Functional analysis of the G-protein α subunits FGA1 and FGA3 in the banana pathogen Fusarium oxysporum f. sp. cubense

Physiological and Molecular Plant Pathology 94 (2016) 75e82

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

Functional analysis of the G-protein a subunits FGA1 and FGA3 in the banana pathogen Fusarium oxysporum f. sp. cubense Lijia Guo a, b, Yuhua Yang a, b, Laying Yang a, b, Feiyang Wang a, b, Guofen Wang a, b, Junsheng Huang a, b, * a b

Key Laboratory of Integrated Pest Management on Tropical Crops, Ministry of Agriculture, People's Republic of China Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, Hainan, People's Republic of China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 December 2015 Received in revised form 20 April 2016 Accepted 22 April 2016 Available online 23 April 2016

The asexual fungus Fusarium oxysporum f. sp. cubense (Foc) is the causal agent of fusarium wilt in bananas (Musa spp.). This fungus poses a threat to banana production throughout the world. Here, two Foc genes, fga1 and fga3, were functionally characterized. These genes encode proteins homologous to the Gprotein a subunits GPA1 from Saccharomyces cerevisiae and MAGC from Magnaporthe grisea, respectively. The deletion of fga1 leads to a phenotypic defect in colony morphology and reductions in vegetative growth, conidiation and pathogenicity against the banana plant (Musa spp. cv. Brazil), which was not observed for the Dfga3 deletion mutant. Intriguingly, both Dfga1 and Dfga3 deletion mutants showed declines in intracellular cyclic AMP levels and increases in heat resistance, suggesting that FGA1 regulates growth, development, pathogenicity, and heat resistance, whereas FGA3 modulates heat resistance, potentially through the cAMP-dependent protein kinase A pathway. These findings offer insights into the roles of the G-protein a subunits in the development and pathogenicity of the fungus Foc. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Fusarium oxysporum f. sp. cubense Musa spp. Pathogenicity Development Cyclic AMP

1. Introduction In eukaryotes, the G-protein complex, composed of a, b and g subunits, is response for transmitting extracellular signals to intracellular effectors (e.g., adenylate cyclase, phospholipases, kinases, and ion channels), and it mediates multiple biological processes, including cell growth, division and proliferation [1]. In fungi, numerous Ga subunits have been identified, and they can be divided into three groups based on sequence similarity to their respective mammalian homologs [2]. Group I and III Ga subunits correspond to the mammalian Gai, and Gas proteins, respectively, but group II Ga subunits have no counterparts in mammals. In the budding yeast Saccharomyces cerevisiae, the Ga subunit GPA1

Abbreviations: Foc, Fusarium oxysporum f. sp. cubense; PDA, potato dextrose agar; PDB, potato dextrose broth; PCR, polymerase chain reaction; PEG, polyethylene glycol; PKA, protein kinase A; PSA, potato sucrose agar; MAPK, mitogen activated protein kinase; RT-PCR, reverse transcription-polymerase chain reaction; WT, wild-type strain B2. * Corresponding author. Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, Hainan, People's Republic of China. E-mail address: [email protected] (J. Huang). http://dx.doi.org/10.1016/j.pmpp.2016.04.003 0885-5765/© 2016 Elsevier Ltd. All rights reserved.

(group I) interacts with the Gb (STE4) and Gg (STE18) subunits, mediating the response to mating pheromone [3]. The Ga subunit GPA2 (group III) is involved in regulating growth and pseudohyphal development of S. cerevisiae during nitrogen starvation [4]. In some phytopathogenic fungi, group I Ga subunits, such as CPG-1 from the chestnut blight fungus Cryphonectria parasitica [5], MAGB from the rice blast fungus Magnaporthe grisea [6], BCG1 from the gray mold fungus Botrytis cinerea [7] and FGA1 from the cucumber wilt pathogen Fusarium oxysporum f. sp. cucumerinum [8], were found to be involved in growth, development and pathogenicity. Most group II Ga subunits are not implicated in fungal development and pathogenicity, except MAGC from M. grisea [6] and BCG2 from B. cinerea [7]. The majority of group III Ga subunits are pathogenicity determinants in some pathogenic fungi, including CPG-2 from C. parasitica [9], MAGA from M. grisea [6], and FGA2 from F. oxysporum f. sp. cucumerinum [10]. Interestingly, similar Gai subunits may have opposite functions depending on the fungal species. For instance, the disruption of Gai protein genes results in a loss or reduction of pathogenicity in some fungi, such as C. parasitica, M. grisea, B. cinerea and F. oxysporum f. sp. cucumerinum, but it causes no change in the virulence of other phytopathogenic fungi, such as Cochliobolus heterostrophus [11] and Ustilago maydis [12]. In addition, the Gai subunit CPG-1 negatively

76

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

modulates intracellular cAMP levels of the fungus C. parasitica [9], but FGA1 plays positive roles in the regulation of intracellular cAMP levels in the fungus F. oxysporum f. sp. cucumerinum [8]. It is noteworthy that group II Ga subunits share no similar functions among different fungi [2]. The asexual fungus F. oxysporum f. sp. cubense (Foc) is the causal agent of vascular wilt in bananas, which has led to a severe yield loss worldwide in the past [13]. Until now, the molecular pathogenicity mechanism of Foc was not well understood. The whole genome sequence analysis of this fungus revealed a large number of putative virulence associated genes, including Ga genes and a Gb gene [14]. The functional analysis of the Gas subunit FGA2 and the Gb subunit FGB1 in Foc have been completed and covered separately [15]. In the present study, a Gai gene, fga1, which is shown to have a high sequence identity to the fga1 gene from F. oxysporum f. sp. cucumerinum, and another functionally unknown gene encoding the group II Ga subunit, fga3, were functionally investigated. We hope that our findings will help with the understanding of the roles of G-protein subunits in the development and pathogenicity of this pathogen. 2. Materials and methods 2.1. Plant material, fungal strains, and culture conditions The F. oxysporum f. sp. cubense wild-type strain B2 (WT) and mutant strains were maintained on potato dextrose agar (PDA; Difco Laboratories, Detroit, MI, USA) slopes at 28
C or as 20% glycerol spore suspensions at 80
C. For DNA or RNA extraction, fungal cultures were grown in potato dextrose broth (PDB, Difco Laboratories). 2.2. Nucleic acid extraction Genomic DNA were extracted from the mycelia of the WT and mutant strains using the cetyltrimethylammonium bromide method [16], and the total RNA was isolated using the TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA) according the supplier's direction. The 1st strand cDNA was synthesized from the total RNA using the previously described methods [17]. 2.3. Vector construction and transformation The fga1 gene deletion vector pCT-fga1 was constructed based on the plasmid pCT74, which carries a hygaromycin resistance cassette and a green fluorescent protein (GFP) cassette [18]. A set of primers, fga1-5f/fga1-5r (Table 1), was designed to amplify the 50 flanking fragment (673 bp) of the fga1 gene, and another pair of primers, fga1-3f/fga1-3r (Table 1), was used for the amplification of the 30 flanking segment (735 bp). The polymerase chain reaction Table 1 Oligonucleotide primers used in this study. Primer

Sequence (50 e30 )a

Amplicon

fga1-5f fga1-5r fga1-3f fga1-3r fga3-5f fga3-5r fga3-3f fga3-3r fga1-cf fga1-cr

ggggtaccATGGCTCATCTCATCTCATT ccgctcgagATATGCTGTTCTGGGATTGA cggaattcCCATTACGCCAGATATACTACT gctctagaTCACAAGCAACATCCAACT cggggtaccTATTTCTGGGACTGTTTTGGC ggcggaattcTTTGAGGTGGAATTGTGGC gcggatccTCCAGCATATTCTCGACTC gcgagctcCTGCTGTCAAGATTTAGGTCC GGTTCTCGAGGTCGAATTCTGCTTCTGCTTCTGCTA GGGAACAAAAGCTGGATCCGAGTGACGAGTGAGTA

673 bp

a

Recognition sequences for restriction enzymes are underlined.

(PCR) was performed in a 50 mL volume containing 5 mL of PCR buffer (10), 4 mL of dNTP mixture (2.5 mM), 5 U rTaq DNA polymerase (TaKaRa, Dalian, China), approximately 100 ng of genomic DNA of Foc WT and 2 mL of each primer (10 mM) using the following program: an initial denaturation step at 95
C for 5 min; followed by 35 cycles of denaturation at 98
C for 10 s, annealing at 60
C for 30 s, and extension at 72
C for 1 min; and a final extension step at 72
C for 5 min. Two correct amplicons were separately isolated from an agarose gel and purified using the TaKaRa MiniBEST DNA fragment purification kit (TaKaRa). Furthermore, the 50 flanking fragment was digested using KpnI and XhoI, and then, it was ligated with the KpnI- and XhoI-digested pCT74 plasmid. The resulting plasmid, pCT-fga1-5F, was digested with EcoRI and XbaI, and then it was ligated with the 30 flanking segment digested with the same enzymes. The cloned sequence of the resulting plasmid was verified by sequencing, and the correct plasmid was designated as pCTfga1. The fga3 gene deletion vector was constructed based on the plasmid pCX62, which carries a hygaromycin B resistance cassette [19]. Two pairs of primers were designed to amplify the 50 and 30 flanking fragments (901 bp and 1014 bp) of the fga3 gene using the identical amplification conditions and the program mentioned above. The 901 bp amplicon was digested with KpnI and EcoRI and then ligated with the KpnI- and EcoRI-digested pCX62. The resulting plasmid, pCX-fga3-5f, was digested with BamHI and XbaI and ligated with a 1014 bp product digested with BamHI and XbaI. The segments cloned into the resulting plasmid were verified by sequencing, and the plasmid was named pCX-fga3. The plasmids pCT-fga1 and pCX-fga3 were both linearized using KpnI and XbaI prior to transformation of WT Foc protoplasts. For complementation analysis, the primer set fga1-cf/fga1-cr was designed to amplify the entire copy of the fga1 gene with ~1.1 kb of the 50 noncoding region. PCR amplification was performed using the genomic DNA of WT Foc as a template, and the program was modified with an extension time of 3 min in the second step. The amplicon of the anticipated size was ligated with the SalI and SacI-digested vector pSilent-Dual1 [20] using the InFusion cloning kit (Clontech, Mountain View, CA, USA) according to the supplier's instructions. The cloned fragment was verified by sequencing the resultant plasmid, and the correct plasmid was designated as pSD-fga1. This plasmid was linearized with SacI prior to transformation. Protoplast preparation was carried out according to the protocols reported by Nahalkova and Fatehi [21]. For the transformation, 20 mL of each plasmid solution (approximately 4 mg) was mixed with 200 mL of protoplast suspension (approximately 2  108 mL1 in a sorbitol solution) in a tube, and the solution was incubated at room temperature for 30 min. Then, 1.2 mL of a polyethylene glycol (PEG) solution (60% (w/v) PEG 3350; 50 mM CaCl2; 10 mM Tris, pH 7.5) was added to the tube and mixed well before another 30 min of incubation. Lastly, the mixture was mixed with 100 mL molten potato sucrose agar (PSA; broth prepared from 200 g of potatoes, 0.8 M sucrose, and 0.9% (w/v) agar) medium (cooled to approximately 50
C) containing the appropriate antibiotic (50 mg L1 hygromycin B or geneticin), poured into Petri dishes, and allowed to solidify. The fungal transformants generated on the PSA plates were purified by monoconidial isolation as described previously [22] before further study.

735 bp

2.4. Identification of mutant strains by gene-specific PCR 901 bp 1014 bp 2923 bp

Based on the homologous recombination strategy, we designed three pairs of primers to identify the fga1 or fga3 gene deletion strains (Table S1). The primer aF1 (cF1), which bound to the sequence near the 50 flanking fragment, and the primer aF2 (cF2), which bound to the hygromycin resistance gene, were used for

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

detecting the recombination of the 50 flanking segment. The primer aF3 (cF3), which bound to the GFP gene (or the hygromycin resistance gene), and the primer aF4 (cF4) which bound to the sequence adjacent to the 30 flanking segment, were applied to detect the recombination of the 30 flanking fragment. The primer set aF5/aF6 (cF5/cF6) was designed to amplify the fga1 (fga3) gene. PCR experiments were performed using the modified program with an extension time of 2 min in the second step.

77

2.8. Statistical analysis All data including the colony size, conidial yield, survival rate, cAMP level, and disease index of the different samples were statistically analyzed using ANOVA and Tukey's test. 3. Results 3.1. Generation of Dfga1 and Dfga3 deletion mutants

2.5. Expression analysis of mutant strains by reverse transcription (RT)-PCR To verify the presence or absence of fga1 (or fga3) gene transcripts in the wild-type and mutant strains, fga1 and fga3 genespecific primer sets were designed (Table S1). RT-PCR was performed using the 1st strand cDNA as a template. The program was identical to that for the amplification of the 50 and 30 flanking fragments of the fga1 gene. The PCR amplification of the actin gene was used as an internal control. Three independent experiments were performed, giving the similar results.

2.6. Phenotypic characterization of mutants To observe colony morphology, 100 mL of the bud-cell suspension (approximately 103 cells mL1) of each fungal strain was spread on PDA medium in a 9-cm Petri dish and allowed to grow for 36 h. For the analysis of vegetative growth and pigmentation, the wild-type and mutant strains were grown on PDA, minimal medium and complete medium [23] for 5 d, and then the colony diameters were measured. For the quantification of the conidia, three disks (approximately 7 mm in diameter) were punched from the center of each colony and washed thoroughly in sterile water prior to counting in a hemocytometer. Heat shock was performed according to a previously described method [8], except the temperatures were changed to 50
C and 55
C. For the quantification of cyclic AMP (cAMP), a fungal culture was prepared on Czapek medium according the methods described by Jain et al. [8]. cAMP was extracted using a cAMP enzyme immunoassay (EIA) system (Sigma, St. Louis, MO, USA), and a protein assay was carried out using a BCA protein assay kit with bovine serum albumin as a standard (TaKaRa). The cAMP levels were related to the protein concentrations of the samples. All these experiments were performed at least three times with similar results, and means ± SD were calculated from two independent experiments, including six replicates. 2.7. Pathogenicity test The tissue culture-derived Cavendish banana (Musa spp. cv. Brazil) was used as a host, and pathogenicity tests were performed using the root-dip method. Briefly, the roots of the banana plants were dipped in the bud-cell suspension (107 cells mL1) or sterile water (control) for 15 s, then transplanted to pots and kept in a growth cabinet under a 14-h photoperiod at 28
C. The pathogenicity tests were repeated three times as independent experiments, containing approximately 20 plants per strain. The disease severity was evaluated at 30 d post inoculation. All plants were cut just above the roots, and the internal symptoms of the corms were rated on a 0e5 scale [17]. The disease index was calculated using the following formula: DI ¼ ð100  Sðn  sÞÞ=ðN  5Þ, where “n” means the number of banana plants with the corresponding scale (s) of the disease symptom and “N” means the total number of banana plants tested. The DI values cited are the results from 60 plants tested for each strain in three independent experiments.

Four out of 24 hygromycin-resistant transformants were confirmed by PCR to be deleted for the fga1 gene, and three out of 21 hygromycin-resistant transformants were verified to be deleted for the fga3 gene. Figs. 1 and 2 show the PCR amplification results of the Dfga1 deletion mutant A1, and the Dfga3 deletion mutant A3. Two bands of the anticipated sizes (approximately 1.7 kb) could be detected in the transformant A1 but not the WT strain using the primer sets aF1/aF2 and aF3/aF4, respectively. Moreover, an approximately 1.3 kb PCR product corresponding to the fga1 gene appeared in the WT strain but not in the transformant A1 using the primer set aF5/aF6 (Fig. 1A and B). These results indicate that the fga1 gene was deleted in the transformant A1. Similarly, we detected two bands of the expected size (approximately 1.6 kb) in the transformant A3 but not in the WT strain using the prime sets cF1/cF2 and cF3/cF4. Conversely, a 0.7 kb PCR product could only be detected in the WT strain but not in the transformant A3 (Fig. 2A and B). These results indicate that the deletion of the fga3 gene was achieved in the transformant A3. Furthermore, we detected the expression of the fga1 and fga3 genes in the WT and mutant strains by RT-PCR. A 0.5 kb PCR product corresponding to the fga1 gene was absent in the strain A1 but present in the WT strain (Fig. 1C). An approximately 0.7 kb band of the anticipated size of the fga3 gene could be detected in the WT strain but not in the strain A3 (Fig. 2C). These results indicate that the fga3 gene was absent in the transformant A1 and the fga3 gene was missing in the transformant A3. 3.2. Phenotypic characterization of Dfga1 and Dfga3 deletion mutants Both the WT strain and the Dfga3 deletion strain A3 formed symmetrical colonies, whereas the Dfga1 deletion strain A1 formed asymmetrical and elongated colonies (Fig. 3A). This difference in colony morphology became distinguishable over time. After cultivation for 5 d, the colony morphology of the strain A1 was analogous to the WT strain on PDA medium (Fig. 3B), but it was distinct from the WT strain on complete medium. On the latter medium, the strain A1 grew vigorously and formed white, dense colonies, whereas the WT strain grew faintly and formed white, loose colonies (Fig. 3C). In contrast, the strain A3 grew faintly, as did the WT strain (data not shown). These results indicate that deletion of the G-protein a subunit gene fga1, but not fga3, affects the colony morphology of the fungus Foc. Additionally, the WT, A1, and A3 strain produced little pigment with no significant difference in the amounts, which could be seen in the growth on the PDA medium (Fig. 3B). After incubation on PDA medium for 5 d, the Dfga1 deletion strains A1 and the Dfga3 deletion strain A3 formed slightly smaller colonies, in contrast to the WT strain (Fig. 4A). Interestingly, the strain A1 formed markedly smaller colonies on minimal and complete medium compared to the WT strain (Fig. 4B and C). These results indicate that FGA1 influences vegetative growth depending on the nutritional conditions, whereas FGA3 has no significant impact on the vegetative growth of the fungus Foc. It is noteworthy that the amount of conidia produced by the strain A1 was less than

78

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

Fig. 1. A schematic representation of targeted deletion of the fga1 gene. (A) The fga1 deletion construct pCT-fga1, which contains the hygromycin resistance (hygR) and green fluorescent protein (GFP) cassettes flanked by the upstream (5F) and downstream (3F) segments of the fga1 gene, was used for the replacement of the fga1 locus using a doublecrossover recombination. (B) The identification of the Dfga1 deletion and the fga1-complemented strain A1-Comp1 by PCR using the primer sets listed in Table 1. Lanes 1e3, the primer set aF1/aF2; lanes 4e6, aF3/aF4; lanes 7e9, aF5/aF6. Lanes 1, 4 & 7, Dfga1 deletion strain A1; lanes 2, 5 & 8, fga1-complemented strains A1-Comp1; lanes 3, 6 &7, wild-type strain B2. (C) The detection of the fga1 gene transcripts by RT-PCR. The cDNAs from the wild-type strain B2 (1), Dfga1 deletion strain A1 (2) and fga1-complemented strains A1Comp1 (3) were used as templates. The amplification of the actin gene was used as a control. For the detailed description of the complementation strain A1-Comp1, please refer to the section ‘3.3 complementation analysis’. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 2. A schematic representation of the targeted deletion of the fga3 gene. (A) The fga3 deletion construct pCX-fga3, which contains a hygromycin resistance (hygR) cassette flanked by the upstream (5F) and downstream (3F) segments of the fga3 gene, was used for the replacement of the fga3 locus by a double-crossover recombination. (B) The identification of the Dfga3 deletion strains by PCR using the primer sets listed in Table 1. Lanes 1e2, the primer set cF1/cF2; lanes 3e4, cF3/cF4; lanes 5e6, cF5/cF6. Lanes 1, 3 & 5, Dfga3 deletion strain A3; lanes 2, 4 & 6, wild-type strain B2. (C) The detection of the fga3 gene transcripts by RT-PCR. The cDNAs from the wild-type strain B2 (1) and Dfga3 deletion strain A3 (2) were used as templates. The amplification of the actin gene was used as a control.

one fifth that of the WT strain, but the amount of conidia produced by the strain A3 was comparable with that of the WT strain (Fig. 4D). These results indicate that FGA1, but not FGA3, plays crucial roles in modulating the conidiation of this fungus. Following heat shock at 50
C for 1 h, both the Dfga1 deletion strain A1 and the Dfga3 deletion strain A3 displayed a higher survival rate (65.1% and 54.5%, respectively) relative to the WT strain (42.2%). A similar case was observed after a heat shock at 55
C. The survival rates of the strains A1 and A3 were 44.3% and 30.1%, respectively, which were significantly higher than that of the WT strain (9.9%, Fig. 5A). These results indicate that the G-protein a subunits FGA1 and FGA3 are negative regulators of heat resistance in the fungus Foc. The intracellular cAMP levels of the wild-type and mutant strains are shown in Fig. 5B. The cAMP levels of the Dfga1 deletion strain A1 and the Dfga3 deletion strain A3 were reduced to approximately 40% and 55% that of the WT strain, respectively, suggesting that both FGA1 and FGA3 play vital roles in regulating the intracellular cAMP levels of Foc cells and are involved in the cAMP signaling pathway.

3.3. Complementation analysis The fga1-complemented strain A1-Comp1 was identified from the transformants expressing geneticin resistance by PCR. Two bands of the anticipated size (approximately 1.7 kb) could be detected in the strain A1-Comp1, but not in the WT strain, and an approximately 1.3 kb band corresponding to the fga1 gene could be detected in both the WT and A1-Comp1 strains (Fig. 1B). Moreover, the fga1 gene transcripts could be detected in the strain A1-Comp1 (Fig. 1C) in the RT-PCR experiments. These results indicate that the strain A1-Comp1 possesses a complete copy of the fga1 gene and this gene can be transcribed normally. The phenotype of the fga1-complemented strain A1-Comp1 was analyzed. This strain formed symmetrical and circular colonies of a similar size as those of the WT strain (Figs. 3 and 4A), and the strain produced as many conidia as the WT strain (Fig. 4B). Moreover, the strain A1-Comp1 had similar survival rates as the WT strain after heat shock treatments at 50
C or 55
C and normal intracellular cAMP levels (Fig. 5A and B). These results indicate that the phenotypic defects in the Dfga1 deletion mutant can be restored by

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

79

Fig. 3. Effects of deletion of the Ga genes fga1 and fga3 on colony morphology and pigmentation. (A) The colony morphology of the wild-type and mutant strains. The wild-type strain B2, the Dfga1 deletion strain A1, the fga1-complemented strain A1-Comp1, and the Dfga3 deletion strain A3 were grown on PDA medium for 36 h. (B) The pigmentation of the wild-type and mutant strains. The wild-type strain B2, the Dfga1 deletion strain A1, and the Dfga3 deletion strain A3 were inoculated onto PDA plates and incubated at 25
C for 5 d. Each strain formed a white fluffy colony (upper panel), and its pigmentation could be seen on the undersides of the PDA plates (lower panel). (C) The colony morphology of the wild-type strain (WT) and the Dfga1 deletion strain A1 on complete medium.

80

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

Fig. 4. Effects of deletion of the Ga genes fga1 and fga3 on vegetative growth and conidiation. The wild-type strain B2, Dfga1 deletion strain A1, fga1-complemented strain A1Comp1, and Dfga3 deletion strain A3 were grown on PDA medium (A), minimal medium (B), and complete medium (C) for 5 d, and the colony diameter was measured. (D) The conidial yield of the wild-type and mutant strains. The conidia collected from each strain were counted using a hemocytometer. The values represent the means ± SD of six replicates from two independent experiments. * Indicates statistically significant differences between the wild-type and mutant strains (Tukey's test, p < 0.05).

Fig. 5. Effects of deletion of the Ga genes fga1 and fga3 on heat resistance and the intracellular cyclic AMP levels. (A) The survival rates of bud cells from the wild-type and mutant strains. The bud cells from the wild-type strain B2, Dfga1 deletion strain A1, fga1-complemented strain A1-Comp1, and Dfga3 deletion strain A3 were incubated in a water bath for 1 h at 50
C or 55
C. Their survival is expressed as a percentage of the 26
C control. (B) The intracellular cAMP levels of the wild-type and mutant strains. The cAMP levels extracted from the wild-type strain B2, Dfga1 deletion strain A1, fga1-complemented strain A1-Comp1, and Dfga3 deletion strain A3 were quantified, and the levels were related to the protein concentrations of the samples. The values represent the means ± SD for six replicates from two independent experiments. * Indicates statistically significant differences (Tukey's test, p < 0.05).

the introduction of an entire copy of the fga1 gene. Additionally, we did not observe any other phenotypes. It is thus can be inferred that the complementation cassette might be integrated into a “neutral site” of Foc genome, with no impact on other phenotypes.

results suggest that the Ga subunit FGA1, but not FGA3, is involved in the regulation of the virulence of the fungus Foc in banana plants.

3.4. Pathogenicity test

We previously identified three Ga subunit genes in the genome of the banana pathogen Foc [17], which were named fga1, fga2, and fga3. The number of the Foc Ga subunit genes is identical with that of most characterized filamentous fungi, except the fungi U. maydis, Rhizopus oryzae, and Schizophyllum commune, which have four or more Ga subunit genes [2]. Because the functions of the Ga subunits FGA1 and FGA2 in F. oxysporum f. sp. cucumerinum have been characterized, it can be inferred that their counterparts in Foc might have similar functions. As expected, the deletion of the fga1 gene led to the generation of phenotypic defects similar to that of fga1 disruptants in the pathogen F. oxysporum f. sp. cucumerinum [8], such as altered colony morphology, decreased conidiation and reduced pathogenicity. However, distinct from many null mutants of the Gai genes, such as the fga1 disruptant from F. oxysporum f. sp. cucumerinum, cag1 disruptants from C. heterostrophus [11], and

We observed conspicuous yellowing in bottom leaves of banana plants (Musa spp. cv. Brazil) inoculated with the fga1-complemented strain A1-Comp1, the Dfga3 deletion strain A3 and the WT strain at 14 d post inoculation, but not in those plants inoculated with the Dfga1 deletion strain A1 and the control (data not shown). At 30 d post inoculation, severe discoloration could be observed in the corms of banana plants inoculated with the WT, A3 and A1-Comp1 strains, while a light discoloration was shown in those inoculated with the strain A1. No symptoms could be observed in the control (Fig. 6A). Moreover, the disease index of the banana plants inoculated with strain A1 was 15.1, which was significantly lower than those inoculated with the WT strain (55.1), the A1-Comp1 strain (52.3) and the A3 strain (53.4) (Fig. 6B). These

4. Discussion

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

81

Fig. 6. The disease symptoms and the disease indices of banana plants inoculated with the wild-type and mutant strains. (A) The disease symptoms in the corms of banana plants (Musa spp. Cv. Brazil). Banana roots were inoculated with the wild-type strain B2 (WT), Dfga1 deletion strain A1, fga1-complemented strain A1-Comp1, or water (CK) using the rootdip method. All plants were cut above the roots at 30 d post inoculation, and discoloration could be observed in the corms of the diseased banana plants. (B) The disease indices of banana plants. The disease severity was rated using a scale ranging from 0 (healthy plant) to 5 (dead plant). The values represent the means ± SD of 60 banana plants tested for each fungal strain in three independent experiments. * Indicates a significant difference (Tukey's test, p < 0.01).

gpa1 disruptants from U. maydis [12], which show no deficiency in vegetative growth, the Dfga1 deletion stain A1 in Foc showed reduced vegetative growth on minimal and complete medium. Moreover, a reduction in vegetative growth was also shown in disruptants of the Gai genes in other filamentous fungi, such as disruptants of cpg-1 from C. parasitica [5] and disruptants of magB from M. grisea [6]. Additionally, the deletion of most Gai genes, such as fga1, cpg-1, magB, and bcg1, exception cag1 and gpa1, results in a loss or reduction of pathogenicity. These findings support the idea that similar Gai subunits might have some contrary or differential functions depending on fungal species. In this study, the deletion of the fga3 gene did not result in an alteration of colony morphology or reductions in vegetative growth, conidiation, and pathogenicity, indicating that FGA3 has no significant influence on the vegetative growth, development and pathogenicity of the fungus Foc. Similar results were observed in null mutants of other fungal group II Ga genes, such as gpa2 from U. maydis [12] and mggpa2 from Mycosphaerella graminicola [24]. Interestingly, the Ga gene bcg2 from B. cinerea was found to be involved in the regulation of pathogenicity, and magC was reported to play roles in the modulation of the conidiation and development

of asci in M. grisea [6]. These results indicate that the functions of the group II Ga subunits are not well conserved in fungi. In mammalian systems, Gai subunits lower the cAMP level in cells by inhibiting adenylate cyclase activity [25]. A similar case was observed in the pathogenic fungus C. parasitica. The deletion of the Gai gene cpg-1 resulted in an increase in the intracellular cAMP level [5], indicating that CPG1 negatively regulates the intracellular cAMP level by inhibiting the adenylate cyclase activity in a similar manner to its mammalian counterparts. In contrast, many Gai subunits, such as MAGB from M. grisea, GNA1 from Neurospora crassa [26] and FGA1 in this study, had an opposite role in the regulation of cAMP levels, suggesting that these Gai subunits might be positive regulators of adenylate cyclase activity. Intriguingly, the Gai subunit MgGPA1 was found to be dispensable for the regulation of cAMP levels in the fungus M. graminicola [24]. These results indicate that Gai subunits could be divided into three classes based on their role in the regulation of cAMP levels. Class I Gai subunits positively regulate the intracellular levels, class II subunits negatively regulate the levels, and class III subunits have no role. In filamentous fungi, the role of group II Ga subunits in modulating cAMP levels in cells has not been characterized until now. In

82

L. Guo et al. / Physiological and Molecular Plant Pathology 94 (2016) 75e82

this study, the deletion of the group II Ga subunit gene fga3 lowered the intracellular cAMP level, indicating that the Ga subunit FGA3 is a positive regulator of adenylate cyclase activity in Foc. Thus, our results suggest that the Ga subunits FGA1 and FGA3 have overlapping functions in regulating the intracellular cAMP level in the fungus Foc. In the filamentous fungus N. crassa, the deletion of the Ga subunit gene gna-1 reduced the intracellular cAMP level [27]. A mutant lacking adenylate cyclase showed a low level of cAMPdependent protein kinase A (PKA) activity and increased heat resistance in N. crassa [28], suggesting that cAMP is involved in the cellular response to heat resistance and that the Ga subunit GNA1 modulates heat resistance through the cAMP-dependent protein kinase A (cAMP-PKA) pathway in this fungus. In the present study, the deletion of either fga1 or fga3 led to an increase in heat resistance and a decrease in the cAMP level, suggesting that FGA1 and FGA3 might negatively regulate heat resistance through the cAMPPKA pathway. Plant pathogenic fungi regulate their development and pathogenicity through multiple pathways, such as the mitogen activated protein kinase (MAPK) cascades and the cAMP-PKA pathway [29,30]. Moreover, many studies have revealed that Ga subunits are involved in the control of fungal development, partially through the cAMPPKA pathway. For instance, the deletion of bcg1 results in the altered colony morphology in the gray mold fungus B. cinerea, and exogenous cAMP could restore this phenotype [7]. A similar case was observed for M. grisea. The deletion of magB blocks appressorium formation, and this deficiency could be recovered by the application of exogenous cAMP [6]. Intriguingly, in the Arabidopsis pathogen F. oxysporum, null mutants of the cAMP-dependent protein kinase A gene FoCPKA showed appreciable reductions in vegetative growth, conidiation, and pathogenicity [31], which were analogous to the phenotypic consequence of the Dfga1 deletion strain in this study. Therefore, we infer that FGA1 modulates vegetative growth, development and pathogenicity, possibly through the cAMP-PKA pathway. Overall, our findings reveal that the Ga subunit FGA1 is involved in the modulation of a variety of biological processes, including the growth, conidiation, and pathogenicity of the fungus Foc, whereas the Ga subunit FGA3 has no roles in these processes. In spite of this, they have partially overlapping functions in regulating heat resistance and intracellular cAMP levels. Whether FGA1 regulates the growth, development and pathogenicity of the fungus Foc by the cAMP-PKA pathway remains to be further confirmed. Nevertheless, the findings of the present study provide comparative insights into the functions of the Ga subunits FGA1 and FGA3 in the fungus Foc. Acknowledgments This work was supported by Grant No. 31201467 from the National Natural Science Foundation of China.

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13] [14]

[15]

[16]

[17]

[18]

[19]

[20]

[21] [22]

[23]

[24]

[25]

Appendix A. Supplementary data

[26]

Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.pmpp.2016.04.003.

[27]

References [1] H.E. Hamm, A. Gilchrist, Heterotrimeric G proteins, Curr. Opin. Cell Biol. 8 (1996) 189e196. [2] L. Li, S.J. Wright, S. Krystofova, G. Park, K.A. Borkovich, Heterotrimeric G protein signaling in filamentous fungi, Annu. Rev. Microbiol. 61 (2007) 423e452. [3] N. Nakayama, Y. Kaziro, K. Arai, K. Matsumoto, Role of STE genes in the mating factor signaling pathway mediated by GPA1 in Saccharomyces cerevisiae, Mol. Cell. Biol. 8 (1988) 3777e3783. [4] M. Nakafuku, T. Obara, K. Kaibuchi, I. Miyajima, A. Miyajima, H. Itoh, et al., Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for

[28]

[29]

[30]

[31]

guanine nucleotide-binding regulatory protein: studies on its structure and possible functions, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 1374e1378. G.H. Choi, B. Chen, D.L. Nuss, Virus-mediated or transgenic suppression of a Gprotein alpha subunit and attenuation of fungal virulence, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 305e309. S. Liu, R.A. Dean, G protein alpha subunit genes control growth, development, and pathogenicity of Magnaporthe grisea, Mol. Plant Microbe Interact. e MPMI 10 (1997) 1075e1086. C.S. Gronover, D. Kasulke, P. Tudzynski, B. Tudzynski, The role of G protein alpha subunits in the infection process of the gray mold fungus Botrytis cinerea, Mol. Plant Microbe Interact. e MPMI 14 (2001) 1293e1302. S. Jain, K. Akiyama, K. Mae, T. Ohguchi, R. Takata, Targeted disruption of a G protein alpha subunit gene results in reduced pathogenicity in Fusarium oxysporum, Curr. Genet. 41 (2002) 407e413. S. Gao, D.L. Nuss, Distinct roles for two G protein alpha subunits in fungal virulence, morphology, and reproduction revealed by targeted gene disruption, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 14122e14127. S. Jain, K. Akiyama, R. Takata, T. Ohguchi, Signaling via the G protein alpha subunit FGA2 is necessary for pathogenesis in Fusarium oxysporum, FEMS Microbiol. Lett. 243 (2005) 165e172. B.A. Horwitz, A. Sharon, S.W. Lu, V. Ritter, T.M. Sandrock, O.C. Yoder, et al., A G protein alpha subunit from Cochliobolus heterostrophus involved in mating and appressorium formation, Fungal Genet. Biol. e FGB 26 (1999) 19e32. E. Regenfelder, T. Spellig, A. Hartmann, S. Lauenstein, M. Bolker, R. Kahmann, G proteins in Ustilago maydis: transmission of multiple signals? EMBO J. 16 (1997) 1934e1942. R.C. Ploetz, Fusarium wilt of banana is caused by several pathogens referred to as Fusarium oxysporum f. sp. cubense, Phytopathology 96 (2006) 653e656. L. Guo, L. Han, L. Yang, H. Zeng, D. Fan, Y. Zhu, et al., Genome and transcriptome analysis of the fungal pathogen Fusarium oxysporum f. sp. cubense causing banana vascular wilt disease, PLoS One 9 (2014) e95543. L. Guo, L. Yang, C. Liang, J. Wang, L. Liu, J. Huang, The G-protein subunits FGA2 and FGB1 play distinct roles in development and pathogenicity in the banana fungal pathogen Fusarium oxysporum f. sp. cubense, Physiol. Mol. Plant Pathol. 93 (2016) 29e38. P.K. Mishra, R.T. Fox, A. Culham, Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria, FEMS Microbiol. Lett. 218 (2003) 329e332. L. Guo, L. Yang, C. Liang, G. Wang, Q. Dai, J. Huang, Differential colonization patterns of bananas (Musa spp.) by physiological race 1 and race 4 isolates of Fusarium oxysporum f. sp. cubense, J. Phytopathol. 163 (10) (October 2015) 807e817. R.M. Andrie, J.P. Martinez, L.M. Ciuffetti, Development of ToxA and ToxB promoter-driven fluorescent protein expression vectors for use in filamentous ascomycetes, Mycologia 97 (2005) 1152e1161. K. Seong, Z. Hou, M. Tracy, H.C. Kistler, J.R. Xu, Random insertional mutagenesis identifies genes associated with virulence in the wheat scab fungus Fusarium graminearum, Phytopathology 95 (2005) 744e750. Q.B. Nguyen, N. Kadotani, S. Kasahara, Y. Tosa, S. Mayama, H. Nakayashiki, Systematic functional analysis of calcium-signalling proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-throughput RNAsilencing system, Mol. Microbiol. 68 (2008) 1348e1365. J. Nahalkova, J. Fatehi, Red fluorescent protein (DsRed2) as a novel reporter in Fusarium oxysporum f. sp. lycopersici, FEMS Microbiol. Lett. 225 (2003) 305e309. A. Di Pietro, F.I. Garcia-MacEira, E. Meglecz, M.I. Roncero, A MAP kinase of the vascular wilt fungus Fusarium oxysporum is essential for root penetration and pathogenesis, Mol. Microbiol. 39 (2001) 1140e1152. C. Klittich, J. Leslie, Nitrate nonutilizing mutants of Fusarium oxysporum and their use in vegetative compatibility tests, Phytopathology 77 (1987) 1640e1646. R. Mehrabi, S.B. M'Barek, T.A.J. van der Lee, C. Waalwijk, P.J.G.M. de Wit, G.H.J. Kema, Ga and Gb proteins regulate the cyclic AMP pathway that is required for development and pathogenicity of the phytopathogen Mycosphaerella graminicola, Eukaryot. Cell 8 (2009) 1001e1013. A.G. Gilman, G proteins and dual control of adenylate cyclase, Cell 36 (1984) 577e579. F.D. Ivey, P.N. Hodge, G.E. Turner, K.A. Borkovich, The G alpha i homologue gna-1 controls multiple differentiation pathways in Neurospora crassa, Mol. Biol. Cell 7 (1996) 1283e1297. F.D. Ivey, Q. Yang, K.A. Borkovich, Positive regulation of adenylyl cyclase activity by a galphai homolog in Neurospora crassa, Fungal Genet. Biol. e FGB 26 (1999) 48e61. A.K. Cruz, H.F. Terenzi, J.A. Jorge, H.F. Terenzi, Cyclic AMP-dependent, constitutive thermotolerance in the adenylate cyclase-deficient cr-1 (crisp) mutant of Neurospora crassa, Curr. Genet. 13 (1988) 451e454. S. Hu, X. Zhou, X. Gu, S. Cao, C. Wang, J.R. Xu, The cAMP-PKA pathway regulates growth, sexual and asexual differentiation, and pathogenesis in Fusarium graminearum, Mol. Plant Microbe Interact. e MPMI 27 (2014) 557e566. K.B. Lengeler, R.C. Davidson, C. D'Souza, T. Harashima, W.C. Shen, P. Wang, et al., Signal transduction cascades regulating fungal development and virulence, Microbiol. Mol. Biol. Rev. e MMBR 64 (2000) 746e785. H.S. Kim, S.Y. Park, S. Lee, E.L. Adams, K. Czymmek, S. Kang, Loss of cAMPdependent protein kinase A affects multiple traits important for root pathogenesis by Fusarium oxysporum, Mol. Plant Microbe Interact. e MPMI 24 (2011) 719e732.