes from B. napus, RTPCR was carried out using specific primers (Fig. 6). Northern blot analysis of BnFAD2 genes was not suitable for this task owing to the high homologies of the four BnFAD2 genes to one another. Total RNAs used for RT-PCR analysis were extracted from leaves, stems, roots, flowers, seedlings at 5 days after imbibition (DAI), and developing seeds at 22 days after pollination (DAP), 33 DAP, and 44 DAP. In polyploid plants generated by hybridization, expression of one of the duplicated genes tends to be silenced, or down-regulated compared to the gene expression of parent plants (Adams et al., 2003, 2004). To establish whether the tissue specificity or level of expression of BnFAD2 genes was influenced by polyploidization, FAD2-specific RT-PCR was performed on RNA samples prepared from B. rapa and B. oleracea (Fig. 6). The BnFAD2-1 and

BnFAD2-2 genes are expressed in all tissues, although BnFAD2-3 and BnFAD2-4 are expressed in certain tissues, specifically developing seeds and root. Moreover, BnFAD2-3 and BnFAD2-4 transcripts were much less abundant than BnFAD2-1 and BnFAD2-2 transcripts. The fragments specific to the BnFAD2-2 and BnFAD2-4 transcripts were not amplified in B. rapa, and the fragments specific to the BnFAD2-1 and BnFAD2-3 transcripts were not amplified in B. oleracea. The BrFAD2-1 (BnFAD2-1) and BoFAD2-1 (BnFAD2-2) transcripts are also expressed constitutively in B. rapa and B. oleracea, respectively. The BrFAD2-2 (BnFAD2-3) and BoFAD2-2 (BnFAD2-4) transcripts are expressed more abundant in developing seeds than in other tissues in B. rapa and B. oleracea, respectively. It was expected that all BnFAD2 genes would be expressed constitutively (Fig. 5). However, the observation that not all BnFAD2 genes are expressed ubiquitously demonstrated that the expression of BnFAD2 genes can be divided into two broad categories. Given that phylogenetic analysis classified all Brassicaceae FAD2 as belonging to the constitutive type (Fig. 5), it can be predicted that Brassicaceae FAD2 genes have evolved from a common FAD2 gene of an ancestral plant, which is expressed in all plant tissues. Although most FAD2 isozymes from Brassicaceae belong to the constitutive type, a few FAD2s within the Brassicaceae clade are classified differently owing to their different expression patterns. The seed type isoforms, BnFAD2-4 and BoFAD2-2 are grouped separately from other Brassica FAD2 isoforms, and CsFAD2-2, which also belongs to the seed type group and is from C. sativa (Kang et al., 2011), is clustered separately from CsFAD2-1 and -3 (Fig. 5). CsFAD2-2 is expressed mainly in developing seed and also expressed to a low level in stem and inflorescence. Similarly, BnFAD2-3 and BnFAD2-4 are expressed in developing seeds and root. Differences between the introns of genes that encode different FAD2 isoforms might also account for differences in their expression profiles.

K.-R. Lee et al. / Gene 531 (2013) 253–262

Constitutive type Brassicaceae Seed type

259

and VlFAD2-2 (seed type) genes are 2724 bp and 1749 bp, respectively (Lee et al., 2012). Therefore, it is tempting to speculate that the relative differences in the sizes of the introns of FAD2 genes might influence of the extent to which they are expressed specifically in developing seeds. It should also be noted that the cis-regulatory elements within the introns are quite different between FAD2 genes with different expression patterns. Searches for cis-regulatory elements within the intron of the BrFAD2-1 gene using PlantCARE (http://bioinformatics.psb.ugent. be/webtools/plantcare/html/; Lescot et al., 2003) identified 56 cisregulatory elements that span 17 different types, with far fewer ciselements and less diversity in the type of cis-element found in the intron of the BrFAD2-2 gene. In addition, 13 types of cis-regulatory element within the intron of BrFAD2-1 gene are not present in the intron of the BrFAD2-2 gene. It might be that these differences affect tissue-related expression profiles and the level of transcript accumulation. These results suggest that one FAD2 gene of an ancestor of members of the Brassicaceae accounts for the divergence of the seed type and constitutive type FAD2 isoforms seen in Brassica and Camelina. The patterns of expression of the BnFAD2 genes are indistinguishable from those of the BoFAD2 and BrFAD2 genes. The levels of expression of the BnFAD2 genes are also similar to those of the BoFAD2 and BrFAD2 genes. This suggests that synthetic hybridization has not affected the level of expression of FAD2 genes. 3.7. Subcellular localization of BnFAD2

To confirm FAD2 function, the budding yeast S. cerevisiae INV-Sc1 was transformed with the yeast expression vector pYES-DEST52 that

Seedling Leaf Stem Root Flower DAP22 DAP33

DAP44

B. rapa DAP33

Flower

DAP22

Stem

Root

Leaf

M

B. napus

3.8. BnFAD2 genes synthesize LA in S. cerevisiae

B. oleracea

M

Promoter-proximal introns, such as the intron found in FAD2 genes, have been reported to have a strong effect on the regulation of gene transcription (Furger et al., 2002; Le Hir et al., 2003; Kim et al., 2006). Notwithstanding the similarities of the ORFs of Brassica FAD2 genes, the sequences of their introns are far more divergent. For example, the intron size of the B. rapa FAD2-1 gene (1088 bp) is much larger than that of B. rapa FAD2-2 gene (618 bp) (Fig. 3). Out of the genes from the Brassicaceae clade, the intron sizes of VlFAD2-1 (constitutive type)

DAP33 DAP44 Seedling

Fig. 5. Phylogenetic relationships of the deduced amino acid sequences from FAD2 proteins from various plants FAD2, including the products of BnFAD2 genes. Seed type FAD2 and constitutive FAD2 proteins are separated. This tree was constructed by DNASTAR MegAlign program using the ClustalW method. X-axis scale bar indicates the number of amino acid substitutions per 100 amino acids. Ah, Arachis hypogaea; At, Arabidopsis thaliana; Bc, Brassica carinata; Bj, Brassica juncea; Bof, Borago officinalis; Br, Brassica rapa; Bol, Brassica oleracea; Cs, Camelina sativa; Ct, Carthamus tinctorius; El, Euphorbia lagascae; Gm, Glycine max; Gh, Gossypium hirsutum; Ha, Helianthus annuus; Jc, Jatropha curcas; Lu, Linum usitatissimum; Oe, Olea europaea; Rc, Ricinus communis; Si, Sesamum indicum; So, Spinacia oleracea; Vf, Vernicia fordii; Vl, Vitis labrusca.

The subcellular localization of the BnFAD2 isozyme was investigated by inoculating N. tabacum cv. Xanthi leaves with A. tumefaciens GV3101 that harbors eYFP fused BnFAD2, and using confocal microscopy to observe the patterns of transient expression. Three of the BnFAD2 isozymes, but not BnFAD2-3, have shown to be localized in the networklike organelle (Fig. 7A). Although GFP:HDEL is localized in the ER and the image is closely similar to that of three of BnFAD2 isozymes, it was not confirmed definitely that three of BnFAD2 isozymes are localized in the ER. Localization of functional FAD2 enzymes in the ER has been reported in the case of Arabidopsis FAD2 (Dyer and Mullen, 2001), and B. rapa FAD2-1:GFP (Jung et al., 2011). In the case of cotton FAD2-4: GFP (Zhang et al., 2009) was similar to this study. Therefore, three of BnFAD2 isozymes are expected to be localized in the ER. However, BnFAD2-3 localized to the nucleus and chloroplasts, most likely as a consequence of a frame shift mutation that causes termination of its translation (Fig. 7B). Accordingly, the PSORT and WoLF PSORT algorithms predicted that BnFAD2-3 would localize to the nucleus and chloroplast, respectively.

Root Flower DAP22

FAD6

DAP44 Seedling Leaf Stem

FAD3

BnFAD2-1

398 bp

BnFAD2-2

339 bp

BnFAD2-3

613 bp

BnFAD2-4

258 bp

Bactin

515 bp

Fig. 6. Expression patterns of FAD2 genes from B. napus, B. rapa, and B. oleracea. Four BnFAD2 genes are expressed in B. napus, and two different BnFAD2 genes are expressed in B. rapa and B. oleracea. Constitutive and seed type expression of FAD2 genes was shown for all of the genes in B. napus, B. rapa, and B. oleracea. M, 100 bp molecular marker, DAP22, DAP33 and DAP44, developing seed at 22; 33; and 44 days after pollination, respectively.

260

K.-R. Lee et al. / Gene 531 (2013) 253–262

(a)

YFP

Merged

Bright

BnFAD2-1:YFP

BnFAD2-2:YFP

BnFAD2-4:YFP

GFP-HDEL

(b)

YFP

Chlorophyll

Bright

Merged

BnFAD2-3:YFP

Fig. 7. Subcellular localization of BnFAD2 fused to YFP at its N-termini after inoculation of leaves of N. tabacum cv. Xanthi with Agrobacterium. Except for BnFAD2-3, all of the BnFAD2 isozymes tested were localized in the ER. Mutated BnFAD2-3 was localized in the nucleus and chloroplast (green and yellow in the merged image, respectively). Bar indicates 20 μm.

was modified to express each of the four BnFAD2 genes separately. The pYES2 vector containing the URA gene found in the pYES-DEST52 vector was used as control vector because of the unsuitability of using pYESDEST52 harboring both ccdB gene and a chloramphenicol resistance gene as a control. Fatty acid analysis demonstrated that yeast harboring any of the BnFAD2-1, BnFAD2-2, or BnFAD2-4 genes produced LA as well as 16:2, which is not present at detectable levels in wild-type yeast. However, yeast that harbored the pYES2 vector carrying the BnFAD2-3 coding sequence did not produce LA (Fig. 8). This confirmed that the BnFAD2-1, BnFAD2-2, and BnFAD2-4 genes are functional, whereas, as expected, BnFAD2-3 is a pseudogene that lost its activity as a consequence of mutation.

of the constitutive type, BnFAD2-3 and BnFAD2-4 genes belong to the seed type. The expression patterns of the original FAD2 genes of B. rapa and B. oleracea are similar to those of BnFAD2 genes, although the level of expression of the original FAD2 genes from B. rapa and B. oleracea differ from those of the BnFAD2 genes. In conclusion, B. napus contains three functional FAD2 genes and one nonfunctional FAD2 gene. Among these four FAD2 genes in B. napus, two originated from B. rapa and other two originated from B. oleracea.

3.9. Conclusion

Acknowledgments

This report describes the cloning of four BnFAD2 genes and their functional characterization in yeast. Sequence analyses of three BnFAD2 genes demonstrated that they have features of typical ERlocalized fatty acid desaturases. However, translation of the BnFAD2-3 transcript was predicted to be terminated prematurely owing to mutation. As predicted, functional analysis in yeast revealed that whereas three of the BnFAD2 genes were functional, the BnFAD2-3 gene was not functional. Analysis of the expression patterns of the BnFAD2 genes demonstrated that whereas BnFAD2-1 and BnFAD2-2 genes are

We are grateful to Dr. Jin A Kim and Ms. Mina Jin (Department of Agricultural Biotechnology, NAAS, RDA, Republic of Korea) for kindly providing the B. rapa seeds and the genome sequences of B. rapa and B. oleracea, respectively. This study was conducted with the support of the Research Program for Agricultural Science & Technology Development (project no. PJ006715), the National Academy of Agricultural Science, Rural Development Administration, and the NextGeneration BioGreen 21 Program, Republic of Korea (SSAC, grant no. PJ009484).

Conflict of interest The authors have declared that no conflict interests exist.

K.-R. Lee et al. / Gene 531 (2013) 253–262

Fig. 8. Chromatograms of fatty acids extracts from yeasts harboring pYES-BnFAD2-1 through pYES-BnFAD2-4. Yeast harboring either BnFAD2-1, BnFAD2-2, or BnFAD2-4 could produce LA (18:2) as well as 16:2. Yeast harboring pYES2 (blank vector) or BnFAD2-3 produced only 16:0, 16:1, 18:0 and 18:1, and did not produce LA and 16:2. FID, flame ionization detector.

References Adams, K.L., Cronn, R., Percifield, R., Wendel, J.F., 2003. Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proc. Natl. Acad. Sci. U. S. A. 100 (8), 4649–4654. Adams, K.L., Percifield, R., Wendel, J.F., 2004. Organ-specific silencing of duplicated genes in a newly synthesized cotton allotetraploid. Genetics 168 (4), 2217–2226. Cheng, F., et al., 2011. BRAD, the genetics and genomics database for Brassica plants. BMC Plant Biol. 11, 136. Cheung, F., et al., 2009. Comparative analysis between homoeologous genome segments of Brassica napus and its progenitor species reveals extensive sequence-level divergence. Plant Cell 21, 1912–1928.

261

Covello, P.S., Reed, D.W., 1996. Functional expression of the extraplastidial Arabidopsis thaliana oleate desaturase gene (FAD2) in Saccharomyces cerevisiae. Plant Physiol. 111, 223–226. Dellaporta, S.L., Wood, J., Hicks, J.B., 1983. A plant DNA minipreparation: version 2. Plant Mol. Biol. Report. 1, 19–22. Dyer, J.M., Mullen, R.T., 2001. Immunocytological localization of two plant fatty acid desaturases in the endoplasmic reticulum. FEBS Lett. 494, 44–47. Furger, A., O'Sullivan, J.M., Binnie, A., Lee, B.A., Proudfoot, N.J., 2002. Promoter proximal splice sites enhance transcription. Genes Dev. 16, 2792–2799. Graef, G., et al., 2009. A high-oleic-acid and low-palmitic-acid soybean: agronomic performance and evaluation as a feedstock for biodiesel. Plant Biotechnol. J. 7, 411–421. Heppard, E.P., Kinney, A.J., Stecca, K.L., Miao, G.H., 1996. Developmental and growth temperature regulation of two different microsomal ω-desaturases in soybean. Plant Physiol. 110, 311–319. Hernandez, M.L., Mancha, M., Martinez-Rivas, J.M., 2005. Molecular cloning and characterization of genes encoding two microsomal oleate desaturases (FAD2) from olive. Phytochemistry 66, 1417–1426. Hongtrakul, V., Slabaugh, M.B., Knapp, S.J., 1998. A seed specific Δ-12 oleate desaturase is duplicated, rearranged, and weakly expressed in high oleic acid sunflower lines. Crop. Sci. 38, 1245–1249. Hu, X., Sullivan-Gilbert, M., Gupta, M., Thompson, S.A., 2006. Mapping of the loci controlling oleic and linolenic acid contents and development of fad2 and fad3 allele-specific markers in canola (Brassica napus L.). Theor. Appl. Genet. 113, 497–507. Inaba, R., Nishio, T., 2002. Phylogenetic analysis of Brassicaceae based on the nucleotide sequences of the S-locus related gene, SLR1. Theor. Appl. Genet. 105, 1159–1165. Jin, U.H., et al., 2001. Characterization and temporal expression of a ω-6 fatty acid desaturase cDNA from sesame (Sesamum indicum L.) seeds. Plant Sci. 161, 935–941. Jung, S., et al., 2000. The high-oleate trait in the cultivated peanut (Arachis hypogaea L.). I. Isolation and characterization of two genes encoding microsomal oleoyl-PC desaturases. Mol. Gen. Genet. 263, 796–805. Jung, J.H., et al., 2011. Identification of functional BrFAD2-1 gene encoding microsomal delta-12 fatty acid desaturase from Brassica rapa and development of Brassica napus containing high oleic acid contents. Plant Cell Rep. 30, 1881–1892. Kang, J., Snapp, A.R., Lu, C., 2011. Identification of three genes encoding microsomal oleate desaturase (FAD2) from the oilseed crop Camelina sativa. Plant Physiol. Biochem. 49, 223–229. Katavic, V., Mietkiewska, E., Barton, D.L., Giblin, E.M., Reed, D.W., Taylor, D.C., 2002. Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution. Eur. J. Biochem. 269, 5625–5631. Khadake, R.M., Ranjekar, P.K., Harsulkar, A.M., 2009. Cloning of novel omega-6 desaturase from flax (Linum usitatissimum L.) and its functional analysis in Saccharomyces cerevisiae. Mol. Biotechnol. 42, 168–174. Kim, M.J., Kim, H., Shin, J.S., Chung, C.-H., Ohlrogge, J.B., Suh, M.C., 2006. Seed-specific expression of sesame microsomal oleic acid desaturase is controlled by combinatorial properties between negative cis-regulatory elements in the SeFAD2 promoter and enhancers in the 5′-UTR intron. Mol. Gen. Genomics 276, 351–368. Krasowska, A., Dziadkowiec, D., Polinceusz, A., Plonka, A., Lukaszewicz, M., 2007. Cloning of flax oleic fatty acid desaturase and its expression in yeast. J. Am. Oil Chem. Soc. 84, 809–816. Kurdrid, P., Subudhi, S., Hongsthong, A., Ruengjitchatchawalya, M., Tanticharoen, M., 2005. Functional expression of Spirulina-Δ6 desaturase gene in yeast, Saccharomyces cerevisiae. Mol. Biol. Rep. 32, 215–226. Le Hir, H., Nott, A., Moore, M.J., 2003. How introns influence and enhance eukaryotic gene expression. Trends Biochem. Sci. 28, 215–220. Lee, K.-R., et al., 2012. Molecular cloning and functional analysis of two FAD2 genes from American grape (Vitis labrusca L.). Gene 509, 189–194. Lescot, M., Déhais, P., Moreau, Y., De Moor, B., Rouzé, P., Rombauts, S., 2003. PlantCARE: a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 30 (1), 325–327. Li, L., Wang, X., Gai, J., Yu, D., 2007. Molecular cloning and characterization of a novel microsomal oleate desaturase gene from soybean. J. Plant Physiol. 164, 1516–1526. Liu, Q., Singh, S.P., Brubaker, C.L., Sharp, P.J., Green, A.J., Marshall, D.R., 1999. Molecular cloning and expression of a cDNA encoding a microsomal ω-6 fatty acid desaturase from cotton (Gossypium hirsutum). Aust. J. Plant Physiol. 26, 101–106. Lopez, Y., Nadaf, H.L., Smith, O.D., Connell, J.P., Reddy, A.S., Fritz, A.K., 2000. Isolation and characterization of the Δ12-fatty acid desaturase in peanut (Arachis hypogaea L.) and search for polymorphisms for the high oleate trait in Spanish market-type lines. Theor. Appl. Genet. 101, 1131–1138. Los, D.A., Murata, N., 1998. Structure and expression of fatty acid desaturases. Biochim. Biophys. Acta 1394, 3–15. McCartney, A.W., et al., 2004. Membrane-bound fatty acid desaturases are inserted cotranslationally into the ER and contain different ER retrieval motifs at their carboxy termini. Plant J. 37, 156–173. Miquel, M., Browse, J., 1992. Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267, 1502–1509. Miquel, M., James, D., Dooner, H., Browse, J., 1993. Arabidopsis requires polyunsaturated lipids for low temperature survival. Proc. Natl. Acad. Sci. U. S. A. 90, 6208–6212. Ohlrogge, J., Browse, J., 1995. Lipid biosynthesis. Plant Cell 7, 957–970. Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., Browse, J., 1994. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147–158. Pirtle, I.L., Kongcharoensuntorn, W., Nampaisansuk, M., Knesek, J.E., Chapman, K.D., Pirtle, R.M., 2001. Molecular cloning and functional expression of the gene for a cotton Δ-12 fatty acid desaturase (FAD2). Biochim. Biophys. Acta 1522, 122–129. Rana, D., et al., 2004. Conservation of the microstructure of genome segments in Brassica napus and its diploid relatives. Plant J. 40, 725–733.

262

K.-R. Lee et al. / Gene 531 (2013) 253–262

Scheffler, J.A., et al., 1997. Desaturase multigene families of Brassica napus arose through genome duplication. Theor. Appl. Genet. 94, 583–591. Schierholt, A., Becker, H.C., Ecke, W., 2000. Mapping a high oleic acid mutation in winter oilseed rape (Brassica napus L.). Theor. Appl. Genet. 101, 897–901. Shanklin, J., Cahoon, E.B., 1998. Desaturation and related modifications of fatty acids. Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 49, 611–641. Shanklin, J., Whittle, E., Fox, B.G., 1994. Eight histidine residues are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenase. Biochemistry 33, 12787–12794. Smooker, A.M., et al., 2011. The identification and mapping of candidate genes and QTL involved in the fatty acid desaturation pathway in Brassica napus. Theor. Appl. Genet. 122 (6), 1075–1090. Sparkes, I.A., Runions, J., Kearns, A., Hawes, C., 2006. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat. Protoc. 1, 2019–2025. Stefansson, B.R., Hougen, F.W., Downey, R.K., 1961. Note on the isolation of rape plants with seed oil free from erucic acid. Can. J. Plant Sci. 41, 218–219. Tang, G.Q., Novitzky, W.P., Griffin, H.C., Huber, S.C., Dewey, R.E., 2005. Oleate desaturase enzymes of soybean: evidence of regulation through differential stability and phosphorylation. Plant J. 44, 433–446.

The Brassica rapa Genome Sequencing Project Consortium, 2011. The genome of the mesopolyploid crop species Brassica rapa. Nat. Genet. 43, 1035–1039. U N., 1935. Genome-analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn J. Bot. 7, 389–452. Warner, K., Knowlton, S., 1997. Frying quality and oxidative stability of high-oleic corn oils. J. Am. Oil Chem. Soc. 74, 1317–1322. Xiong, Z., Gaeta, R.T., Pires, J.C., 2011. Homoeologous shuffling and chromosome compensation maintain genome balance in resynthesized allopolyploid Brassica napus. Proc. Natl. Acad. Soc. U. S. A. 108, 7908–7913. Yang, T.J., et al., 2006. Sequence-level analysis of the diploidization process in the triplicated FLOWERING LOCUS C region of the Brassica rapa. Plant Cell 18, 1339–1347. Yang, Q., et al., 2012. Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic acid and low linolenic acid contents. Theor. Appl. Genet. 125, 715–729. Yao, K., Lockhart, K.M., Kalanack, J.J., 2005. Cloning of dehydrin coding sequences from Brassica juncea and Brassica napus and their low temperature-inducible expression in germinating seeds. Plant Physiol. Biochem. 43, 83–89. Zhang, D., et al., 2009. Identification and expression of a new delta-12 fatty acid desaturase (FAD2-4) gene in upland cotton and its functional expression in yeast and Arabidopsis thaliana plants. Plant Physiol. Biochem. 47, 462–471.