Functional analysis of alcS, a gene of the alc cluster in Aspergillus nidulans

Fungal Genetics and Biology 43 (2006) 247–260 www.elsevier.com/locate/yfgbi

Functional analysis of alcS, a gene of the alc cluster in Aspergillus nidulans Michel Flipphi 1, Xavier Robellet, Emmanuel Dequier 2, Xavier Leschelle 3, Béatrice Felenbok, Christian Vélot ¤ Institut de Génétique et Microbiologie, CNRS Unité Mixte de Recherche 8621, Université Paris-Sud XI, Centre ScientiWque d’Orsay, Bâtiment 360, F-91405 Orsay Cedex, France Received 14 September 2005; accepted 19 December 2005 Available online 13 March 2006

Abstract The ethanol utilization pathway (alc system) of Aspergillus nidulans requires two structural genes, alcA and aldA, which encode the two enzymes (alcohol dehydrogenase and aldehyde dehydrogenase, respectively) allowing conversion of ethanol into acetate via acetyldehyde, and a regulatory gene, alcR, encoding the pathway-speciWc autoregulated transcriptional activator. The alcR and alcA genes are clustered with three other genes that are also positively regulated by alcR, although they are dispensable for growth on ethanol. In this study, we characterized alcS, the most abundantly transcribed of these three genes. alcS is strictly co-regulated with alcA, and encodes a 262-amino acid protein. Sequence comparison with protein databases detected a putative conserved domain that is characteristic of the novel GPR1/FUN34/YaaH membrane protein family. It was shown that the AlcS protein is located in the plasma membrane. Deletion or overexpression of alcS did not result in any obvious phenotype. In particular, AlcS does not appear to be essential for the transport of ethanol, acetaldehyde or acetate. Basic Local Alignment Search Tool analysis against the A. nidulans genome led to the identiWcation of two novel ethanol- and ethylacetate-induced genes encoding other members of the GPR1/FUN34/YaaH family, AN5226 and AN8390. © 2006 Elsevier Inc. All rights reserved. Keywords: Ethanol catabolism; GPR1/FUN34/YaaH protein family; Regulation of transcription; Functional redundancy

1. Introduction The hyphal fungus Aspergillus nidulans can utilize twocarbon compounds, such as acetate and ethanol, as sole carbon sources. The ability of this model organism to utilize ethanol requires two structural genes, alcA (Gwynne et al., 1987) and aldA (Pickett et al., 1987), encoding alcohol dehydrogenase I (ADHI; EC 1.1.1.1.) and aldehyde dehy*

Corresponding author. Fax: +33 1 69 15 63 34. E-mail address: [email protected] (C. Vélot). 1 Present address: Instituto de Agroquimica y Tecnologia de Alimentos, Consejo Superior de Investigaciones CientiWcas Apartado de Correos 73 46100 Burjassot, Valencia, Spain. 2 Present address: Jealott’s Hill International Research Center, Bracknell, Berskhire RG426EY, UK. 3 Present address: 99 avenue du Général Leclerc, Résidence les Chandeliers, Bât. C, 91120 Palaiseau, France. 1087-1845/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2005.12.008

drogenase (ALDH; EC 1.2.1.5.), respectively. These two enzymes allow oxidation of ethanol into acetate via acetaldehyde. The acetate is further activated to acetyl-CoA to enter mainstream metabolism. A large body of experimental data relative to ethanol utilization pathway (termed alc system) and its regulation has been obtained (Felenbok et al., 2001). This catabolic pathway is governed, at the transcriptional level, by two antagonist controlling circuits: general carbon catabolite repression (Mathieu and Felenbok, 1994) that is mediated via the creA negative regulatory gene product (Arst and Bailey, 1977; Bailey and Arst, 1975), and a pathway-speciWc induction mediated by the transactivator AlcR (Pateman et al., 1983), a zinc binuclear cluster protein (Kulmburg et al., 1991) encoded by the regulatory alcR gene (Felenbok et al., 1988; Lockington et al., 1987). AlcR–dependent transcriptional activation requires the presence of an external

248

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

co-inducer such as ethanol, other primary alcohols, ketones, primary monoamines or L-threonine (Flipphi et al., 2002, 2003a). It has been shown that the physiological inducer of the alc genes is acetaldehyde (Flipphi et al., 2001). This compound is also a catabolic intermediate of Lthreonine and ethylamine degradation (Flipphi et al., 2002). The alcR gene itself is also subject to the aforementioned regulatory circuits. It is controlled at the transcriptional level by AlcR via a positive feedback loop and by CreA, which directly represses alcR transcription (Kulmburg et al., 1992, 1993; Mathieu and Felenbok, 1994; Mathieu et al., 2000). In presence of glucose, and even when an external inducer is present, catabolite repression is so strong that alcA transcription is completely repressed. Although alcA expression is dependent on an active AlcR protein, it is also subject to a direct repression by CreA. Under less extreme growth conditions, interplay between induction and repression allows a Wne-tuning of the expression of alcR and alcA, as a result of a direct competition between the AlcR and CreA proteins exerting mutual antagonism in the promoters of these two alc genes. Such a competition is explained by the overlapping of functional AlcR binding sites and CreA targets in these promoters (Mathieu et al., 2000; Panozzo et al., 1998). On the other hand, no functional CreA site is present in the aldA promoter. Therefore, unlike alcA, repression of aldA occurs solely by CreA-mediated repression of the regulatory alcR gene (Flipphi et al., 2001). This less stringent control of aldA by CreA can be explained by the necessity for the cell to permanently express aldA to a minimum basal level to prevent acetaldehyde accumulation reaching concentrations that are toxic for the cell. Transcriptional repression of the alc system is thus mediated at two levels: directly, via the binding of the repressor CreA to its cognate targets located in the alcR and alcA gene promoters, and indirectly, by down-regulating the antagonistic regulatory alcR gene (the “double lock” mechanism of repression) (Mathieu and Felenbok, 1994; Panozzo et al., 1998). Unlike aldA which is located on chromosome VIII, the alcR and alcA genes are linked on the left-hand arm of chromosome VII. In A. nidulans, genes involved in various catabolic pathways, such as those for L-proline, nitrate, and quinate, are clustered (Arst and MacDonald, 1975; Hawkins et al., 1994; Johnstone et al., 1990; Keller and Hohn, 1997). One possible explanation for gene clustering is that it is somehow involved in their mutual regulation. A thorough analysis of transcription units localized in the alcR– alcA region has led to the identiWcation of Wve unknown genes. Three of them, termed alcO, alcM, and alcS, are strongly inducible by 2-butanone (EMK, a gratuitous inducer of the system alc), subject to strict AlcR control, and almost completely repressed in the presence of glucose (Fillinger and Felenbok, 1996). Like alcR and alcA, alcO and alcS are directly regulated by CreA, while the CreAmediated carbon catabolite repression of alcM occurs via repression of alcR, as for aldA. Besides these diVerent patterns of regulation vis-à-vis the general repressor CreA, these new alc genes also vary in the steady state amounts of

their transcripts: the induced levels of alcO are relatively low, whereas alcS is highly induced (nearly as high as alcA), while alcM shows intermediate expression. The alcR/alcO, as well as alcM/alcS genes, are divergently transcribed. Surprisingly, these three new alc genes are dispensable for growth on ethanol, ethylamine, and L-threonine (Felenbok et al., 2001; Fillinger and Felenbok, 1996), and the physiological signiWcance of such a subtle pattern of regulation and the cluster organization of the alc genes remains an open question. However, the fact that these new genes are coordinately expressed with alcR, alcA and aldA genes without being required for ethanol utilization implies that they may be involved in other pathways which are closely interwoven with ethanol catabolism. To gain insights in the role of the alcO, alcM, and alcS genes, we have undertaken their functional analysis. In this report, we focus on the alcS gene, the one that displays the highest expression under inducing conditions. We show that alcS encodes a 262 amino acids protein that is located in the plasma membrane. Similarity to a conserved domain that is characteristic of a novel family of membrane proteins including Gpr1p of Yarrowia lipolytica (Augstein et al., 2003) and Ady2p of Saccharomyces cerevisiae (Paiva et al., 2004) led us to look for a possible phenotype of the null alcS mutant and the alcS-over-expressing strain with regard to growth on acetate, transport of alcohols, acetaldehyde and acetate, and growth under physiological conditions leading to ammonium production. 2. Materials and methods 2.1. Strains, general growth conditions, classical genetics, and transformation A. nidulans strains used in this study are listed in Table 1. Refer to Clutterbuck (1993) for gene annotations. Media composition, supplements and basic growth conditions at 37 °C were as described by Cove (1966), using di-ammonium tartrate (5 mM) as the nitrogen source and the various carbon sources at 1% (w/v or v/v), unless otherwise stated. Auxotrophic markers were exchanged and mutant alleles were combined through meiotic recombination (Clutterbuck, 1974). Protoplast generation and transformation of A. nidulans with plasmid and/or PCR-ampliWed DNA were performed as described by Tilburn et al. (1983). Aspergillus genomic DNA utilized for PCRs and in Southern blot analyses for the veriWcation of the various transformants was isolated according to Specht et al. (1982). The host Escherichia coli strains used for DNA constructions were XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F⬘ proAB lacIq lacZM15 Tn10(tetr)]), and KS272 [F¡ lacX74 galE galK thi rpsL phoA (PvuII)] carrying pKOBEG (Chaveroche et al., 2000). Electro-competent E. coli cells were obtained

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

249

Table 1 A. nidulans strains used in this study Strain

Genotype

Source

BF057 BF064 BF073 BF096 BF125 BF146 BF299 C590 CV043 CV044 CV050 CV057 CV063 CV064 ED016

pabaA1, argB2b,e yA2 pabaA1, alc500a,c,e yA2 pabaA1, (argB2), (alc500); Tr. alcR/argBa,c,e pabaA1, alcA4951a,c,e yA2 pabaA1, (alc500), aldA15; Tr. alcROA/argBa,d,e yA2, pantoB100, aldA67 pabaA1, (argB2); Tr. alcS::sGFP/argBa,b biA2, wA3, aldA15, gly¡ yA2 (pyrG89), pantoB100; Tr. A.f. pyrGb,e yA2 (pyrG89), pantoB100; Tr. A.f. pyrGb,e yA2 (pyrG89), pantoB100; Tr. A.f. pyrG/gpdA::alcSb,e yA2 (pyrG89), pantoB100; Tr. A.f. pyrG/gpdA::alcSb,e yA2 (pyrG89), pantoB100, alcS8; Tr. alcS::A.f. pyrGb,e yA2 (pyrG89), pantoB100, alcS17; Tr. alcS::A.f. pyrGb,e yA2 pyrG89, pantoB100

This work Fillinger and Felenbok (1996) Flipphi et al. (2003a) Lockington et al. (1985); Panozzo et al. (1997) Fillinger and Felenbok (1996); Flipphi et al. (2001) Flipphi et al. (2001) This work Flipphi et al. (2001) This work This work This work This work This work This work This work

a b c d e

Arginine prototroph. Grows on ethanol. Does not grow on ethanol. Grows like an aldA15 single mutant on ethanol. Uridine prototroph. A.f: Aspergillus fumigatus; Tr: “transformed with.”

either according to the standard method (Sambrook and Russel, 2001) for XL1Blue or according to the method described by Chaveroche et al. (2000) for KS272 carrying pKOBEG. 2.2. Structure of the alcS gene Features of the alcS gene structure (introns positions, transcription start-, and end-points) were revealed upon sequencing of a considerable number of cDNA clones obtained upon rapid ampliWcation of cDNA ends (RACE) with a sample of total RNA isolated from wild type mycelia induced with 2-butanone (as described below), utilizing a number of gene-speciWc oligonucleotide primers (Table 2) and a RACE kit from Boehringer Mannheim (Roche). Table 2 Oligonucleotides used in this study Name

Sequence (5⬘!3⬘)

3⬘RACE-843 5⬘RACE-1147 5⬘RACE-1217 alcS-DIS-PYR

ttccctcattcaacgcagcc gggacaggaagatgagcgtg tcaccgacagcagcgtcccc aaccagctatagcaatcttacccgttcaatttcttaatccccatctagac gaattcgcctcaaacaatgc ctagaaatgcccaactgtatccacggtatttctcgaatgccctgacccct ggaattctcagtcctgctcc agctccatggctaccgagatcagtaacggtgag atgacaaagccccctagtgccctg tacacgctcatcttcctgtccctg atgacaaagccccctagtgccctg atcgcgcaaagagaatgaga cagccacgagtatcccgtat aattctgagctccatggacgtgactgcactcggtgtgctcgt ctgactcccgcgggctactggaccatggtgctcgt ctagacgagcacaccgagtgcagtcacgtccatggagctcag ctagacgagcaccatggtccagtagcccgcgggagtcaggtac

alcS-DIS-ZEO AS5 AS6 AS7 AS8 DeltaS-L DeltaS-R ECXB KPXB XBEC XBKP

2.3. DNA constructions 2.3.1. GFP-tagged construct The AlcS protein was C-terminally tagged with a plantadapted version of the green Xuorescent protein (sGFP) (Chiu et al., 1996). The resulting fusion protein was expressed in A. nidulans from the (inducible) alcS promoter. The adaptor formed with the complementary oligonucleotides KPXB and XBKP (Table 2) was ligated into the vector pGEM3zf (Promega) linearized with Asp718 and XbaI. An NcoI restriction site was created at the 3⬘ end of the coding region of the alcS gene enabling in-frame fusion of Ser260 of AlcS with Met1 of sGFP by ampliWcation of a small PCR product corresponding to the 3⬘ end of the coding region of the alcS gene with oligonucleotides AS7 and AS8 (Table 2) using pfu DNA polymerase and pAN203 (Lockington et al., 1985) as the template. The ampliWcation product was gel-puriWed, cleaved with SacII and NcoI and ligated into the above-described vector digested with the same enzymes. Finally, the »1.3 kb Asp718/SacII fragment from pAN203, harboring the 5⬘ end of the alcS gene including its promoter, was introduced upstream, while the »1.5 kb NcoI/XbaI fragment from plasmid pAN-SGFP (Pokorska et al., 2000) encompassing the coding region of sGFP followed by the terminator of the A. nidulans trpC gene (Mullaney et al., 1985), was inserted downstream of the fusion fragment. The resulting plasmid was termed pMFIN361. pAN-SGFP was a kind gift from Dr. Corinne Clavé (Institut de Biochimie et de Génétique Cellulaires, Université de Bordeaux 2, France). 2.3.2. gpdA::alcS construct To overexpress alcS constitutively, the alcS coding region was fused to the glyceraldehyde-3-phosphate dehydrogenase (gpdA) promoter at the ATG start codon. The

250

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

adaptor formed with the complementary oligonucleotides ECXB and XBEC (Table 2) was ligated into the vector pUC19 linearized with EcoRI and XbaI. An NcoI restriction site was created at the ATG start codon of alcS by ampliWcation of a small PCR product corresponding to the 5⬘ end of the coding region of the alcS gene with oligonucleotides AS5 and AS6 (Table 2) using pfu DNA polymerase and EcoRI-linearized pAN203 as the template. After puriWcation, the ampliWcation product was cleaved with NcoI and DraIII and ligated into the above-described vector linearized with the same enzymes. Finally, the »2.3 kb EcoRI/NcoI fragment from pAN-SGFP, harboring the gpdA promoter (Punt et al., 1991), was introduced upstream, while the »2.3 kb DraIII/HindIII fragment from plasmid pAN203, encompassing the 3⬘ end of the alcS gene, was inserted downstream of the fusion fragment. The resulting plasmid was termed pMFIN362.

untransformed and transformed mycelia. The resulting independent alcS null mutant strains used in this study were termed CV063 and CV064 (Table 1). The alcS-overexpressing strain was obtained by cotransformation of ED016 with plasmid pMFIN362 and the 2.4-kb pyrG/Zeo cassette (see above). The presence of the gpdA::alcS construct in the uridine prototroph transformants was checked by PCR analysis on genomic DNA. The resulting independent strains constitutively overexpressing alcS used in this study were named CV050 and CV057 (Table 1). For purposes of comparison, ED016 was also transformed with the 2.4-kb pyrG/Zeo cassette alone to generate the control strains CV043 and CV044 (Table 1), independent uridine-prototroph transformants with a wild-type alcS gene. 2.6. Subcellular localization of the AlcS protein

2.3.3. alcS::pyrG disruption cassette The knock-out of alcS was carried out using the cosmid W3D09, a derivative of pWE15 that carries an A. nidulans genomic region containing the alc cluster, according to the procedure described by Chaveroche et al. (2000). This cosmid originates from an A. nidulans chromosome-speciWc library (Brody et al., 1991) constructed in the pWE15 cosmid vector. The zeo/pyrG cassette (2.4 kb) of pCDA21 (Chaveroche et al., 2000) was ampliWed using oligonucleotides alcS-DIS-ZEO and alcS-DIS-PYR (Table 2). These oligonucleotides have 50 bases of homology to the 5⬘ or 3⬘ non-coding region of the A. nidulans alcS gene followed by 20 bases of homology to the zeocin-resistance or Aspergillus fumigatus pyrG genes carried by pCDA21, respectively. The recombinant cosmid (termed W3D09S) was used as a template for a long-PCR ampliWcation using the Expand Long Template PCR System (Roche) with oligonucleotides DeltaS-L and DeltaS-R (Table 2) to generate the alcS disruption cassette (8.4-kb). 2.4. Generation of a strain expressing the AlcS–GFP fusion protein The A. nidulans argB2 strain BF057 (Table 1) was cotransformed with pMFIN361 and pFB39, a plasmid carrying a functional A. nidulans argB gene (Upshall et al., 1986). Transformants were selected for L-arginine prototrophy and checked for the presence of the alcS–GFP construct by Southern blot. The selected strain expressing sGFP-tagged AlcS from the alcS promoter was termed BF299 (Table 1). 2.5. Generation of alcS deletion mutants and alcS overexpressing transformants To generate the alcS knock-out mutant, 2.5 g of the 8.4kb alcS disruption cassette was used to transform the pyrG89 strain ED016 (Table 1) to uridine prototrophy. Disruption of the alcS gene in the uridine-independent transformants was checked by Southern analysis of both

Fresh conidia of the strain BF299 (Table 1) were inoculated overnight at 37 °C in 10 l drops of minimal medium (with 50 mM L-threonine as the carbon source) directly on glass slides. The glass slides were thoroughly rinsed (with the same medium) to remove excess mycelia. The plasma membranes were speciWcally stained by incubating the remaining material 2 min at room temperature in 10 l drops of the dye FM4-64 (2.5 M) in the presence of 10 mM sodium azide, as previously described by Fischer-Parton et al. (2000). Again, the slides were rinsed with minimal medium before microscope observation. Slides were examined with a Zeiss LSM510 confocal scanning laser microscope equipped with a 25 mW Argon laser and a 1 mW Helium–Neon laser, using a Plan Apochromat 63£ objective (NA 1.40, oil immersion). Green Xuorescence was observed with a 505–550 nm bandpass emission Wlter under 488 nm laser illumination and red Xuorescence was observed with a 585 long-pass emission Wlter under 543 nm laser illumination. Pinholes were set at 1.0 Airy unit. Simultaneous images corresponding to GFP and FM4-64 were obtained using the multitracking function of the microscope. 2.7. Special growth conditions 2.7.1. Toxicity of alcohols Toxicity of allylalcohol (Felenbok et al., 2001) was tested on adequately supplemented minimal medium/glycerol plates with sodium nitrate (10 mM) as the nitrogen source. Growth in the presence of n-propanol was addressed on minimal medium with sodium L-glutamate (50 mM) as the carbon and nitrogen source (Felenbok et al., 2001). The alcohols were tested in a concentration range from 50 mM to 13 M (Wnal concentration). Water-diluted alcohol was either added to hand warm molten medium directly prior to pouring or, alternatively, administered to a Wlter paper placed inside the lid of ready-poured and inoculated plates. The Petri dishes were tightly taped to reduce evaporation during cultivation at either 37 or 25 °C.

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

2.7.2. Anaerobic conditions Conditions for ammonia fermentation (Takasaki et al., 2004) were adapted to solid medium to monitor growth or changes in morphology of A. nidulans colonies surviving in absence of oxygen. Minimal medium plates containing sodium nitrate (10 mM) and either ethanol as the sole carbon source or ethanol (1% v/v) and glycerol (0.1% v/v), were used. Glycerol allows considerable ethanol-induced expression of the alc genes. Point-inoculated plates were incubated for 48 h at 37 °C (i.e., in the presence of oxygen) to allow the formation of small colonies. The plates were subsequently subjected to anaerobic conditions generated with Anaerocult A (Merck) in air tight jars and further incubated at 37 °C for one to six weeks. 2.7.3. Acetaldehyde cross feeding assay (Flipphi et al., 2001) aldA15 mutant strains (C590 or BF125: Table 1) were inoculated on adequately supplemented minimal medium/ ethanol plates. After two days of incubation at 37 °C, ADHI-deWcient mutants (BF096 or BF073: Table 1) were co-inoculated at a distance of 1.5 cm from the aldA15 strain. Cross feeding could be scored after a further four days of incubation at 37 °C. 2.8. Transcript analysis Mycelia for transcript analysis were grown for 24 h in properly supplemented minimal medium with lactose (3% w/v) as the carbon source and urea (5 mM) as the nitrogen source (Flipphi et al., 2003a). These growth conditions are neutral with respect to induction of the alc genes by ethanol. Induction was achieved by the addition of either ethanol or ethylacetate to 50 mM (Wnal concentration) and cultures were harvested after 2.5 h of further incubation. However, for acetate induction, sodium acetate was added (from a 4-M solution, pH 6.8) only to 36 mM because higher concentrations of this weak acid at pH 6.8 provoke a considerable drop in the transcript level of the -actin (acnA) gene (at more acidic medium pH, this eVect is also evident at lower acetate concentrations: our unpublished results). Total RNA isolation from above mycelia and northern analysis were carried out as described previously (Flipphi et al., 2003b). Hybridization signals were revealed using a PhosphorImager (Molecular Dynamics). All expression experiments were repeated at least twice. 3. Results 3.1. alcS is strictly co-regulated with alcA As for alcA, aldA, and alcR, the alcS gene has been shown to be subject to both induction via AlcR and repression via CreA (Fillinger and Felenbok, 1996). To reWne the expression pattern of alcS and to determine whether it matches with that of alcA, we compared the expression of the two genes after induction with ethanol and ethylacetate

251

(Fig. 1A) (Flipphi et al., 2002, 2003a). Acetate is known to repress the alc genes, and this repression is mediated by the general carbon catabolite repressor CreA, since it is essentially not observed in creA loss-of-function mutants (data not shown). As for alcA, acetate represses the ethanolinduced as well as the basal level (non induced) expression observed for alcS on lactose (Fig. 1A). This acetate repression of basal level expression, routinely observed when no additions were made to mycelia grown on the neutral carbon source lactose, indicates that alcS is, like alcA, subject to both direct and indirect repression by CreA (i.e., the “double lock” mechanism of repression). Essentially identical behavior of alcS and alcA is also observed in the structural aldA67 loss-of-function mutant that is blocked in acetaldehyde oxidation (Fig. 1B). The pseudo-constitutive expression of alcS in such a mutant indicates that its induction is, as for the other alc genes, governed by the intracellular concentration of acetaldehyde, the physiological inducer of the alc system, which is accumulated in this mutant. As expected from previous work with alcA (Flipphi et al., 2002), alcS is not induced by acetate metabolism, unlike facA and acuE encoding acetyl-CoA synthethase and malate synthase, respectively (Fig. 1A). 3.2. Structure of the alcS gene and its putative translation product We determined the A. nidulans-speciWc sequence of the insert of plasmid bAN203, a subclone of lambda clone LAN102 that was shown to contain alcR and alcA by

Fig. 1. The A. nidulans alcS gene is co-regulated with the alcohol dehydrogenase ADHI gene, alcA, essential for ethanol utilization. A. Induction and repression of transcription in wild type background. B. Pseudo-constitutive expression and induction in an aldehyde dehydrogenase loss-offunction background (aldA67). Fungal biomass was generated on lactose/ urea and gene expression was induced/repressed with the indicated compounds by adding them to the mycelial cultures to the concentrations mentioned in Section 2. A culture to which no inducer compound was added provided the non-induced (NI) control. Total RNA was isolated, denatured, separated and transferred to nylon membrane as described in Section 2. The northern blots were subsequently hybridized with 32Plabelled probes for the indicated genes (see Section 2). Wild-type strain (A and “WT” in B) was CV044, while BF146 provided the mutant background (“aldA67” in B) (see Table 1).

252

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

complementation of various classic alc mutants, including the alc500 deletion (Lockington et al., 1985). This particular deletion mutant lacks Wve additional ketone-inducible transcription units clustered around the two genes essential for ethanol utilization, including alcS (Fillinger and Felenbok, 1996). The complete DNA sequence is available under the accession number DQ076245. Using RACE, we mapped the exact position of the alcS transcript within this sequence upon analysis of a number of gene-speciWc cDNA clones generated from total RNA isolated from 2-butanone-induced mycelia. The alcS transcription unit and its Xanking regions are shown in Fig. 2. The transcribed region was found to be interrupted by six short intron sequences. The open reading frame formed upon removal of these introns would encode a putative translation product of 262 amino acids. The 5⬘ and 3⬘ non-coding sequences are 75 and 368 bp long, respectively.

It was shown that induced expression of alcS depends on AlcR, the transcriptional activator of ethanol catabolism (Fillinger and Felenbok, 1996). This correlates with the presence of two couples of putative DNA-binding sites for AlcR in the promoter of the alcS gene (Fig. 2). The distal doublet, an inverted repeat of single sites 5⬘ WGCGG separated by two base pairs, has the same organization as three in vivo functional AlcR targets in alcA, alcR, and aldA promoters (Flipphi et al., 2001; Mathieu et al., 2000; Panozzo et al., 1997). Moreover, this putative target in alcS contains the same 15-bp sequence harbouring the sole functional AlcR target in the alcR promoter. Therefore, the strict regulation by AlcR of the alcS gene is supported by the presence of typical canonical AlcR sites in its promoter. The presence of a single pair of putative CreA DNA-binding sites, separated by 23 bp, in the alcS promoter (Fig. 2) correlates with the conclusion of Fillinger and Felenbok (1996) that CreA acts

Fig. 2. The structure of the A. nidulans alcS gene and its deduced translation product, AlcS. The nucleotide sequence of the 2136-bp long Asp718/NheI DNA fragment from bAN203 encompassing the alcS gene is presented. The alcM gene is located upstream while the alcU gene is downstream of the depicted sequence (Fillinger and Felenbok, 1996). The complete sequence of the A. nidulans-speciWc insert of genomic clone bAN203 is available under GenBank accession number DQ076245. All distances are relative to the Wrst base of the presumed start codon of the AlcS protein (+1). The upstream sequences depicted function as a minimal promoter of properly regulated alcS expression (results not shown). Consensus core elements of the targets for the regulatory DNA-binding proteins AlcR and CreA (Felenbok et al., 2001) are highlighted. The putative AlcR-binding sites (core D 5⬘-WGCGG) are underlined while the orientation of the core element is indicated by the arrow overhead. The putative CreA-binding sites (core D 5⬘-SYGGRG) are given in bold on a grey background. In two cases, CreA- and AlcR-binding sites overlap. The start of transcription and the major polyadenylation site are indicated in bold and marked overhead “5⬘” and “3⬘”, respectively. The six introns within alcS are numbered A through F. The deduced 262 animo acid-long sequence of the AlcS protein is given below the coding sequences (in upper case). The six putative, 21 amino-acids long transmembranal helices predicted by the TopPred algorithm (von Heijne, 1992) are marked by the grey background. Two amino acid sequences corresponding to the signature of the GPR1/FUN34/YaaH family of transmembranal proteins (i.e., the Wrst split by intron A and the second by intron C) are underlined and printed bold (see also Fig. 3).

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

on the promoter of alcS. This is consistent with the fact that all but one in vivo functional repression target known in A. nidulans to date consist of two coupled CreA DNA-binding sites (Felenbok et al., 2001; Flipphi and Felenbok, 2004). One of these CreA sites in alcS overlaps the proximal doublet of putative AlcR DNA-binding sites, a direct repeat separated by 15 bp, suggesting the direct repression of alcS by CreA could be the result of regulator competition for DNA binding, as it is for alcA. The most remarkable characteristic of the predicted AlcS amino acid sequence is the presence of six hydrophobic regions. When the deduced amino acid sequence is subject to a number of algorithms designed to address topology of membrane proteins (accessible via http:// www.hgmp.mrc.ac.uk/GenomeWeb/prot- transmembrane ), the protein is predicted to have six ordered transmembrane domains preceded by an N-terminal domain of about 50 amino acids. In Fig. 2 are indicated the six membrane spanning segments (21 residues-long) predicted by the TopPred 2 algorithm (von Heijne, 1992) as representative for all the predictions of the six domains. Sequence comparison of the AlcS protein with protein databases (all non-redundant GenBank CDS translations, PDB, SWISS-PROT, PIR, PRF) did not reveal any obvious homology, except with two hypothetical proteins: one from Fusarium graminearum (44% identity), and one from Ustilago maydis (37% identity). However, this sequence comparison detected a conserved domain that is characteristic of a novel family of membrane proteins in prokaryotic and eukaryotic organisms, the GPR1/FUN34/yaaH family (InterPro: IPR000791; Pfam: PF01184; ProDom: PD010188; PROSITE: PS01114). Although the two sequences—(A/G)NPAPLGL and SYG(X)FW—that represent the sequence signature of this class of proteins are not fully conserved in AlcS (Fig. 3), software trained to recognize common features in protein sequences assigned AlcS to this family which includes, among others, Y. lipolytica

253

Gpr1p (Kujau et al., 1992), S. cerevisiae Fun34p (Stettler et al., 1992) and Ady2p (Rabitsch et al., 2001), and E. coli yaaH (James et al., 1993). As AlcS, all feature six putative transmembrane regions. 3.3. AlcS is a plasma membrane protein To determine the subcellular localization of the AlcS protein, we tagged AlcS at its carboxy terminus with the green Xuorescent protein (GFP). It was expressed under the control of the alcS promoter, allowing production of the fusion protein to a similar level as AlcS itself under physiological relevant conditions. A. nidulans transformants expressing this AlcS–GFP fusion were grown in minimal medium with L-threonine as the carbon source. Confocal laser scanning microscopy of these transformants revealed the presence of the AlcS–GFP fusion protein in the plasma membrane, and along the septa as seen by the superimposition (Fig. 4C) of Xuorescence of GFP (Fig. 4B) and that of membrane-speciWc dye FM4-64 (Fig. 4A). 3.4. Deletion or over-expression of alcS does not aVect growth on ethanol or acetate as a sole carbon source To date, deWnite biochemical function has not been established for any protein classed in the GPR1/FUN34/ yaaH family. However, some interesting phenotypic eVects have been described in yeast species for gpr1 and ady2 mutants. In S. cerevisiae, ADY2 (as well as FUN34) expression is elevated in liquid culture upon medium shift from glucose to the non-fermentative growth substrate acetate. Deletion of ADY2 results in loss of the low-aYnity acetate uptake system (common to propionate and formate), implying that this gene is necessary for the expression of an acetate permease (Paiva et al., 2004). In Y. lipolytica, deletion of the GPR1 gene leads to a prolonged lag phase in growth on acetate (Augstein et al., 2003).

Fig. 3. Sequence comparison of the A. nidulans AlcS protein with type representants of the GPR1/FUN34/YaaH family of transmembranal proteins. The amino acid sequence of the A. nidulans AlcS protein (AnAlcSp) was aligned with those of the three namesake proteins Y. lipolytica Gpr1p (YlGpr1p) (Kujau et al., 1992), S. cerevisiae Fun34p (ScFun34p) (Stettler et al., 1992) and E. coli YaaHp (EcYaaHp) (James et al., 1993) as well as with that of a second yeast protein, the probable acetate transporter Ady2p (ScAdy2p) (Paiva et al., 2004). The consensus line gives those residues that are conserved among all Wve proteins. The two signature sequences of the GPR1/FUN34/YaaH protein family are indicated by the grey boxes.

254

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

Fig. 4. AlcS is localized in the plasma membrane. The plasma membranes of the A. nidulans transformants expressing the AlcS–GFP fusion protein (BF299) upon growth on L-threonine, were speciWcally stained with the dye FM4-64 (see Section 2). (A) Membrane-speciWc FM4-64 Xuorescence (red); (B) GFP Xuorescence (green); (C) the superimposition of green and red Xuorescence appears as yellow.

In addition, gpr1 mutants are more sensitive to acetic acid toxicity at lower pH, when weak acids are mainly present in the undissociated form that enters the cell by passive diVusion. This would suggest that Gpr1p is involved in active transport of acetate to the exterior, allowing the organism to adapt to this carbon source while avoiding intoxication. We have constructed the null alcS mutant as well as a strain over-expressing alcS (in which expression is driven from the strong and constitutive gpdA promoter) (see Section 2), and tested their ability to grow on acetate as the sole carbon source. As controls, growth of these strains was also tested on media containing either ethanol or glycerol as the sole carbon source. As shown in Fig. 5, strains either lacking or over-expressing alcS behaved like wild-type on these diVerent media. Growth on acetate was also tested at diVerent concentrations of this carbon source and at diVerent medium pH, but again, no diVerences could be observed among the strains (data not shown).

3.5. Deletion or over-expression of alcS does not result in phenotypes related to possible secretion of ammonia In S. cerevisiae, three genes encoding members of the GPR1/FUN34/yaaH family, ADY2 (ATO1), FUN34 (ATO2) and ATO3, appear to be involved in the excretion of ammonia under conditions of colonial growth on solid media, in a concerted response to local nutrient depletion (Palkova et al., 2002). If such a process would occur in A. nidulans, it is unlikely that AlcS is involved in it, since this fungus responds to local nutrient depletion on solid media by initiating asexual development (conidiation) (Skromne et al., 1995) which is not impaired at all in alcs null mutants (Fig. 5). However, to investigate whether AlcS could be involved in secretion of ammonia by A. nidulans, we have tested a known physiological condition, described by Takasaki et al. (2004), under which much more ammonium is produced than necessary for metabolism and growth while the alc genes are induced.

Fig. 5. Growth of alcS gene-deleted mutants and transformants overexpressing alcS on plates containing ethanol or acetate as the sole carbon source. Plates with properly supplemented minimal medium containing sodium nitrate (10 mM) as the nitrogen source were prepared. Ethanol or glycerol was added to 1% v/v while acetate was administered to a Wnal concentration of 36 mM as detailed in Section 2. Freshly poured plates were point inoculated with six isogenic strains: two independent alcS-deleted strains (alcS: CV063 and CV064), two independent strains harbouring a wild type alcS gene (“ WT ”: CV043 and CV044) and two independent transformants in which alcS transcription is driven by the strong constitutive promoter of the A. nidulans gpdA gene (gpdA::alcS: CV050 and CV057) (see Section 2 and Table 1). The inoculated plates were incubated at 37 °C for 72 h.

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

Ammonia fermentation appears to constitute a survival mechanism under anaerobic conditions, involving the coupled conversion of ethanol and nitrate into acetate and ammonium, respectively, on a 2:1 molar basis, as the sole means for the fungus to generate ATP. Under these conditions, 80% of the nitrate is metabolized to ammonium, implying that the latter accumulates in the cell, and might be actively exported into the medium. The two end-products of ammonium fermentation, ammonium and acetate, are the two metabolites whose transport is aVected in a S. cerevisiae ady2 mutant (i.e., import for acetate and export for ammonium) (Paiva et al., 2004; Palkova et al., 2002). We have tested whether strains either lacking or overexpressing alcS behave diVerently from wild type strains on plates containing ethanol and nitrate when transferred to an anaerobic environment. However, no signiWcant diVerence in growth or colony morphology could be observed (data not shown). 3.6. AlcS does not appear to be essential for the transport of alcohols, aldehydes, or acetate Since we have shown that AlcS is resident in the plasma membrane, it appeared logical to look for a function in transport of either the substrate or the catabolic intermediates of ethanol catabolism—ethanol, acetaldehyde, and acetate—under inducing conditions. AlcS is dispensable for growth on standard ethanol plates in which the alcohol is present at a high concentration (1% v/v, equivalent to 170 mM). But it is conceivable that under such conditions, suYcient ethanol enters the fungal cell by diVusion as has been shown for S. cerevisiae (Guijarro and Lagunas, 1984). Therefore, we looked at the ability of the alcS null mutants and wild-type strain to grow on media with low concentrations (between 0.01 and 0.1% v/v) of ethanol as the sole carbon source. No growth diVerence was observed. We also tested the sensitivity of these strains to two inducing but toxic alcohols, allylalcohol and n-propanol, in the presence of a non-repressive growth substrate. Mutations in alcA and alcR protect the fungus against these alcohols because their toxic eVects depend on their oxidation to acrolein and propionaldehyde, respectively (Felenbok et al., 2001). However, screening allylalcohol- and n-propanol toxicity in the millimolar and micromolar ranges could not discriminate alcS-deleted strains from wild type. These results strongly suggest that AlcS is not important for the uptake of alcohols. Possible involvement of AlcS in the transport of acetaldehyde across the plasma membrane has been addressed with cross feeding assays on ethanol plates (Flipphi et al., 2001). This assay depends, on one hand, on the ability of leaky aldA mutants (which grow very slowly on ethanol) to produce a surplus of acetaldehyde from ethanol that gets exported and diVuses into the surrounding medium. On the other hand, this extracellular acetaldehyde somehow penetrates carbon-starved mycelium of structural alcA loss-offunction mutants, capable of catabolizing it. alcA mutants

255

cannot grow on ethanol but are able, as other A. nidulans strains, to utilize agar as a very poor carbon source leading to colonies of low hyphal density with sparse sporulation in the absence of any other growth substrate (Armitt et al., 1976). This sequence of events results in local growth and dense sporulation of alcA mutants (like alcA4951) in the vicinity of a leaky aldA mutant (like aldA15) (Flipphi et al., 2001). However, an aldA15 mutant that lacks the alcS gene (BF125) was able to crossfeed (data not shown). Moreover, a strain that lacks both alcA and alcS (BF073) behaved like the alcA4951 control. Furthermore, we were unable to observe any diVerence in behavior when both partners in the crossfeeding assay lacked the alcS gene. This suggests that AlcS is not necessary for transport of acetaldehyde across the plasma membrane. The ability of alcS mutants to grow like wild-type on acetate as the sole carbon source indicates that AlcS is not required for entry of acetate in the cell. However, this does not exclude the possibility that AlcS might be involved in the export of acetate in the surroundings to prevent toxic eVects resulting from its intracellular accumulation. Acetate (like other weak acids) is known to aVect intracellular processes, for example nutrient and ion transport, membrane structure, fatty acid and phospholipid composition, as well as protein synthesis (Jones, 1989; Sikkema et al., 1995). The fact that AlcS is not expressed on acetate (cf. Fig. 1A) does not exclude the possibility that the protein could be involved in such control when ethanol is the carbon source. To test this hypothesis, we crossed a alcS mutant with the CV061 strain which is mutated in the acetyl-CoA synthetase (facA) gene (facA330) (Armitt et al., 1976). Such a strain accumulates acetate when grown on a non-repressive carbon source (such as glycerol) in the presence of ethanol. Double alcS facA330 mutants from the progeny, together with single facA330 mutants, have been tested for their ability to grow on a medium with glycerol as a carbon source either alone or in presence of ethanol. However, no signiWcant diVerences have been observed between these two types of mutants on these media, indicating that the presence of AlcS does not result in a higher tolerance of the facA mutants to acetate accumulation. 3.7. Two other A. nidulans genes, encoding members of the GPR1/FUN34/yaaH family of membrane proteins, are induced by ethanol The lack of a phenotype for alcS mutant strains prompted us to suggest that some other gene might be able to perform its function in its absence. The recent public release of the complete genome sequence of A. nidulans by the Whitehead Institute for Biomedical Research (http:// www.broad.mit.edu/annotation/fungi/aspergillus/index) facilitated the search for such a gene. The most obvious candidates are those that encode membrane proteins belonging to the GPR1/FUN34/yaaH family. Basic Local Alignment Search Tool (BLAST) screening of the A. nidulans genome data with the S. cerevisiae Ady2p and the

256

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

A. nidulans AlcS sequences yielded four new genes encoding hypothetical proteins that would belong to the GPR1/ FUN34/yaaH family: AN5226, AN1839, AN7317, and AN8390 (according to the annotation nomenclature by the Whitehead Institute). The three Wrst proteins are more similar to the family’s eukaryotic type proteins than AlcS is (Fig. 6). Particularly, AN5226 exhibits a high similarity at the amino acid sequence level with Ady2p and Gpr1p (43 and 34% identity, respectively). AN8390, however, exhibits substantial similarity to AlcS (36% identity) rather than to Gpr1p/Ady2p, but clearly belongs to the GPR1/FUN34/ yaaH family (Fig. 6). By transcript analysis, we found that one of these four genes, AN5226, is induced in the presence of the typical alc inducers such as ethanol and ethylacetate (Fig. 7). However, in contrast to alcS, this gene (which has two transcript products), is expressed to high levels under conditions of non-induction (i.e., lactose) and even after addition of acetate (Fig. 7). The induced transcription level obtained with ethanol was decreased in mycelia to which both ethanol and acetate were added (data not shown). The gene AN5226 thus appears, like alcS, to be induced by ethanol and ethylacetate, and repressed by acetate under induced conditions in a wild type strain. Although no pseudo-constitutive expression is observed in a aldA67 mutant, these data leave open the possibility that AN5226 could compensate for any loss of AlcS function under relevant growth conditions, especially since the induced level of the smaller transcript appears to be somewhat higher in a alcS mutant strain (Fig. 7). Although the transcriptional level of AN8390 is low when compared to that of alcS in a wild-type strain, it is induced by ethylacetate (Fig. 7). Its ethanol induction,

which is not obvious in a wild type strain, becomes clear in an aldA67 mutant that accumulates acetaldehyde (Fig. 7), suggesting that this transcriptional induction could be mediated by AlcR. Although the transcription pattern of

Fig. 7. The genes encoding two hypothetical GPR1/FUN34/YaaH family proteins in A. nidulans, AN5226 and AN8390, are co-expressed with alcS. The expression of the Wve A. nidulans genes encoding hypothetical proteins, AN0366, AN1839, AN5226, AN7317, and AN8390, in response to typical alcS inducing conditions (i.e., ethanol and ethylacetate) was analyzed at the transcript level in various genetic backgrounds. BF146 provided an aldA67 mutant background, in which the alcS gene is expressed in absence of external inducer compounds (see Fig. 1), CV064 was used as an alcS-deleted background (alcS), and CV044 served as the wild type (WT) context (see Table 1). 32P-labelled probes for the Wve genes were prepared as detailed in Section 2. Further experimental details and abbreviations were as described in the legend to Fig. 1. We could not detect expression of three of the genes of interest, those encoding AN0366, AN1839, and AN7317, in any of the genetic contexts under the conditions tested, and therefore, their analyses are not shown.

Fig. 6. Sequence alignment of Wve proteins speciWed by the A. nidulans genome that can be assigned to the GPR1/FUN34/YaaH protein family. The AlcS sequence (ANAlcS) was aligned with the amino acid sequences of three hypothetical proteins speciWed by the A. nidulans genome sequence, AN1839, AN5226 and AN7317, similar to the probable acetate transporter in yeast, ScAdy2p, as well as with the amino acid sequence of a fourth hypothetical protein in A. nidulans, AN8390, that displays considerable similarity with AlcS but less with the type members of the GPR1/FUN34/YaaH protein family. The PileUp program of the Wisconsin Sequence Analysis Package (Genetics Computer Group, Madison, WI, USA) was run using default settings. Note that another hypothetical protein from A. nidulans, AN0366, was identiWed upon a BLASTP screening with the AlcS sequence. This protein, like all others mentioned above, is predicted to contain six transmembranal domains, however, it fails to align properly with the two signature sequences of the GPR1/ FUN34/YaaH protein family and was therefore left out of the alignment. Perhaps one could consider AN0366 an atypical member of the GPR1/FUN34/ YaaH family of transmembranal proteins.

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

AN8390 is not signiWcantly aVected in a alcS mutant (Fig. 7), the encoded protein might be able to compensate for the absence of AlcS. 4. Discussion In this study, we characterize the A. nidulans alcS gene, which is the most abundantly transcribed among the alc cluster genes whose functions are unknown to date, but whose pattern of expression is the same than that of alcA (Fillinger and Felenbok, 1996). We have sequenced its cDNA and shown that the encoded protein (AlcS) is located in the plasma membrane, as expected from its hydrophobicity pattern that indicates the presence of six putative transmembrane regions. However, AlcS is apparently not involved in the transport of ethanol, acetaldehyde or acetate, and no obvious phenotype has been observed with both the alcS knock-out mutant and the alcS-overexpressing strain. The absence of an observable phenotype in the alcS null mutant might be due to the presence, in the genome of A. nidulans, of two other ethanol-induced genes, AN5226 and AN8390, which encode hypothetical proteins also belonging to the GPR1/FUN34/yaaH membrane protein family. Even though alcS (like alcO and alcM) is dispensable for growth on ethanol, its AlcR-responsiveness, its strict coregulation with alcA, and the cluster organization with alcR and alcA suggest that there is an intimate link between ethanol catabolism and the pathway(s) in which AlcS is involved. Especially, the alc system (alcR, alcA, and aldA) might be involved in other concomitant processes that are relevant to ethanol utilization and require the other alc cluster genes. Such a hypothesis is reinforced by the high level of the alc gene expression. Indeed, one remarkable characteristic of the ethanol utilization system is its high inducibility. It can be considered one of the strongest inducible fungal expression systems (Felenbok, 1991). This is based on two features. The Wrst is the high level of expression of the alcR transacting gene, resulting from alcR positive endogenous activation enhancing its own expression. A second feature is the high inducibility of the alcA and aldA promoters (Felenbok et al., 1988; Lockington et al., 1987). It is unlikely that catabolism of ethanol alone could justify such a high level of expression of the alc genes. For instance, a set of experimental data indicate that only 20% of the wild-type Krebs TCA cycle enzyme activities in yeast is required for a fully functional TCA cycle (Kispal et al., 1990; Velot et al., 1999), suggesting that these enzymes may be involved in processes other than catalytic ones. Several studies have conWrmed this hypothesis (Chen et al., 2005; Elzinga et al., 1993; Kaufman et al., 2000). Besides its classiWcation in the GPR1/FUN34/yaaH family, the comparison of the AlcS protein with fungal sequence databases revealed signiWcant similarity with two hypothetical proteins: one from F. graminearum (44% identity), and one from U. maydis (37% identity) (but see Note added in proof). However, such high similarity was not

257

detected with any yeast protein, and notably from S. cerevisiae, consistent with the fact that AlcS does not encode a vital function for ethanol catabolism. Among the members of the GPR1/FUN34/yaaH family, Gpr1p from Y. lipolytica and Ady2p from S. cerevisiae are the only two for which some functional information is available. The physiological role of both genes is related to the intracellular presence of acetate. Gpr1p is required for adaptation of Y. lipolytica cells to acetic acid, and might be involved in acetate export, preventing intracellular accumulation of the acid (Augstein et al., 2003). However, we have shown that the absence of AlcS does not aVect the growth of a facA loss-of-function mutant, that accumulates acetate when grown on glycerol as the carbon source in presence of ethanol. Ady2p has been shown to be a key determinant for the kinetics of acetate transport in S. cerevisiae (Paiva et al., 2004). We have shown that an A. nidulans alcS mutant strain grows as well as a wild-type strain on media with acetate as the sole carbon source. Nevertheless, this is not enough to conclude that AlcS is not involved in acetate transport since Ady2p is apparently not necessary for normal growth of S. cerevisiae on acetate (Paiva et al., 2004). However, the basal expression of alcS is totally repressed in presence of acetate (cf. Fig. 1A), while both ADY2 and GPR1 genes are constitutively expressed but are induced when ethanol or acetate are the growth substrates (Augstein et al., 2003; Paiva et al., 2004). Moreover, deletion of GPR1 or ADY2 indirectly aVect the transcriptional expression of the glyoxylate cycle genes (Kujau et al., 1992; Paiva et al., 2004), required for growth on two-carbon compounds by enabling the synthesis of gluconeogenic metabolites from acetyl-CoA units. On the contrary, deletion of alcS has no consequences for the expression of the acuD and acuE genes encoding isocitrate lyase and malate synthase, respectively (data not shown). Altogether, our data show that alcS cannot be the functional analogue of either S. cerevisiae ADY2 or Y. lipolytica GPR1. AN5226 is the A. nidulans protein with the highest similarity to Ady2p, Fun34p, and Gpr1p. However, transcription of the gene does not seem to be induced by acetate, but rather in the presence of the typical alc inducers ethanol and ethylacetate. The ethanol induction is decreased in the presence of acetate, but in contrast to the alc genes, this weak acid has no eVect on the basal transcript level (obtained on lactose) of AN5226. Moreover, contrary to the alc genes, the aldA67 mutation does not result in an increase of AN5226 expression (cf. Fig. 7). Therefore, the induction proWle of the gene AN5226 resembles neither that of typical alc genes, mediated by AlcR in response to aldehydes and ketones (Flipphi et al., 2002), nor that of structural genes involved in acetate catabolism (facA, acuD, acuE) mediated by another activator, FacB in response to acetate (Armitt et al., 1976; Katz and Hynes, 1989). The gene rather appears to respond to small amounts of intracellular acetate formed upon catabolism of ethanol and ethylacetate, which could suggest that AN5226 might function as a high-aYnity carboxylic acid transporter.

258

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

Although the transcriptional expression level of AN8390 is low when compared to those of AN5226 or alcS, it also appears to be induced by the typical alc inducers, ethanol and ethylacetate, especially in a aldA67 mutant strain. This suggests that acetaldehyde is, as for alc genes, the physiological inducer. The AN8390 hypothetical protein displays the highest similarity with AlcS (36% identity). This similarity is conWrmed by a topology prediction performed with the software TopPred (http:// bioweb.pasteur.fr/seqanal/interfaces/toppred.html) which shows a very similar structural organization in the plasma membrane for both proteins, with the main loop (extracellular) between the third and the fourth transmembranal segments. On the contrary, the same prediction performed for AN5226 shows a diVerent organization with the main loop (cytoplasmic) between the fourth and the Wfth transmembranal segments. Therefore, AN8390 may well correspond to an AlcS isoform. Altogether, our data could indicate that each one of the proteins AN5226 and AN8390 totally or partly fulWll the function of AlcS in its absence, and in the future we will undertake the knock-out of the corresponding genes with the hope to elucidate the functionality of AlcS and the other GPR1/FUN34/YaaH membrane proteins in A. nidulans. Note added in proof By TBLASTN screening genomic sequence data of the opportunistic Wlamentous fungal human pathogen A. fumigatus (Nierman et al., 2005) we identiWed a gene that likely encodes a functional homologue of A. nidulans AlcS. A 1178-bp DNA-sequence having an intron-exon structure identical to that of the A. nidulans alcS gene was identiWed. The corresponding nucleotide sequence data are available in the Third Party Annotation Section of the DDBJ/EMBL/GenBank databases under the accession number TPA: BK005755. Whilst the spliced coding sequences share 64% identity with those of A. nidulans alcS, the sequences of the six introns are not conserved at all. The open reading frame codes for a protein of 272 amino acids that is 69% identical to the A. nidulans AlcS protein. The 10 additional amino acids are located at the N-terminus of the A. fumigatus protein. The A. fumigatus alcS gene apparently went unnoticed by automatic annotation which instead predicts a gene encoding a much smaller protein (EAL84794) at the locus of the alcS homologue. Sequences highly similar to A. nidulans alcS are present in numerous other accessible Wlamentous fungal genome sequences. Interestingly, in A. fumigatus, alcS is clustered with two genes that are highly expressed upon growth on ethanol (Kniemeyer et al., 2005). These two genes (GenBank AAHF01000015: positions 459147 to 460328 and 461659 to 463304) have been annotated as encoding putative alcohol-(EAL84792; locus tag Afu7g01010) and aldehyde dehydrogenases (EAL84793; locus tag Afu7g01000), respectively.

Acknowledgments We are grateful to Marie-Françoise Cochet who selected the initial GFP transformants and helped, together with Sabine Fillinger, with the DNA sequencing. We thank Christine Drevet and Andrew MacCabe for help with informatics, Valerie Nicolas for her expertise in confocal microscopy, Michael DuBow for correcting the English, and Igor Nikolaev, Gloria Boncompagni and Sylvine Pegot for technical assistance. This work was supported by the Centre National de la Recherche ScientiWque (CNRS: contrat ATIP 2JE077). M.F. was initially an EC Marie Curie fellow (European Community: grant BIO4-CT97-5028). X.R. is a recipient of doctoral fellowship from the Ministère de l’Enseignement Supérieur et de la Recherche of the French Government. References Armitt, S., McCullough, W., Roberts, C.F., 1976. Analysis of acetate nonutilizing (acu) mutants in Aspergillus nidulans. J. Gen. Microbiol. 92, 263–282. Arst Jr., H.N., MacDonald, D.W., 1975. A gene cluster in Aspergillus nidulans with an internally located cis-acting regulatory region. Nature 254, 26–31. Arst Jr., H.N., Bailey, C.R., 1977. The regulation of carbon metabolism in Aspergillus. In: Smith, J.E., Pateman, J.A. (Eds.), Genetics and Physiology of Aspergillus. Academic Press, London, pp. 131–146. Augstein, A., Barth, K., Gentsch, M., Kohlwein, S.D., Barth, G., 2003. Characterization, localization and functional analysis of Gpr1p, a protein aVecting sensitivity to acetic acid in the yeast Yarrowia lipolytica. Microbiology 149, 589–600. Bailey, C., Arst Jr., H.N., 1975. Carbon catabolite repression in Aspergillus nidulans. Eur. J. Biochem. 51, 573–577. Brody, H., GriYth, J., Cuticchia, A.J., Arnold, J., Timberlake, W.E., 1991. Chromosome-speciWc recombinant DNA libraries from the fungus Aspergillus nidulans. Nucleic Acids Res. 19, 3105–3109. Chaveroche, M.K., Ghigo, J.M., d’Enfert, C., 2000. A rapid method for eYcient gene replacement in the Wlamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28, E97. Chen, X.J., Wang, X., Kaufman, B.A., Butow, R.A., 2005. Aconitase couples metabolic regulation to mitochondrial DNA maintenance. Science 307, 714–717. Chiu, W., Niwa, Y., Zeng, W., Hirano, T., Kobayashi, H., Sheen, J., 1996. Engineered GFP as a vital reporter in plants. Curr. Biol. 6, 325–330. Clutterbuck, A.J., 1974. Aspergillus nidulans. In: King, R.C. (Ed.), Handbook of Genetics. Bacteria, Bacteriophages, and Fungi. Plenum Press, New York, London, pp. 447–510. Clutterbuck, A.J., 1993. Aspergillus nidulans. In: O’Brien, S.J. (Ed.), Genetic Maps: Locus Maps of Complex Genomes. Cold Spring Harbor laboratory, Cold Spring Harbor, NY, pp. 3.71–73.84. Cove, D.J., 1966. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113, 51–56. Elzinga, S.D., Bednarz, A.L., van Oosterum, K., Dekker, P.J., Grivell, L.A., 1993. Yeast mitochondrial NAD(+)-dependent isocitrate dehydrogenase is an RNA-binding protein. Nucleic Acids Res. 21, 5328–5331. Felenbok, B., 1991. The ethanol utilization regulon of Aspergillus nidulans: the alcA–alcR system as a tool for the expression of recombinant proteins. J. Biotechnol. 17, 11–17. Felenbok, B., Flipphi, M., Nikolaev, I., 2001. Ethanol catabolism in Aspergillus nidulans: a model system for studying gene regulation. Prog. Nucleic Acid Res. Mol. Biol. 69, 149–204. Felenbok, B., Sequeval, D., Mathieu, M., Sibley, S., Gwynne, D.I., Davies, R.W., 1988. The ethanol regulon in Aspergillus nidulans: characteriza-

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260 tion and sequence of the positive regulatory gene alcR. Gene 73, 385– 396. Fillinger, S., Felenbok, B., 1996. A newly identiWed gene cluster in Aspergillus nidulans comprises Wve novel genes localized in the alc region that are controlled both by the speciWc transactivator AlcR and the general carbon-catabolite repressor CreA. Mol. Microbiol. 20, 475–488. Fischer-Parton, S., Parton, R.M., Hickey, P.C., Dijksterhuis, J., Atkinson, H.A., Read, N.D., 2000. Confocal microscopy of FM4-64 as a tool for analysing endocytosis and vesicle traYcking in living fungal hyphae. J. Microsc. 198, 246–259. Flipphi, M., Felenbok, B., 2004. The onset of carbon catabolic repression and interplay between speciWc induction and carbon catabolite repression in Aspergillus nidulans. In: Brambl, R., Marzluf, G.A. (Eds.), The Mycota III. Biochemistry and Molecular Biology, second ed. SpringerVerlag, Berlin, Heidelberg, pp. 403–420. Flipphi, M., Kocialkowska, J., Felenbok, B., 2002. Characteristics of physiological inducers of the ethanol utilization (alc) pathway in Aspergillus nidulans. Biochem. J. 364, 25–31. Flipphi, M., Kocialkowska, J., Felenbok, B., 2003a. Relationships between the ethanol utilization (alc) pathway and unrelated catabolic pathways in Aspergillus nidulans. Eur. J. Biochem. 270, 3555–3564. Flipphi, M., Mathieu, M., Cirpus, I., Panozzo, C., Felenbok, B., 2001. Regulation of the aldehyde dehydrogenase gene (aldA) and its role in the control of the coinducer level necessary for induction of the ethanol utilization pathway in Aspergillus nidulans. J. Biol. Chem. 276, 6950– 6958. Flipphi, M., van de Vondervoort, P.J.I., Ruijter, G.J.G., Visser, J., Arst Jr., H.N., Felenbok, B., 2003b. Onset of carbon catabolite repression in Aspergillus nidulans. Parallel involvement of hexokinase and glucokinase in sugar signaling. J. Biol. Chem. 278, 11849–11857. Guijarro, J.M., Lagunas, R., 1984. Saccharomyces cerevisiae does not accumulate ethanol against a concentration gradient. J. Bacteriol. 160, 874– 878. Gwynne, D.I., Buxton, F.P., Sibley, S., Davies, R.W., Lockington, R.A., Scazzocchio, C., Sealy-Lewis, H.M., 1987. Comparison of the cis-acting control regions of two coordinately controlled genes involved in ethanol utilization in Aspergillus nidulans. Gene 51, 205–216. Hawkins, A.R., Lamb, H.K., Roberts, C.F., 1994. Control of metabolic Xux in the shikimate and quinate pathways. Prog. Ind. Microbiol. 29, 195– 220. James, R., Dean, D.O., Debbage, J., 1993. Five open reading frames upstream of the dnaK gene of E. coli. DNA Seq. 3, 327–332. Johnstone, I.L., McCabe, P.C., Greaves, P., Gurr, S.J., Cole, G.E., Brow, M.A., Unkles, S.E., Clutterbuck, A.J., Kinghorn, J.R., Innis, M.A., 1990. Isolation and characterisation of the crnA–niiA–niaD gene cluster for nitrate assimilation in Aspergillus nidulans. Gene 90, 181–192. Jones, R.P., 1989. Biological principles for the eVects of ethanol. Enzyme Microb. Technol. 11, 130–153. Katz, M.E., Hynes, M.J., 1989. Isolation and analysis of the acetate regulatory gene, facB, from Aspergillus nidulans. Mol. Cell. Biol. 9, 5696–5701. Kaufman, B.A., Newman, S.M., Hallberg, R.L., Slaughter, C.A., Perlman, P.S., Butow, R.A., 2000. In organello formaldehyde crosslinking of proteins to mtDNA: identiWcation of bifunctional proteins. Proc. Natl. Acad. Sci. USA 97, 7772–7777. Keller, N.P., Hohn, T.M., 1997. Metabolic pathway gene clusters in Wlamentous fungi. Fungal Genet. Biol. 21, 17–29. Kispal, G., Evans, C.T., Srere, P.A., 1990. Changes in the phenotype of a yeast mutant by insertion of an inactive enzyme. In: Srere, P.A., Jones, M.E., Mathews, C.K. (Eds.), Structural and Organization Aspects of Metabolic Regulation. Wiley-Liss, New York, Chichester, Brisbane, Toronto, Singapore, pp. 389–403. Kniemeyer, O., Lessing, F., Scheibner, O., Hertweck, C., Brakhage, A.A., 2005. Optimisation of a 2-D gel electrophoresis protocol for the human pathogenic fungus Aspergillus fumigatus. Curr. Genet., DOI doi:10.1007/s00294-005-0047-9. Kujau, M., Weber, H., Barth, G., 1992. Characterization of mutants of the yeast Yarrowia lipolytica defective in acetyl-coenzyme A synthetase. Yeast 8, 193–203.

259

Kulmburg, P., Sequeval, D., Lenouvel, F., Mathieu, M., Felenbok, B., 1992. IdentiWcation of the promoter region involved in the autoregulation of the transcriptional activator ALCR in Aspergillus nidulans. Mol. Cell. Biol. 12, 1932–1939. Kulmburg, P., Mathieu, M., Dowzer, C., Kelly, J., Felenbok, B., 1993. SpeciWc binding sites in the alcR and alcA promoters of the ethanol regulon for the CREA repressor mediating carbon catabolite repression in Aspergillus nidulans. Mol. Microbiol. 7, 847–857. Kulmburg, P., Prange, T., Mathieu, M., Sequeval, D., Scazzocchio, C., Felenbok, B., 1991. Correct intron splicing generates a new type of a putative zinc-binding domain in a transcriptional activator of Aspergillus nidulans. FEBS Lett. 280, 11–16. Lockington, R., Scazzocchio, C., Sequeval, D., Mathieu, M., Felenbok, B., 1987. Regulation of alcR, the positive regulatory gene of the ethanol utilization regulon of Aspergillus nidulans. Mol. Microbiol. 1, 275–281. Lockington, R.A., Sealy-Lewis, H.M., Scazzocchio, C., Davies, R.W., 1985. Cloning and characterization of the ethanol utilization regulon in Aspergillus nidulans. Gene 33, 137–149. Mathieu, M., Felenbok, B., 1994. The Aspergillus nidulans CREA protein mediates glucose repression of the ethanol regulon at various levels through competition with the ALCR-speciWc transactivator. EMBO J. 13, 4022–4027. Mathieu, M., Fillinger, S., Felenbok, B., 2000. In vivo studies of upstream regulatory cis-acting elements of the alcR gene encoding the transactivator of the ethanol regulon in Aspergillus nidulans. Mol. Microbiol. 36, 123–131. Mullaney, E.J., Hamer, J.E., Roberti, K.A., Yelton, M.M., Timberlake, W.E., 1985. Primary structure of the trpC gene from Aspergillus nidulans. Mol. Gen. Genet. 199, 37–45. Nierman, W.C., Pain, A., Anderson, M.J., Wortman, J.R., Kim, H.S., Arroyo, J., Berriman, M., Abe, K., Archer, D.B., Bermejo, C., et al., 2005. Genomic sequence of the pathogenic and allergenic Wlamentous fungus Aspergillus fumigatus. Nature 438, 1151–1156. Paiva, S., Devaux, F., Barbosa, S., Jacq, C., Casal, M., 2004. Ady2p is essential for the acetate permease activity in the yeast Saccharomyces cerevisiae. Yeast 21, 201–210. Palkova, Z., Devaux, F., Icicova, M., Minarikova, L., Le Crom, S., Jacq, C., 2002. Ammonia pulses and metabolic oscillations guide yeast colony development. Mol. Biol. Cell 13, 3901–3914. Panozzo, C., Cornillot, E., Felenbok, B., 1998. The CreA repressor is the sole DNA-binding protein responsible for carbon catabolite repression of the alcA gene in Aspergillus nidulans via its binding to a couple of speciWc sites. J. Biol. Chem. 273, 6367–6372. Panozzo, C., Capuano, V., Fillinger, S., Felenbok, B., 1997. The zinc binuclear cluster activator AlcR is able to bind to single sites but requires multiple repeated sites for synergistic activation of the alcA gene in Aspergillus nidulans. J. Biol. Chem. 272, 22859–22865. Pateman, J.A., Doy, C.H., Olsen, J.E., Norris, U., Creaser, E.H., Hynes, M., 1983. Regulation of alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (AldDH) in Aspergillus nidulans. Proc. R. Soc. London B 217, 243–264. Pickett, M., Gwynne, D.I., Buxton, F.P., Elliott, R., Davies, R.W., Lockington, R.A., Scazzocchio, C., Sealy-Lewis, H.M., 1987. Cloning and characterization of the aldA gene of Aspergillus nidulans. Gene 51, 217–226. Pokorska, A., Drevet, C., Scazzocchio, C., 2000. The analysis of the transcriptional activator PrnA reveals a tripartite nuclear localisation sequence. J. Mol. Biol. 298, 585–596. Punt, P.J., Zegers, N.D., Busscher, M., Pouwels, P.H., van den Hondel, C.A.M.J.J., 1991. Intracellular and extracellular production of proteins in Aspergillus under the control of expression signals of the highly expressed Aspergillus nidulans gpdA gene. J. Biotechnol. 17, 19–33. Rabitsch, K.P., Toth, A., Galova, M., SchleiVer, A., SchaVner, G., Aigner, E., Rupp, C., Penkner, A.M., Moreno-Borchart, A.C., Primig, M., Esposito, R.E., Klein, F., Knop, M., Nasmyth, K., 2001. A screen for genes required for meiosis and spore formation based on wholegenome expression. Curr. Biol. 11, 1001–1009. Sambrook, J., Russel, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, New York.

260

M. Flipphi et al. / Fungal Genetics and Biology 43 (2006) 247–260

Sikkema, J., de Bont, J.A., Poolman, B., 1995. Mechanisms of membrane toxicity of hydrocarbons. Microbiol. Rev. 59, 201–222. Skromne, I., Sanchez, O., Aguirre, J., 1995. Starvation stress modulates the expression of the Aspergillus nidulans brlA regulatory gene. Microbiology 141, 21–28. Specht, C.A., DiRusso, C.C., Novotny, C.P., Ullrich, R.C., 1982. A method for extracting high-molecular-weight deoxyribonucleic acid from fungi. Anal. Biochem. 119, 158–163. Stettler, S., Mariotte, S., Riva, M., Sentenac, A., Thuriaux, P., 1992. An essential and speciWc subunit of RNA polymerase III (C) is encoded by gene RPC34 in Saccharomyces cerevisiae. J. Biol. Chem. 267, 21390–21395. Takasaki, K., Shoun, H., Yamaguchi, M., Takeo, K., Nakamura, A., Hoshino, T., Takaya, N., 2004. Fungal ammonia fermentation, a novel metabolic mechanism that couples the dissimilatory and assimilatory

pathways of both nitrate and ethanol. Role of acetyl CoA synthetase in anaerobic ATP synthesis. J. Biol. Chem. 279, 12414–12420. Tilburn, J., Scazzocchio, C., Taylor, G.G., Zabicky-Zissman, J.H., Lockington, R.A., Davies, R.W., 1983. Transformation by integration in Aspergillus nidulans. Gene 26, 205–221. Upshall, A., Gilbert, T., Saari, G., O’Hara, P.J., Weglenski, P., Berse, B., Miller, K., Timberlake, W.E., 1986. Molecular analysis of the argB gene of Aspergillus nidulans. Mol. Gen. Genet. 204, 349–354. Velot, C., Lebreton, S., Morgunov, I., Usher, K.C., Srere, P.A., 1999. Metabolic eVects of mislocalized mitochondrial and peroxisomal citrate synthases in yeast Saccharomyces cerevisiae. Biochemistry 38, 16195– 16204. von Heijne, G., 1992. Membrane protein structure prediction. Hydrophobicity analysis and the positive-inside rule. J. Mol. Biol. 225, 487–494.