Functional analysis of cholesterol biosynthesis by RNA interference

Journal of Steroid Biochemistry & Molecular Biology 104 (2007) 105–109

Functional analysis of cholesterol biosynthesis by RNA interference夽 Christina Guggenberger, Denise Ilgen, Jerzy Adamski ∗ GSF-National Research Center for Environment and Health, Institute of Experimental Genetics, Genome Analysis Center, Ingolstaedter Landstr. 1, 85764 Neuherberg, Germany

Abstract Inborn errors of cholesterol biosynthesis caused by dysfunctionality of single enzymes are known to cause severe malformation syndromes like X-linked chondrodysplasia punctata (CDPX2), CHILD syndrome or Smith–Lemli–Opitz-syndrome (SLOS). In this study we established the method of RNA interference (RNAi) for analyzing the molecular mechanisms underlying disrupted cholesterol biosynthesis. For different genes involved in the cholesterol biosynthesis pathway-NAD(P) dependent steroid dehydrogenase-like (NSDHL), 17-beta hydroxysteroid dehydrogenase type 7 (HSD17B7) and emopamil binding protein (EBP)-shRNA sequences were designed and tested for their effectiveness. For a better comparability of the experiments and to avoid different transfection efficiencies, examined shRNA sequences which reached a knock down of at least 80% were stably transfected in a HeLa cell line with a tetracycline-regulated expression (HeLa T-REx). These stable transfected cell lines represent novel tools for the analysis of cholesterol biosynthesis. © 2007 Elsevier Ltd. All rights reserved. Keywords: Cholesterol biosynthesis; RNA interference; HSD17B7; NSDHL; EBP

1. Introduction

2. Materials and methods

Cholesterol is not only a structural lipid and a precursor molecule for bile acid and steroid hormone synthesis, it also plays an important role in embryogenesis. Inborn errors of cholesterol biosynthesis caused by dysfunctionality of single enzymes are known to cause severe malformation syndromes like X-linked chondrodysplasia punctata (CDPX2), CHILD syndrome or Smith–Lemli–Optiz syndrome (SLOS) [1,2]. However, the molecular mechanisms of these syndromes are not yet understood. Possibly affected pathways include but are not restricted to sonic hedgehog [3] or ROR alpha [4] which are modulated by cholesterol direct or by its metabolites. With the method of RNAi we wanted to specifically manipulate selected steps of cholesterol biosynthesis and elucidate the pathogenesis of CDPX2, CHILD and SLOS and their underlining molecular mechanisms.

2.1. Bioinformatic prediction of effective shRNAs

夽 Poster paper presented at the 17th International Symposium of the Journal of Steroid Biochemistry and Molecular Biology, ‘Recent Advances in Steroid Biochemistry and Molecular Biology’ (Seefeld, Austria, 31 May–03 June 2006). ∗ Corresponding author. Tel.: +49 89 3187 3155; fax: +49 89 3187 3225. E-mail address: [email protected] (J. Adamski).

0960-0760/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.jsbmb.2007.03.001

Three servers were employed for the analysis of shRNA sequences: BLOCK-iTTM RNAi Designer (https:// rnaidesigner.invitrogen.com/rnaiexpress/), siRNA Target Designer (http://www.promega.com/siRNADesigner/), siRNA Target Finder (https://www.genscript.com/ssl-bin/ app/rnai). 2.2. Generation of shRNA expression vectors For generating shRNA expression vectors, single stranded Oligos were ordered from Invitrogen. Equal amounts of the single-stranded oligos (ss oligos) were annealed to generate double stranded oligos (ds oligos). The ds oligos were cloned via TOPO TA-Cloning into pENTRTM /U6 (Invitrogen, Karlsruhe, Germany) for transient transfection and pENTRTM /H1/TO (Invitrogen) for stable transfection. 2.3. Cloning of human NSDHL, HSD17B7 and EBP For cloning, parts of the CDS were amplified by PCR from HeLa cDNA. NSDHL, HSD17B7 and EBP were cloned

106

C. Guggenberger et al. / Journal of Steroid Biochemistry & Molecular Biology 104 (2007) 105–109

into psiCHECK-2 (Promega, Mannheim, Germany) by use of XhoI and NotI (NSDHL, EBP) and NotI (HSD17B7) restriction sites (PCR primers: NSDHL: forward 5 -CAG TCT CGA GCA GCA AGG GTT TGA TAA TCC CCA G-3 , reverse 5 -GTC AGC GGC CGC CAG GTG GCG AAA GCT CTG CAC GG-3 , HSD17B7: forward 5 -GTC AGC GGC CGC CGA AAG GTG GTT TTG ATC ACC G-3 , reverse 5 -GTC AGC GGC CGC TTC AGG CTT TTG GTG GAA AAG C3 , EBP: forward 5 -CAG TCT CGA GAT GAC TAC CAA CGC GGG CC-3 , reverse 5 -GTC AGC GGC CGC GGC CTT GGC ATC CAG CG-3 ). The inserts were verified by DNA sequencing. For transfection, DNA was isolated using the PureYield Midi Kit (Promega, Mannheim, Germany) according to the manufacturer’s protocol. 2.4. Cell culture HeLa, HeLa T-Rex and stably transfected HeLa T-Rex cells were grown under humidified standard conditions (37 ◦ C, 5% CO2 ) in minimum essential medium with GlutMAXTM I (Invitrogen, Karlsruhe, Germany) supplemented with 10% FBS, tested for tetracyclin (Biochrom AG, Berlin, Germany), 100 U/ml penicillin and 100 U/ml streptomycin (Invitrogen). Depending on the cell line, 5 ␮g/ml blasticidin and 100 ␮g/ml zeocin (both Invitorgen) were added to the medium. For induction of the stably transfected HeLa T-Rex tetracyclin (Sigma–Aldrich, Taufkirchen, Germany) was added to the medium in a final concentration of 10 ␮g/ml. For transfection, FuGENE6 transfection reagent (Roche Biosciences, Mannheim, Germany) was used according to the manufacturer’s instructions. For analysis of shRNA effectiveness the Dual Luciferase Reporter Assay System (Promega, Mannheim, Germany) was used. The cells were seeded in 12-well culture plates and grown overnight under humidified standard conditions. Then the cells were transfected with the screening vector. For induction of shRNA expression the stable transfected HeLa T-REx were treated with tetracyclin 6 h after transfection. Thirty-two hours after transfection the cells were harvested and luciferase activities were measured. 2.5. Western blot For the positive control bacteria pellets containing the overexpressed human HSD17B7 from a pGEX/hHSD17B7 construct were resuspended in lysis buffer (containing 1000 × proteinase inhibitor (Sigma–Aldrich, Taufkirchen, Germany)) and disrupted by multiple freeze and thaw cycles. After centrifugation for 20 min at 4500 rpm at 4 ◦ C, supernatants were further analyzed. Pellets from HeLa cells were resuspended in RIPA Buffer (Sigma–Aldrich, Taufkirchen, Germany), incubated on ice for 5 min and centrifuged for 20 min and 14,000 rpm at 4 ◦ C.

For immunoblots, 5 × SDS probe buffer (250 mM Tris–HCl pH 6.8, 10% SDS, 50% glycerol, 5% betamercaptoethanol, 0.5% bromphenol blue) were added to the aliquots. Samples were subjected to denaturing PAGE on 10% gels and subsequently blotted semidry onto PVDF membranes (FluoroTransW-PVDF Membrane, Pall Life Sciences, Ann Arbor, USA) according to standard procedures. Membranes were blocked with PBS/5% milk powder and incubated overnight at 4 ◦ C with primary antibody (anti-HSD17B7 from C. jaccus, 1:2000 in 0.5% milk powder, 0.2% sodium azide, peptide sequence: NH2 CKMDLDEDTAEKFYK-CONH2 ) [5]. After three times washing with PBS the blot was incubated with the second antibody (goat anti-rabbit IgG coupled to alkaline phosphatase in a dilution of 1:5000 in PBS/0.5% milk powder (Sigma–Aldrich, Taufkirchen, Germany)) and visualized using an ECL detection system (Western lightning chemiluminescence reagent, Perkin-Elmer Life Sciences, Boston, USA).

3. Results and discussion 3.1. Screening for effective sequences to knock down the expression of human NSDHL, HSD17B7 and EBP For our studies we have chosen three different genes, NSDHL, HSD17B7, and EBP, participating in the final steps of post-squalene cholesterol biosynthesis pathway (see Fig. 1). Different shRNA sequences were designed for all of these genes (sequences for HSD17B7 are shown in Table 1). The selected sequences were submitted to BLAST search to assure the selected genes were targeted. From seven different shRNA sequences for HSD17B7 only the shHSD17B7-VII was showing a significant knock down of about 80% in the screening experiments (Fig. 2). The results from the dual luciferase assays were verified on endogenous mRNA levels by quantitative real time-PCR (data not shown). In a similar way we also could identify specific shRNA sequences to knock down NSDHL and EBP (data not shown). Our results illustrate that the efficiency of RNAi experiments relays on the sequences used as shRNAs. Although we checked the shRNA sequences referring to different algorithms [6,7] the predicted sequences did not show the expected results. For the knock down of NSDHL and EBP we had to screen three different sequences each to get an 80% knock down (data not shown). In the case of HSD17B7 seven different sequences were requested until we could identify one with an 80% knock down efficiency. 3.2. Stable transfection of the shRNA constructs Performing RNAi experiments with transiently transfected cells brought up some severe problems for our applications. Results from those experiments were often not comparable because of the different transfection efficiencies.

C. Guggenberger et al. / Journal of Steroid Biochemistry & Molecular Biology 104 (2007) 105–109 Fig. 1. Postsqualene cholesterol biosynthesis pathway. RNAi was performed for the genes marked in red. Malformation syndromes caused by defects of special genes are highlighted in dark blue, as well as are the mouse mutants. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of the article.)

107

108

C. Guggenberger et al. / Journal of Steroid Biochemistry & Molecular Biology 104 (2007) 105–109

Table 1 Overview of 5 –3 shRNA oligo sequences for knock down of HSD17B7 shOligo

Single-strand oligo

5 –3 sequence

shHSD17B7-1

shRNA-hHSD17B7-279-top shRNA-hHSD17B7-279-bottom

CACCGCATGCCTAATCCACAACTAAATTCAAGAGATTTAGTTGTGGATTAGGCATG AAAACATGCCTAATCCACAACTAAATCTCTTGAATTTAGTTGTGGATTAGGCATGC

shHSD17B7-2

shRNA-hHSD17B7-484-top shRNA-hHSD17B7-484-bottom

CACCGAATCCATCTCAGCTCATCTGGACTTCAAGAGAGTCCAGATGAGCTGAGATGGA AAAATCCATCTCAGCTCATCTGGACTCTCTTGAAGTCCAGATGAGCTGAGATGGATTC

shHSD17B7-3

shRNA-hHSD17B7-792-top shRNA-hHSD17B7-bottom

CACCGAACAGAAGCTCTGGTATGGCTTTAACGAAAGCCATACCAGAGCTTCTG AAAACAGAAGCTCTGGTATGGCTTTCGTTAAA GCCATACCAGAGCTTCTGTTC

shHSD17B7-4

shRNA-hHSD17B7-58-top shRNA-hHSD17B7-58-bottom

CACCGAAGCGGCTGCTGGCGGAAGATCGAAATCTTCCGCCAGCAGCCGC AAAAGCGGCTGCTGGCGGAAGATTTCGATCTTCCGCCAGCAGCCGCTTC

shHSD17B7-5

shRNA-hHSD17B7-109-top shRNA-hHSD17B7-109-bottom

CACCGAACATGAGCAAGGCAGAAGCTCGAAAGCTTCTGCCTTGCTCATG AAAACATGAGCAAGGCAGAAGCTTTCGAGCTTCTGCCTTGCTCATGTTC

shHSD17B7-6

shRNA-hHSD17B7-572-top shRNA-hHSD17B7-572-bottom

CACCGAACCCTACAGCTCTTCCAAACGAATTTGGAAGAGCTGTAGGG AAAACCCTACAGCTCTTCCAAATTCGTTTGGAAGAGCTGTAGGGTTC

shHSD17B7-7

shRNA-hHSD17B7-613 shRNA-hHSD17B7-613-bottom

CACCGTGGCTTTGAACAGGAACTTCCGAAGAAGTTCCTGTTCAAAGCCAC AAAAGTGGCTTTGAACAGGAACTTCTTCGGAAGTTCCTGTTCAAAGCCAC

Fig. 2. Knock down efficiency of different shRNA constructs for HSD17B7. Seven different shRNAs were cloned in the shRNA expression vector pENTR/U6 and tested for their effectiveness using the screening vector psiCHECK-2. Therefore the constructs were cotransfected with psiCHECK2 into HeLa cells. Measurement was done with the Dual Luciferase Reporter Assay System. In the positive control, only the psiCHECK-2, without a shRNA is transfected. Cotransfection of psiCHECK-2/HSD17B7 and pENTR/U6/shlacZ served as a negative control and as a control for the specificity of the knock down.

Furthermore, transiently transfected cells are expressing the shRNA of interest only for about 2–3 days. Depending on the gene of interest the proteins are in contrast often stable for a much longer time period. These observations led us to establish stably transfected shRNA constructs for NSDHL, HSD17B7 and EBP. For the generation of these cell lines

we used shRNA oligonucleotides with at least 80% knock down efficiency (sequences are shown in Table 2). We have further chosen an approach to inducible cell lines based on HeLa T-REx system. From each transfected construct we obtained different clones, which were all checked with the dual luciferase assay for their ability to knock down the expression of the target gene (data not shown). We identified clones from every transfected construct which reached a knock down efficiency after induction with tetracyclin reaching 90% (Fig. 3). We also show that the suppression of the shRNA expression is not complete. Small amounts of shRNA are always expressed, so that more effective knock down in comparison to non-transfected cells was observed. 3.3. Confirmation of knock down results on protein level for HSD17B7 We confirmed the results we got from our screening knock down experiments on protein level for HSD17B7. As a positive control, we used recombinant human HSD17B7 overexpressed in E. coli. We observed that the protein level in the non-transfected HeLa T-REx was higher than in HeLa T-REx/shHSD17B7/K4, which again indicates that the repression of shRNA expression is not complete. After induction with tetracycline the amount of protein was decreasing significantly over time. After 10 days of induction the protein was decreased to a minimum level (Fig. 4).

Table 2 Sequences of tested single stranded oligonucleotides for cloning into pENTRTM /H1/TO for stable transfection ss oligo

5 –3 sequence

shNSDHL-top shNSDHL-bottom shHSD17B7-top shHSD17B7-bottom shEBP-top shEBP-bottom

CACCGGGCGTCGATATCAAGAATGGTTCAAGAGACCATTCTTGATATCGACGCCC AAAAGGGCGTCGATATCAAGAATGGTCTCTTGAACCATTCTTGATATCGACGCCC CACCGTGGCTTTGAACAGGAACTTCCGAAGAAGTTCCTGTTCAAAGCCAC AAAAGTGGCTTTGAACAGGAACTTCTTCGGAAGTTCCTGTTCAAAGCCAC CACCGCTGGCCTCTTCTCTGTCACATTCAAGAGATGTGACAGAGAAGAGGCCAGC AAAAGCTGGCCTCTTCTCTGTCACATCTCTTGAATGTGACAGAGAAGAGGCCAGC

C. Guggenberger et al. / Journal of Steroid Biochemistry & Molecular Biology 104 (2007) 105–109

109

level as well. Therefore, we performed Western blot analysis using an antibody against HSD17B7. Our experiments show that protein level is significantly reduced after 5 days of constant shRNA expression. After 10 days of RNAi, HSD17B7 reached his minimum level with still protein found in the cells.

4. Conclusions

Fig. 3. Knock down efficiency in stably transfected HeLa T-REx. If untransfected HeLa T-REx cells are serving as a reference, the knock down efficiency lies between 76% (NSDHL) and 92% (HSD17B7). When using the stably transfected non-induced cells as positive control, we could measure a knock down of 78% (NSDHL), 95% (HSD17B7) and 92% (EBP) on exogenous mRNA level with the dual luciferase assay.

We however experienced limitations of the tools we established for our purpose. Even with the inducible system the repression of the shRNA expression is not complete (Fig. 3) despite the use of tested and tetracycline optimized serum. Nevertheless, our experiments show clearly that the knock down efficiency is higher in stably transfected than in transiently transfected cells. For further experiments it was indispensible to control not only the down-regulation of mRNA level but the protein

Fig. 4. Confirmation of HSD17B7 knock down in stably transfected HeLa T-REx/shHSD17B7 on protein level. After induction of HeLa TREX/shHSD17B7 a significant reduction of HSD17B7 could be detected by Western blot, whereas the amount of protein is reduced with longer induction time.

Our studies provide new versatile tools for analyses of cholesterol biosynthesis interference with other biological processes. Despite some limitations the tools are a major improvement.

Acknowledgements We thank Dr. Gabriele M¨oller (GSF, Neuherberg, Germany) for the pGEX/hHSD17B7 construct. We also like to thank Prof. Dr. Almuth Einspanier (University Leipzig, Veterinary Faculty, Leipzig, Germany) for the anti-HSD17B7 antibody.

References [1] G.E. Herman, X-linked dominant disorders of cholesterol biosynthesis in man and mouse (review), Biochim. Biophys. Acta 1529 (1–3) (2000) 357–373. [2] F.D. Porter, Malformation syndromes due to inborn errors of cholesterol biosynthesis, J. Clin. Invest. 110 (2002) 715–724. [3] C. Roux, C. Wolf, N. Mulliez, W. Gaoua, V. Cormier, F. Chevy, D. Citadelle, Role of cholesterol in embryonic development, Am. J. Clin. Nutr. 71 (5) (2000) 1270–1279. [4] A.M. Jetten, Recent advances in the mechanisms of action and physiological functions of the retinoid-related orphan receptors (RORs), Curr. Drug Targets Inflamm. Allergy 3 (4) (2004) 395–412. [5] B. Husen, J. Adamski, A. Br¨uns, D. Deluca, K. Fuhrmann, G. M¨oller, I. Schwabe, A. Einspanier, Chatacterization of 17b-hydroxysteroid dehydrogenase type 7 in reproductive tissues of the Marmoset monkey, Biol. Reprod. 68 (6) (2003) 2092–2099. [6] S.M. Elbashir, J. Harborth, K. Weber, T. Tuschl, Analysis of gene function in somatic mammalian cells using small interfering RNAs, Methods 26 (2002) 199–213. [7] W. Cui, J. Ning, U.P. Naik, M.K. Duncan, OptiRNAi, an RNAi design tool, Comput. Meth. Programs Biomed. 75 (1) (2004) 67–73.