- Email: [email protected]
Functional Analysis of the Novel C-terminal Domains of S. pombe Transcription Factor IIIA
doi:10.1016/S0022-2836(03)00730-7
J. Mol. Biol. (2003) 331, 321–330
Functional Analysis of the Novel C-terminal Domains of S. pombe Transcription Factor IIIA Deborah B. Schulman1 and David R. Setzer1,2* 1
Department of Molecular Biology and Microbiology School of Medicine, Case Western Reserve University Cleveland, OH 44106, USA 2
Division of Biological Sciences Tucker Hall, University of Missouri, Columbia, MO 65211-7400, USA
Transcription factor IIIA from S. pombe exhibits a novel structural organization compared to its homologues in other species. TFIIIA from S. cerevisiae or vertebrates contains a total of nine C2H2 zinc-finger domains and a non-zinc finger region at its C terminus. In addition, the S. cerevisiae protein possesses an 81-amino acid spacer between zinc fingers eight and nine. In contrast, the S. pombe TFIIIA sequence includes ten potential zinc finger motifs, with a 53-amino acid spacer between fingers nine and ten. Zinc finger nine of the S. pombe protein deviates from the consensus for a C2H2 zinc finger, however, in that it does not include an appropriately positioned second Zn2þ-coordinating histidine. We demonstrate here, through analysis of mutated forms of the protein, that the non-canonical ninth zinc finger is functional in both DNA binding and transcription. In addition, we have shown that the spacer preceding finger ten and finger ten itself are essential for the transcriptional function of S. pombe TFIIIA, but neither is required for wild-type 5 S rRNA genebinding activity. q 2003 Elsevier Ltd. All rights reserved
*Corresponding author
Keywords: TFIIIA; 5 S rRNA; S. pombe; transcription; zinc-finger
Introduction Transcription factor IIIA (TFIIIA) is specifically responsible for the nucleation of RNA polymerase III transcription complex assembly on 5 S ribosomal RNA genes. Several homologues of this protein have been extensively characterized and the primary sequences of these and numerous others have been identified, including those from Xenopus laevis,1 several other amphibians,2 – 4 catfish,5 human,6,7 mouse, rat,8 Saccharomyces cerevisiae9,10 and, most recently, Schizosaccharomyces pombe.11 While the nucleotide sequence within the 5 S rRNA gene to which TFIIIA binds has been relatively well conserved, the primary sequence of the protein has diverged substantially during evolution. In fact, even the structural organization of TFIIIA has not been conserved in all lineages. The common feature of all TFIIIA homologues is the presence of multiple zinc finger motifs, originally identified in X. laevis TFIIIA (F/Y-X-C-X(1-5)C-X3-F/Y-X5-L-X2-H-X(3-4)-H, X ¼ any residue).12,13 All known vertebrate homologues contain nine closely spaced zinc finger motifs, followed by a C-terminal domain of undetermined structure. Abbreviations used: TFIIIA, transcription factor IIIA. E-mail address of the corresponding author: [email protected]
TFIIIA from S. cerevisiae contains eight closely spaced zinc finger motifs, followed by an 81amino acid spacer region and a ninth zinc finger.9,10 Aside from the residues specifically required for zinc finger folding, however, the amino acid sequence of TFIIIA has evolved comparatively rapidly. Recently, we described an initial characterization of TFIIIA from S. pombe.11 S. pombe TFIIIA is not only highly diverged relative to its vertebrate and S. cerevisiae homologues, but is characterized by a novel structural organization (Figure 1). The S. pombe protein contains eight closely spaced zinc fingers, followed by a non-canonical ninth zinc finger that lacks the terminal Zn2þ-coordinating histidine. Putative zinc fingers similar to this one have been identified in proteins encoded within the S. cerevisiae genome,14 but these zinc fingers have not been shown to be functional in DNA binding. Following the putative non-canonical ninth zinc finger, S. pombe TFIIIA contains a 53amino acid spacer, and an unprecedented tenth zinc finger at the very C terminus of the protein. This unique structural organization mimics aspects of both vertebrate and S. cerevisiae TFIIIA, but sequence identity at residues other than those necessary for zinc finger structure is limited to only about 15% when compared to TFIIIA from either S. cerevisiae or X. laevis.
0022-2836/$ - see front matter q 2003 Elsevier Ltd. All rights reserved
322
We confirmed the identity of S. pombe TFIIIA by demonstrating that the protein binds specifically to an S. pombe 5 S rRNA gene with an affinity similar to that observed between either X. laevis or S. cerevisiae TFIIIA and the cognate-binding site.11 In addition, a TFIIIA-dependent in vitro 5 S rRNA gene transcription assay from S. pombe was developed and characterized, and recombinant S. pombe TFIIIA was shown to be active in supporting 5 S rRNA synthesis.11 S. pombe TFIIIA is likely to associate with its binding site in a different manner from what has been observed previously with either vertebrate or S. cerevisiae TFIIIAs, as suggested by the novel pattern of DNase I protection generated on the S. pombe 5 S rRNA gene.11,15 – 18 It is likely that the contributions to DNA binding of various portions of the S. pombe protein differ from what has been observed with other TFIIIAs. TFIIIAs from both X. laevis and S. cerevisiae include sequences that are specifically required for transcription of 5 S rRNA genes.19,20 These sequences have no similarity to one another, but are located in non-zinc finger portions of the protein: specifically, the C terminus of the X. laevis protein and the spacer preceding finger nine of the S. cerevisiae protein. In addition, the C-terminal zinc fingers of both proteins have been shown to be involved in the support of transcription.20 – 22 No sequence similar to either of the known transcription activation sequences is found in the S. pombe protein, however. The unusual organization of the C-terminal region of S. pombe TFIIIA has led us to focus on this portion of the protein. In particular, we asked if the non-canonical finger nine is functional in DNA-binding and/or transcription, and what role, if any, the tenth zinc finger, or the spacer preceding it, plays in TFIIIA function. We show that finger nine is indeed functional in DNA binding and makes a modest contribution to the transcriptional activity of the protein. In contrast, finger ten and the spacer preceding it play little or no role in DNA binding, but are both crucial to TFIIIA’s function in supporting transcription of a 5 S rRNA gene.
Results DNA-binding activity Analysis of finger nine In order to investigate the potential function of the non-consensus ninth zinc finger of S. pombe TFIIIA, several mutant forms of the protein were constructed (Figure 1). In one such mutant, the putative ninth finger was deleted entirely (DF9), and in another the two putative Zn2þ-coordinating cysteines were simultaneously mutated to alanine to eliminate any potential Zn2þ-coordination and, therefore, any zinc finger folding (F9C2A). A mutant in which finger nine and the spacer region
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 1. Primary sequence of S. pombe TFIIIA and tabulation of the mutants discussed.
preceding finger ten were deleted was also constructed (DF9/S). In order to determine the contribution of putative finger nine to the DNA-binding affinity of the protein, the equilibrium-binding constant ðKd Þ for the interaction of mutant F9C2A with the 5 S rRNA gene was measured by Scatchard analysis of gel mobility shift data. Mutating the potential Zn2þ-coordinating cysteines to alanine resulted in a sixfold decrease in affinity for the DNA, relative to wild-type (Table 1). This demonstrates that wild-type finger nine does contribute to wild-type DNA-binding affinity and is dependent upon the mutated cysteine residues for function. Presumably, this dependence results from Zn2þ-coordination by the cysteines, suggesting the existence of a folded zinc finger nine in the wild-type protein.
Table 1. Equilibrium and kinetic constants defining the DNA-binding activity of S. pombe TFIIIA mutants
TFIIIA
Kd (nM)
DG (kcal/ mol)
WT F9C2A G289H F10C2A DF10 DS DS/ F10C2A
0.19(^0.03) 1.15(^0.04) 0.31(^0.04) 0.11(^0.02) 0.10(^0.01) 0.17(^0.03) 0.23(^0.04)
213.5 212.4 213.2 213.8 213.9 213.6 213.4
a
koff b (s21)
t1/2c (min)
0.00148(^0.00021)
7.8
d
d
ND 0.00235(^0.00022) 0.00227(^0.00016) 0.0016(^0.00016) ND
ND 4.9 5.1 7.1 ND
a Average and standard error were determined by analysis of covariance. b Errors are the standard error of the mean. c t1=2 ¼ ððln 2Þ=koff Þ=60: d Dissociation was too rapid for these values to be determined accurately.
323
Analysis of C-terminal Domains of S. pombe TFIIIA
The rate constant for dissociation ðkoff Þ of the complex of this mutant with the 5 S rRNA gene was too rapid to be measured using our assay. Finger nine differs from a consensus zinc finger only in the absence of a C-terminal histidine. In the wild-type protein, this position is occupied by a glycine residue (G289). We constructed and analyzed a mutant version of the protein containing a consensus finger nine by mutating this glycine residue to histidine (G289H, Figure 1). We predicted that restoration of the consensus might significantly alter the DNA-binding affinity of the protein if the putative zinc-finger motif was not functioning as a legitimate DNA-binding zinc finger. This change could manifest itself either as an increase in binding affinity, as a result of increased interaction surface relative to wild-type, or as a decrease in binding affinity resulting from interference with wild-type interactions. In contrast, if wild-type finger nine functions similarly to a canonical zinc finger, the addition of the second Zn2þ-coordinating histidine should have little effect on DNA-binding affinity. In fact, the DNAbinding affinity of mutant G289H was not changed significantly relative to wild-type. Analysis of DNase I protection (footprinting) of a DNA fragment including the S. pombe 5 S rRNA gene by the finger nine mutant proteins provides strong evidence that finger nine is contacting the DNA directly. As we have shown previously,11 wild-type S. pombe TFIIIA protects the 5 S rRNA gene from DNase I digestion from position þ 45 to þ 95, relative to the start site for transcription (þ 1), on the template strand, and from þ 48 to þ 97 on the non-template strand. There is an unprotected region in the center of the footprint from þ 63 to þ 73 on the template strand, and þ 61, þ 62 and þ 70 to þ 76 are unprotected on the non-template strand. DNase I hypersensitive sites are induced at position þ 63 on the non-template strand and at þ 45 and þ 71 on the template strand upon TFIIIA binding. Each of the finger nine mutations, except G289H, resulted in a similar alteration in the DNase I protection pattern (Figures 2 and 3). Specifically, when finger nine is deleted or disrupted, in mutants DF9, DF9/S, or F9C2A, there is a loss of protection over the entire 50 end of the wild-type footprint, from þ 48 to þ 62 on the template strand and from þ 49 to þ 59 on the non-template strand. Additionally, hypersensitivity at position þ 63 is no longer observed. Furthermore, there is some reduction in the degree of protection across the remainder of the footprint, observed most clearly on the template strand with DF9/S. In contrast, G289H yielded a footprint that was essentially wild-type. Analysis of finger ten Mutants were constructed to address the contributions of finger ten to the DNA-binding activity of the protein. These included both deletion
(DF10) and disruption of the finger by mutation of the Zn2þ-coordinating cysteines to alanine (F10C2A). 5 S rRNA gene-binding affinities of these mutant proteins were assessed as described above. We found that deletion or disruption of finger ten does not result in a significant change in binding affinity (Table 1). The half-lives of the finger ten mutant-5 S rRNA gene complexes are also similar to those observed with wild-type TFIIIA, suggesting that the loss of finger ten does not result in the formation of a significantly less stable complex with the DNA. The patterns of DNase I protection of the 5 S rRNA gene generated by mutants with a disruption or deletion of finger ten (F10C2A or DF10) are indistinguishable from those produced by wildtype TFIIIA, further indicating that finger ten does not make significant contacts with the DNA (Figures 2 and 3). Analysis of the spacer A mutant was constructed with the sequence between finger nine and ten deleted (DS) (Figure 1). Neither the equilibrium-binding constant ðKd Þ; nor the dissociation rate constant ðkoff Þ for the complex of this mutant with the 5 S rRNA gene was significantly different from those of the wild-type protein (Table 1). The DNase I protection pattern generated by this mutant on the 5 S rRNA gene is also indistinguishable from that of wildtype (Figures 2 and 3). Not surprisingly, simultaneous deletion of the spacer and disruption of finger ten (DS/F10C2A, Figure 1) had no effect on the DNA-binding affinity of the protein (Table 1). Transcriptional activity To analyze the transcriptional activity of recombinant forms of S. pombe TFIIIA, we developed a TFIIIA-dependent in vitro 5 S rRNA gene transcription system.11 A whole cell extract, derived from S. pombe cells, was generated and fractionated on phosphocellulose (Whatman P11). Transcription of the S. pombe 5 S rRNA gene in the fraction of this extract eluted from the resin at 0.6 M KCl is dependent upon the addition of recombinant TFIIIA. The transcriptional activity of each of the mutant forms of S. pombe TFIIIA was determined using this in vitro system. Activity was measured as a function of TFIIIA concentration, including concentrations beyond which no further increase in RNA synthesis was observed. Determination of these saturation values for transcriptional activity allows for direct comparison between different forms of the protein. Relative to wild-type, the transcriptional activities of mutants with the spacer deleted (DS) or with finger ten disrupted (F10C2A) are reduced to 2.5% and 5.4% of wild-type activity, respectively (Figures 4 and 5). Mutation of the protein to include both deletion of the spacer and disruption of finger ten (DS/F10C2A) was found
324
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 2. A, DNase I protection analysis of the S. pombe 5 S rRNA gene by mutant forms of TFIIIA. The template strand was 50 endlabeled in these experiments. Lane 1 contains undigested probe. Lane 2 contains an A þ G Maxam-Gilbert sequencing ladder as a marker. Lanes 3 and 12 contain digested probe in the absence of protein. Lanes 4– 11 contain probe digested in the presence of saturating amounts of the indicated form of TFIIIA. The diagram at the left shows the pattern of protection generated by the wild-type protein. Triangles designate positions hypersensitive to DNase I digestion. B, S. pombe 5 S rRNA gene sequence from þ40 to þ111.
to be slightly more detrimental to activity than either of the mutations individually (1.7% wildtype activity). Disruption of finger nine (F9C2A) is less deleterious to transcriptional activity, with 44% wild-type activity retained (Figure 4).
Discussion The results presented here indicate that non-
canonical finger nine is, in fact, functional, and is dependent on its two conserved cysteines that are presumed to participate in Zn2þ-coordination. Mutation of the putative Zn2þ-coordinating cysteines (F9C2A) caused a significant decrease in the DNA-binding activity of the protein. In addition, the observation that altering this finger to conform to consensus (G289H) has little effect on the DNA-binding affinity of the protein supports the conclusion that the naturally occurring
Analysis of C-terminal Domains of S. pombe TFIIIA
325
Figure 3. A, DNase I protection analysis of the S. pombe 5 S rRNA gene by mutant forms of TFIIIA. The non-template strand was 50 end-labeled in these experiments. Lane 1 contains undigested probe. Lane 2 contains an A þ G MaxamGilbert sequencing ladder as a marker. Lane 3 contains digested probe in the absence of protein. Lanes 4 – 11 contain probe digested in the presence of saturating amounts of the indicated form of TFIIIA. The diagram at the left shows the pattern of protection generated by the wild-type protein. Triangles designate positions hypersensitive to DNase I digestion. B, S. pombe 5 S rRNA gene sequence from þ 40 to þ111.
non-canonical zinc finger nine is indeed folded and functional in DNA binding. The fourth Zn2þ ligand provided by the C-terminal histidine of a canonical zinc finger must, therefore, come from elsewhere. Three likely possibilities are that the fourth Zn2þ ligand is a water molecule, a thiolate provided by the dithiothreitol present in the binding buffer,23 or that it is provided by C291 (see Figure 1). Bohm et al.14
have described a small family of putative variant zinc fingers encoded by the S. cerevisiae genome that have a corresponding cysteine six residues downstream of the first Zn2þ-coordinating histidine. A parsimonious explanation would therefore be that this conserved cysteine residue plays a common role, Zn2þ coordination, in this variant subfamily of zinc fingers. Another possibility for S. pombe TFIIIA finger nine is that H295, ten
326
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 4. A, Summary of data from multiple experiments in which the transcriptional activity of TFIIIA mutants was measured as a function of increasing mutant TFIIIA concentration. The curves presented were generated using nonlinear curve-fitting methods. B, Transcription saturation values of the same mutants, relative to wild-type.
residues downstream of the first Zn2þ-coordinating histidine, acts as the fourth Zn2þ ligand. We have tested the potential involvement of C291 and H295 in the DNA-binding function of finger nine by mutating these residues individually to alanine and testing the effects of the mutations on DNAbinding activity. In fact, the stability of a complex formed between the 5 S rRNA gene and either C291A or H295A is indistinguishable from that of the wild-type TFIIIA-5 S rRNA gene complex. Furthermore, the DNase I protection patterns, on either the template or non-template strand, conferred by these mutant proteins exhibit no signifi-
cant differences from those produced by wild-type TFIIIA (data not shown). Thus, it is extremely unlikely that either C291 or H295 serves as the fourth zinc ligand mediating correct folding of finger nine. By exclusion, it appears that the most likely candidates for the fourth ligand are a water molecule or a dithiothreitol-provided thiolate, although we cannot eliminate the possibility that an untested amino acid residue serves this function. Merkle et al.23 have shown previously that a C-terminally truncated zinc finger peptide folds in the absence of the C-terminal histidine residue, and that a water molecule fills the fourth metal
Analysis of C-terminal Domains of S. pombe TFIIIA
327
Figure 5. A, Summary of data from multiple experiments in which the transcriptional activity of severely impaired TFIIIA mutants was measured as a function of increasing mutant TFIIIA concentration. The data are the same as those shown in Figure 4, but are plotted on a more informative scale. The curves presented were generated using non-linear curve-fitting methods. B, Transcription saturation values of the same mutants, relative to wild-type.
coordination site in the folded peptide in the absence of exogenous ligands. Titration with b-mercaptoethanol suggested that thiolate is preferred over water as the fourth metal ligand, but is not required for folding of the truncated zinc finger.23 It seems likely that S. pombe zinc finger nine is a naturally occurring example of a zinc finger with metal coordination properties similar to those of the synthetic, truncated peptide studied by Merkle et al., and that folding occurs in the absence of a fourth zinc ligand provided by the protein. An intact finger nine is necessary for the wildtype pattern of DNase I protection of the 5 S rRNA gene over a large region at the 50 end of the binding site. Individual finger disruptions of the
X. laevis protein have been shown previously to eliminate protection of only two to four bases on either strand.16 The loss of protection resulting from the disruption or deletion of S. pombe TFIIIA finger nine, therefore, suggests that this structure is required for the positioning of a large part of the protein on the binding site. In addition, the observation that disruption of finger nine significantly decreases binding affinity and stability of the protein –5 S rRNA gene complex indicates a substantial contribution to DNA binding from the C-terminal end of the protein. The DNase I protection patterns generated by the finger nine mutants also indicate that S. pombe TFIIIA binds to the 5 S rRNA gene in the same orientation as other homologues previously
328
characterized, with the C terminus of the protein contacting the 50 end of the internal control region. Finger nine also functions in the support of 5 S rRNA gene transcription, as its disruption results in a modest decrease in transcription activity, relative to wild-type. Analysis of the F9C2A mutant suggests that a folded zinc finger, and not simply the presence of the appropriate primary sequence, is required for the support of transcription. It is tempting to presume that the decreased DNAbinding affinity of this protein leads to the reduction in transcriptional activity, but this is unlikely to be the case. As we have shown previously with mutants of X. laevis TFIIIA, DNAbinding affinity does not correlate with transcriptional activity.21 The binary complex of TFIIIA and the 5 S rRNA gene is greatly stabilized by the subsequent association of TFIIIC and TFIIIB. Thus, at equilibrium, transcription complex assembly is largely independent of the equilibrium-binding constant of a binary complex of TFIIIA with the 5 S rRNA gene. As a consequence, mutations in TFIIIA would be expected to affect transcription activity only if the mutation affects later steps in transcription complex assembly or the activity of the assembled complex. We believe, therefore, that disruption of finger nine of S. pombe TFIIIA adversely affects steps in transcription complex assembly subsequent to initial DNA binding, or the activity of the assembled complex. This effect could either be direct, by preventing contact with one or more components of the transcription apparatus, or indirect, by improperly positioning more C-terminal domains of the protein (see below) that mediate direct contacts with TFIIIC, TFIIIB, RNA polymerase III, or other factors involved in 5 S rRNA synthesis. The disruption or deletion of finger ten has little effect on the DNA-binding affinity of S. pombe TFIIIA, or on its protection of the 5 S rRNA gene from DNase I digestion. Consequently, finger ten is unlikely to be involved in DNA recognition at all. The deletion or disruption of this motif is, however, severely detrimental to the transcriptional activity of the protein. Deletion of the spacer preceding finger ten is similarly detrimental. In order to explore possible functional interactions between finger ten and the spacer, we have analyzed a mutant containing both a deletion of the spacer and disruption of finger ten (DS/ F10C2A, Figure 1). If the functions of these portions of the protein are independent, the combined mutation would result in a greater reduction in activity than either of the individual mutations. The combined mutation did result in a slightly more severe reduction in transcriptional activity than either deletion of the spacer or disruption of finger ten alone, suggesting some independence of function. Unfortunately, however, the extremely low activities of all three mutants makes it difficult to assess the relative activities quantitatively, precluding a definitive resolution of the question of finger ten/spacer independence.
Analysis of C-terminal Domains of S. pombe TFIIIA
It will be interesting to more precisely identify the sequences within the spacer region and finger ten that are responsible for the support of transcription. It is interesting to note that the sequences serving this function in X. laevis (KRSLASRLT GYIPPK19) and S. cerevisiae TFIIIA (NGLNLLLN20) are not at all similar, and the identification of the functionally analogous sequences in S. pombe TFIIIA could expand our understanding of the manner in which this protein nucleates the assembly of the transcription complex on the 5 S rRNA gene.
Materials and Methods Mutant construction and purification Mutant forms of S. pombe TFIIIA were constructed by a two-step PCR-based mutagenesis method similar to overlap extension PCR described by Ho et al.24 Two primers, each including the desired change were designed to anneal to both strands of pET-SP3A, a bacterial vector that allows expression of wild-type TFIIIA.11 A primer complementary to the 50 end of the coding region (TAACCTACATGTGTCATTTCAATG) was paired in a first round PCR with a mutagenic primer that annealed to the template strand. Another firstround reaction was done with one primer complementary to the 30 end of the coding region (TTGCTTGG ATCCTTATTATGAAGAGAAGCT) paired with a mutagenic primer that annealed to the non-template strand. These two purified PCR products were mixed together in a second PCR with additional 50 and 30 primer in order to “stitch” the two half-molecules together. The final products included an AflIII site at the 50 end and a BamHI site at the 30 end for subcloning between the NcoI and BamHI sites of pET-11D (Novagen). The specific primer sequences for each mutant construction are listed below. DF9 : (GGAACAGCTAAATG CCATATTACCTTC and ATGGCATTTCTGGAGCGCGG CACTTGT). F9C2A : (TCCAAATTTGGTACCAGCGCT ATCAGCATGAAATGCCATATT and AATATGGCATTT CATGCTGATAGCGCTGGTACCAAATTTGGA). G289H: (AGCTTTTTTACAAGTGTGGCGCTCCAGGTGTCG and CGACACCTGGAGCGCCACACTTGTAAAAAAGCT). F10C2A : (CCGGTAATTAGCTTCTGGAAAGGAAGCG CTGTATTCTCGGGCTTC and GAATACAGCGCTTCC DS: TTTCCAGAAGCTAATTACCGGTTCAAACGG). (GGCTTCTTTACAAGTGCCGCGCTCCAG and GGCA CTTGTAAAGAAGCCCGAGAATAC). DF9=S : (GGAA CAGCTAAATGCCATATTACCTTC and ATGGCATTTA GCTGTTCCTTTCCAGAA). DF10 was constructed in a single PCR using the 50 primer described above and a 30 mutagenic primer that added a stop codon prior to the sequence of finger ten and that also added a BamHI site to the new 30 end (GCATTCTGGATCCGATCAGCT GTATTCTCGGGC). Combined mutants were made similarly, using as template a mutant TFIIIA construct including one of the desired mutations and mutagenizing a second site with primers described above. The second round PCR products were ligated between the NcoI and BamHI sites of pET-11d (Novagen). The resulting constructs were transformed into E. coli BL21 (DE3) cells, and the recombinant proteins were expressed and purified as described.11,25
Analysis of C-terminal Domains of S. pombe TFIIIA
329
Determination of equilibrium-binding constants
National Institute of General Medical Sciences to D.R.S. (GM48035).
Scatchard26 analysis of gel mobility shift data was used to determine the equilibrium-binding constant ðKd Þ for each of the mutant proteins complexed to 5 S rDNA as described.11,27 The DNA probe used was a 390-basepair fragment of pGP-SP5S that included the entire S. pombe 5 S rRNA gene.11 Data from multiple determinations were combined and used to determine a best estimate of the Kd and an associated standard error using analysis of covariance. Determination of rate constants for dissociation The rate constant for dissociation of TFIIIA from the 5 S rRNA gene was measured by analysis of gel shift data, as described.11,27 The fraction of 5 S rDNA remaining bound to protein in a single reaction mixture, as a function of time following addition of “trap” DNA to an equilibrated binding reaction mixture, was determined. The resulting data were fit to the equation Bt ¼ A e2kt þ C; where Bt is the fraction of DNA bound at time t and A; C; and k are fitted parameters. k is the dissociation rate constant ðkoff Þ: DNase I protection analysis A PCR fragment including S. pombe 5 S rRNA gene sequence from 263 to þ185 was generated using a 50 end-labeled oligonucleotide in a PCR with pGP-SP5S11 as template. For analysis of the template strand, the 50 primer was labeled with [g-32P]ATP and for analysis of the non-template strand, the 30 primer was labeled. Aliquots of the binding reaction mixture were removed for analysis by EMSA just prior to addition of DNase I to ensure that virtually all the labeled DNA fragment was bound to protein. The details of the analysis are described elsewhere.11 Transcription assays S. pombe extract was prepared using a modification of a protocol developed by Schultz et al.28 – 31 and fractionated on phosphocellulose (Whatman P11) as described.11 Transcription reactions were performed at 30 8C in a total volume of 20 ml with 200 ng (4.1 nM) pGP-SP5S as template, with 0.6 mM CTP, 0.6 mM UTP, 0.6 mM ATP, 0.05 mM GTP, 2 mCi [a-32P]GTP (3000 Ci/mmol), in 20 mM Hepes (pH 7.9), 10% (v/v) glycerol, 10 mM ZnCl2, 0.1 mM BSA, 2.5 mM MgCl2, 0.4 mM DTT, and 3 ml of the 0.6 M P11 fraction (amount of P11 fraction used was preparation-specific). The monovalent salt concentration (NaCl/KCl) was held constant in each reaction at 100 mM (significant salt is carried over from the recombinant TFIIIA preparation). TFIIIA was added at variable concentrations. Reactions were stopped, extracted, precipitated, and run on a denaturing gel. The dried gel was analyzed on a phosphorimager using Image Quant software (Molecular Dynamics).
Acknowledgements We thank Brittany Cone for technical assistance. This work was supported by a grant from the
References 1. Ginsberg, A. M., King, B. O. & Roeder, R. G. (1984). Xenopus 5 S gene transcription factor, TFIIIA: characterization of a cDNA clone and measurement of RNA levels throughout development. Cell, 39, 479 –489. 2. Gaskins, C. J., Smith, J. F., Ogilvie, M. K. & Hanas, J. S. (1992). Comparison of the sequence and structure of transcription factor IIIA from Bufo americanus and Rana pipiens. Gene, 120, 197– 206. 3. Gaskins, C. J. & Hanas, J. S. (1990). Sequence variation in transcription factor IIIA. Nucl. Acids Res. 18, 2117 – 2123. 4. Gaskins, C. J., Fiser-Littell, R. M., Duke, A. L. & Hanas, J. S. (1989). Species variation in transcription factor IIIA. Nucl. Acids Res. 17, 781– 794. 5. Ogilvie, M. K. & Hanas, J. S. (1997). Molecular biology of vertebrate transcription factor IIIA: cloning and characterization of TFIIIA from channel catfish oocytes. Gene, 203, 103– 112. 6. Drew, P. D., Nagle, J. W., Canning, R. D., Ozato, K., Biddison, W. E. & Becker, K. G. (1995). Cloning and expression analysis of a human cDNA homologous to Xenopus TFIIIA. Gene, 159, 215– 218. 7. Arakawa, H., Nagase, H., Hayashi, N., Ogawa, M., Nagata, M., Fujiwara, T. et al. (1995). Molecular cloning, characterization, and chromosomal mapping of a novel human gene (GTF3A) that is highly homologous to Xenopus transcription factor IIIA. Cytogenet. Cell Genet. 70, 235– 238. 8. Hanas, J. S., Hocker, J. R., Cheng, Y. G., Lerner, M. R., Brackett, D. J., Lightfoot, S. A. et al. (2002). cDNA cloning, DNA binding, and evolution of mammalian transcription factor IIIA. Gene, 282, 43– 52. 9. Archambault, J., Milne, C. A., Schappert, K. T., Baum, B., Friesen, J. D. & Segall, J. (1992). The deduced sequence of the transcription factor TFIIIA from Saccharomyces cerevisiae reveals extensive divergence from Xenopus TFIIIA. J. Biol. Chem. 267, 3282 –3288. 10. Woychik, N. A. & Young, R. A. (1992). Genes encoding transcription factor IIIA and the RNA polymerase common subunit RPB6 are divergently transcribed in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 89, 3999– 4003. 11. Schulman, D. B. & Setzer, D. R. (2002). Identification and characterization of transcription factor IIIA from Schizosaccaromyces pombe. Nucl. Acids Res. 30, 2772– 2781. 12. Miller, J., McLachlan, A. D. & Klug, A. (1985). Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 4, 1609 –1614. 13. Berg, J. M. (1988). Proposed structure for the zincbinding domains from transcription factor IIIA and related proteins. Proc. Natl Acad. Sci. USA, 85, 99 – 102. 14. Bohm, S., Frishman, D. & Mewes, H. W. (1997). Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins. Nucl. Acids Res. 25, 2464– 2469. 15. Engelke, D. R., Ng, S. Y., Shastry, B. S. & Roeder, R. G. (1980). Specific interaction of a purified transcription
330
16.
17.
18.
19. 20.
21. 22.
23.
factor with an internal control region of 5 S RNA genes. Cell, 19, 717– 728. Del Rio, S., Menezes, S. R. & Setzer, D. R. (1993). The function of individual zinc fingers in sequencespecific DNA recognition by transcription factor IIIA. J. Mol. Biol. 233, 567– 579. Braun, B. R., Riggs, D. L., Kassavetis, G. A. & Geiduschek, E. P. (1989). Multiple states of protein – DNA interaction in the assembly of transcription complexes on Saccharomyces cerevisiae 5 S ribosomal RNA genes. Proc. Natl Acad. Sci. USA, 86, 2530– 2534. Rowland, O. & Segall, J. (1996). Interaction of wildtype and truncated forms of transcription factor IIIA from Saccharomyces cerevisiae with the 5 S RNA gene. J. Biol. Chem. 271, 12103– 12110. Mao, X. & Darby, M. K. (1993). A position-dependent transcription-activating domain in TFIIIA. Mol. Cell. Biol. 13, 7496– 7506. Rowland, O. & Segall, J. (1998). A hydrophobic segment within the 81-amino-acid domain of TFIIIA from Saccharomyces cerevisiae is essential for its transcription factor activity. Mol. Cell. Biol. 18, 420– 432. Del Rio, S. & Setzer, D. R. (1993). The role of zinc fingers in transcriptional activation by transcription factor IIIA. Proc. Natl Acad. Sci. USA, 90, 168–172. Milne, C. A. & Segall, J. (1993). Mapping regions of yeast transcription factor IIIA required for DNA binding, interaction with transcription factor IIIC, and transcription activity. J. Biol. Chem. 268, 11364– 11371. Merkle, D. L., Schmidt, M. H. & Berg, J. M. (1991).
Analysis of C-terminal Domains of S. pombe TFIIIA
24.
25. 26. 27. 28.
29. 30.
31.
Design and characterization of a ligand-binding metallopeptide. J. Am. Chem. Soc. 113, 5450– 5451. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene, 77, 51 – 59. Del Rio, S. & Setzer, D. R. (1991). High yield purification of active transcription factor IIIA expressed in E. coli. Nucl. Acids Res. 19, 6197–6203. Scatchard, G. (1949). The attractions of proteins for small molecules and ions. Ann. N.Y. Acad. Sci. 51, 660– 672. Setzer, D. R. (1999). Measuring equilibrium and kinetic constants using gel retardation assays. Methods Mol. Biol. 118, 115 – 128. Schultz, M. C., Choe, S. Y. & Reeder, R. H. (1991). Specific initiation by RNA polymerase I in a wholecell extract from yeast. Proc. Natl Acad. Sci. USA, 88, 1004– 1008. Nichols, M., Willis, I. & Soll, D. (1990). Yeast suppressor mutations and transfer RNA processing. Methods Enzymol. 181, 377– 394. Liu, Z., Zhao, A., Chen, L. & Pape, L. (1997). Activated levels of rRNA synthesis in fission yeast are driven by an intergenic rDNA region positioned over 2500 nucleotides upstream of the initiation site. Nucl. Acids Res. 25, 659– 667. Rodicker, F., Ossenbuhl, F., Michels, D. & Benecke, B. J. (1999). Faithful in vitro transcription by fission yeast RNA polymerase III reveals unique alphaamanitin sensitivity. Gene Expr. 8, 165– 174.
Edited by Sir A. Klug (Received 15 May 2003; accepted 5 June 2003)
J. Mol. Biol. (2003) 331, 321–330
Functional Analysis of the Novel C-terminal Domains of S. pombe Transcription Factor IIIA Deborah B. Schulman1 and David R. Setzer1,2* 1
Department of Molecular Biology and Microbiology School of Medicine, Case Western Reserve University Cleveland, OH 44106, USA 2
Division of Biological Sciences Tucker Hall, University of Missouri, Columbia, MO 65211-7400, USA
Transcription factor IIIA from S. pombe exhibits a novel structural organization compared to its homologues in other species. TFIIIA from S. cerevisiae or vertebrates contains a total of nine C2H2 zinc-finger domains and a non-zinc finger region at its C terminus. In addition, the S. cerevisiae protein possesses an 81-amino acid spacer between zinc fingers eight and nine. In contrast, the S. pombe TFIIIA sequence includes ten potential zinc finger motifs, with a 53-amino acid spacer between fingers nine and ten. Zinc finger nine of the S. pombe protein deviates from the consensus for a C2H2 zinc finger, however, in that it does not include an appropriately positioned second Zn2þ-coordinating histidine. We demonstrate here, through analysis of mutated forms of the protein, that the non-canonical ninth zinc finger is functional in both DNA binding and transcription. In addition, we have shown that the spacer preceding finger ten and finger ten itself are essential for the transcriptional function of S. pombe TFIIIA, but neither is required for wild-type 5 S rRNA genebinding activity. q 2003 Elsevier Ltd. All rights reserved
*Corresponding author
Keywords: TFIIIA; 5 S rRNA; S. pombe; transcription; zinc-finger
Introduction Transcription factor IIIA (TFIIIA) is specifically responsible for the nucleation of RNA polymerase III transcription complex assembly on 5 S ribosomal RNA genes. Several homologues of this protein have been extensively characterized and the primary sequences of these and numerous others have been identified, including those from Xenopus laevis,1 several other amphibians,2 – 4 catfish,5 human,6,7 mouse, rat,8 Saccharomyces cerevisiae9,10 and, most recently, Schizosaccharomyces pombe.11 While the nucleotide sequence within the 5 S rRNA gene to which TFIIIA binds has been relatively well conserved, the primary sequence of the protein has diverged substantially during evolution. In fact, even the structural organization of TFIIIA has not been conserved in all lineages. The common feature of all TFIIIA homologues is the presence of multiple zinc finger motifs, originally identified in X. laevis TFIIIA (F/Y-X-C-X(1-5)C-X3-F/Y-X5-L-X2-H-X(3-4)-H, X ¼ any residue).12,13 All known vertebrate homologues contain nine closely spaced zinc finger motifs, followed by a C-terminal domain of undetermined structure. Abbreviations used: TFIIIA, transcription factor IIIA. E-mail address of the corresponding author: [email protected]
TFIIIA from S. cerevisiae contains eight closely spaced zinc finger motifs, followed by an 81amino acid spacer region and a ninth zinc finger.9,10 Aside from the residues specifically required for zinc finger folding, however, the amino acid sequence of TFIIIA has evolved comparatively rapidly. Recently, we described an initial characterization of TFIIIA from S. pombe.11 S. pombe TFIIIA is not only highly diverged relative to its vertebrate and S. cerevisiae homologues, but is characterized by a novel structural organization (Figure 1). The S. pombe protein contains eight closely spaced zinc fingers, followed by a non-canonical ninth zinc finger that lacks the terminal Zn2þ-coordinating histidine. Putative zinc fingers similar to this one have been identified in proteins encoded within the S. cerevisiae genome,14 but these zinc fingers have not been shown to be functional in DNA binding. Following the putative non-canonical ninth zinc finger, S. pombe TFIIIA contains a 53amino acid spacer, and an unprecedented tenth zinc finger at the very C terminus of the protein. This unique structural organization mimics aspects of both vertebrate and S. cerevisiae TFIIIA, but sequence identity at residues other than those necessary for zinc finger structure is limited to only about 15% when compared to TFIIIA from either S. cerevisiae or X. laevis.
0022-2836/$ - see front matter q 2003 Elsevier Ltd. All rights reserved
322
We confirmed the identity of S. pombe TFIIIA by demonstrating that the protein binds specifically to an S. pombe 5 S rRNA gene with an affinity similar to that observed between either X. laevis or S. cerevisiae TFIIIA and the cognate-binding site.11 In addition, a TFIIIA-dependent in vitro 5 S rRNA gene transcription assay from S. pombe was developed and characterized, and recombinant S. pombe TFIIIA was shown to be active in supporting 5 S rRNA synthesis.11 S. pombe TFIIIA is likely to associate with its binding site in a different manner from what has been observed previously with either vertebrate or S. cerevisiae TFIIIAs, as suggested by the novel pattern of DNase I protection generated on the S. pombe 5 S rRNA gene.11,15 – 18 It is likely that the contributions to DNA binding of various portions of the S. pombe protein differ from what has been observed with other TFIIIAs. TFIIIAs from both X. laevis and S. cerevisiae include sequences that are specifically required for transcription of 5 S rRNA genes.19,20 These sequences have no similarity to one another, but are located in non-zinc finger portions of the protein: specifically, the C terminus of the X. laevis protein and the spacer preceding finger nine of the S. cerevisiae protein. In addition, the C-terminal zinc fingers of both proteins have been shown to be involved in the support of transcription.20 – 22 No sequence similar to either of the known transcription activation sequences is found in the S. pombe protein, however. The unusual organization of the C-terminal region of S. pombe TFIIIA has led us to focus on this portion of the protein. In particular, we asked if the non-canonical finger nine is functional in DNA-binding and/or transcription, and what role, if any, the tenth zinc finger, or the spacer preceding it, plays in TFIIIA function. We show that finger nine is indeed functional in DNA binding and makes a modest contribution to the transcriptional activity of the protein. In contrast, finger ten and the spacer preceding it play little or no role in DNA binding, but are both crucial to TFIIIA’s function in supporting transcription of a 5 S rRNA gene.
Results DNA-binding activity Analysis of finger nine In order to investigate the potential function of the non-consensus ninth zinc finger of S. pombe TFIIIA, several mutant forms of the protein were constructed (Figure 1). In one such mutant, the putative ninth finger was deleted entirely (DF9), and in another the two putative Zn2þ-coordinating cysteines were simultaneously mutated to alanine to eliminate any potential Zn2þ-coordination and, therefore, any zinc finger folding (F9C2A). A mutant in which finger nine and the spacer region
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 1. Primary sequence of S. pombe TFIIIA and tabulation of the mutants discussed.
preceding finger ten were deleted was also constructed (DF9/S). In order to determine the contribution of putative finger nine to the DNA-binding affinity of the protein, the equilibrium-binding constant ðKd Þ for the interaction of mutant F9C2A with the 5 S rRNA gene was measured by Scatchard analysis of gel mobility shift data. Mutating the potential Zn2þ-coordinating cysteines to alanine resulted in a sixfold decrease in affinity for the DNA, relative to wild-type (Table 1). This demonstrates that wild-type finger nine does contribute to wild-type DNA-binding affinity and is dependent upon the mutated cysteine residues for function. Presumably, this dependence results from Zn2þ-coordination by the cysteines, suggesting the existence of a folded zinc finger nine in the wild-type protein.
Table 1. Equilibrium and kinetic constants defining the DNA-binding activity of S. pombe TFIIIA mutants
TFIIIA
Kd (nM)
DG (kcal/ mol)
WT F9C2A G289H F10C2A DF10 DS DS/ F10C2A
0.19(^0.03) 1.15(^0.04) 0.31(^0.04) 0.11(^0.02) 0.10(^0.01) 0.17(^0.03) 0.23(^0.04)
213.5 212.4 213.2 213.8 213.9 213.6 213.4
a
koff b (s21)
t1/2c (min)
0.00148(^0.00021)
7.8
d
d
ND 0.00235(^0.00022) 0.00227(^0.00016) 0.0016(^0.00016) ND
ND 4.9 5.1 7.1 ND
a Average and standard error were determined by analysis of covariance. b Errors are the standard error of the mean. c t1=2 ¼ ððln 2Þ=koff Þ=60: d Dissociation was too rapid for these values to be determined accurately.
323
Analysis of C-terminal Domains of S. pombe TFIIIA
The rate constant for dissociation ðkoff Þ of the complex of this mutant with the 5 S rRNA gene was too rapid to be measured using our assay. Finger nine differs from a consensus zinc finger only in the absence of a C-terminal histidine. In the wild-type protein, this position is occupied by a glycine residue (G289). We constructed and analyzed a mutant version of the protein containing a consensus finger nine by mutating this glycine residue to histidine (G289H, Figure 1). We predicted that restoration of the consensus might significantly alter the DNA-binding affinity of the protein if the putative zinc-finger motif was not functioning as a legitimate DNA-binding zinc finger. This change could manifest itself either as an increase in binding affinity, as a result of increased interaction surface relative to wild-type, or as a decrease in binding affinity resulting from interference with wild-type interactions. In contrast, if wild-type finger nine functions similarly to a canonical zinc finger, the addition of the second Zn2þ-coordinating histidine should have little effect on DNA-binding affinity. In fact, the DNAbinding affinity of mutant G289H was not changed significantly relative to wild-type. Analysis of DNase I protection (footprinting) of a DNA fragment including the S. pombe 5 S rRNA gene by the finger nine mutant proteins provides strong evidence that finger nine is contacting the DNA directly. As we have shown previously,11 wild-type S. pombe TFIIIA protects the 5 S rRNA gene from DNase I digestion from position þ 45 to þ 95, relative to the start site for transcription (þ 1), on the template strand, and from þ 48 to þ 97 on the non-template strand. There is an unprotected region in the center of the footprint from þ 63 to þ 73 on the template strand, and þ 61, þ 62 and þ 70 to þ 76 are unprotected on the non-template strand. DNase I hypersensitive sites are induced at position þ 63 on the non-template strand and at þ 45 and þ 71 on the template strand upon TFIIIA binding. Each of the finger nine mutations, except G289H, resulted in a similar alteration in the DNase I protection pattern (Figures 2 and 3). Specifically, when finger nine is deleted or disrupted, in mutants DF9, DF9/S, or F9C2A, there is a loss of protection over the entire 50 end of the wild-type footprint, from þ 48 to þ 62 on the template strand and from þ 49 to þ 59 on the non-template strand. Additionally, hypersensitivity at position þ 63 is no longer observed. Furthermore, there is some reduction in the degree of protection across the remainder of the footprint, observed most clearly on the template strand with DF9/S. In contrast, G289H yielded a footprint that was essentially wild-type. Analysis of finger ten Mutants were constructed to address the contributions of finger ten to the DNA-binding activity of the protein. These included both deletion
(DF10) and disruption of the finger by mutation of the Zn2þ-coordinating cysteines to alanine (F10C2A). 5 S rRNA gene-binding affinities of these mutant proteins were assessed as described above. We found that deletion or disruption of finger ten does not result in a significant change in binding affinity (Table 1). The half-lives of the finger ten mutant-5 S rRNA gene complexes are also similar to those observed with wild-type TFIIIA, suggesting that the loss of finger ten does not result in the formation of a significantly less stable complex with the DNA. The patterns of DNase I protection of the 5 S rRNA gene generated by mutants with a disruption or deletion of finger ten (F10C2A or DF10) are indistinguishable from those produced by wildtype TFIIIA, further indicating that finger ten does not make significant contacts with the DNA (Figures 2 and 3). Analysis of the spacer A mutant was constructed with the sequence between finger nine and ten deleted (DS) (Figure 1). Neither the equilibrium-binding constant ðKd Þ; nor the dissociation rate constant ðkoff Þ for the complex of this mutant with the 5 S rRNA gene was significantly different from those of the wild-type protein (Table 1). The DNase I protection pattern generated by this mutant on the 5 S rRNA gene is also indistinguishable from that of wildtype (Figures 2 and 3). Not surprisingly, simultaneous deletion of the spacer and disruption of finger ten (DS/F10C2A, Figure 1) had no effect on the DNA-binding affinity of the protein (Table 1). Transcriptional activity To analyze the transcriptional activity of recombinant forms of S. pombe TFIIIA, we developed a TFIIIA-dependent in vitro 5 S rRNA gene transcription system.11 A whole cell extract, derived from S. pombe cells, was generated and fractionated on phosphocellulose (Whatman P11). Transcription of the S. pombe 5 S rRNA gene in the fraction of this extract eluted from the resin at 0.6 M KCl is dependent upon the addition of recombinant TFIIIA. The transcriptional activity of each of the mutant forms of S. pombe TFIIIA was determined using this in vitro system. Activity was measured as a function of TFIIIA concentration, including concentrations beyond which no further increase in RNA synthesis was observed. Determination of these saturation values for transcriptional activity allows for direct comparison between different forms of the protein. Relative to wild-type, the transcriptional activities of mutants with the spacer deleted (DS) or with finger ten disrupted (F10C2A) are reduced to 2.5% and 5.4% of wild-type activity, respectively (Figures 4 and 5). Mutation of the protein to include both deletion of the spacer and disruption of finger ten (DS/F10C2A) was found
324
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 2. A, DNase I protection analysis of the S. pombe 5 S rRNA gene by mutant forms of TFIIIA. The template strand was 50 endlabeled in these experiments. Lane 1 contains undigested probe. Lane 2 contains an A þ G Maxam-Gilbert sequencing ladder as a marker. Lanes 3 and 12 contain digested probe in the absence of protein. Lanes 4– 11 contain probe digested in the presence of saturating amounts of the indicated form of TFIIIA. The diagram at the left shows the pattern of protection generated by the wild-type protein. Triangles designate positions hypersensitive to DNase I digestion. B, S. pombe 5 S rRNA gene sequence from þ40 to þ111.
to be slightly more detrimental to activity than either of the mutations individually (1.7% wildtype activity). Disruption of finger nine (F9C2A) is less deleterious to transcriptional activity, with 44% wild-type activity retained (Figure 4).
Discussion The results presented here indicate that non-
canonical finger nine is, in fact, functional, and is dependent on its two conserved cysteines that are presumed to participate in Zn2þ-coordination. Mutation of the putative Zn2þ-coordinating cysteines (F9C2A) caused a significant decrease in the DNA-binding activity of the protein. In addition, the observation that altering this finger to conform to consensus (G289H) has little effect on the DNA-binding affinity of the protein supports the conclusion that the naturally occurring
Analysis of C-terminal Domains of S. pombe TFIIIA
325
Figure 3. A, DNase I protection analysis of the S. pombe 5 S rRNA gene by mutant forms of TFIIIA. The non-template strand was 50 end-labeled in these experiments. Lane 1 contains undigested probe. Lane 2 contains an A þ G MaxamGilbert sequencing ladder as a marker. Lane 3 contains digested probe in the absence of protein. Lanes 4 – 11 contain probe digested in the presence of saturating amounts of the indicated form of TFIIIA. The diagram at the left shows the pattern of protection generated by the wild-type protein. Triangles designate positions hypersensitive to DNase I digestion. B, S. pombe 5 S rRNA gene sequence from þ 40 to þ111.
non-canonical zinc finger nine is indeed folded and functional in DNA binding. The fourth Zn2þ ligand provided by the C-terminal histidine of a canonical zinc finger must, therefore, come from elsewhere. Three likely possibilities are that the fourth Zn2þ ligand is a water molecule, a thiolate provided by the dithiothreitol present in the binding buffer,23 or that it is provided by C291 (see Figure 1). Bohm et al.14
have described a small family of putative variant zinc fingers encoded by the S. cerevisiae genome that have a corresponding cysteine six residues downstream of the first Zn2þ-coordinating histidine. A parsimonious explanation would therefore be that this conserved cysteine residue plays a common role, Zn2þ coordination, in this variant subfamily of zinc fingers. Another possibility for S. pombe TFIIIA finger nine is that H295, ten
326
Analysis of C-terminal Domains of S. pombe TFIIIA
Figure 4. A, Summary of data from multiple experiments in which the transcriptional activity of TFIIIA mutants was measured as a function of increasing mutant TFIIIA concentration. The curves presented were generated using nonlinear curve-fitting methods. B, Transcription saturation values of the same mutants, relative to wild-type.
residues downstream of the first Zn2þ-coordinating histidine, acts as the fourth Zn2þ ligand. We have tested the potential involvement of C291 and H295 in the DNA-binding function of finger nine by mutating these residues individually to alanine and testing the effects of the mutations on DNAbinding activity. In fact, the stability of a complex formed between the 5 S rRNA gene and either C291A or H295A is indistinguishable from that of the wild-type TFIIIA-5 S rRNA gene complex. Furthermore, the DNase I protection patterns, on either the template or non-template strand, conferred by these mutant proteins exhibit no signifi-
cant differences from those produced by wild-type TFIIIA (data not shown). Thus, it is extremely unlikely that either C291 or H295 serves as the fourth zinc ligand mediating correct folding of finger nine. By exclusion, it appears that the most likely candidates for the fourth ligand are a water molecule or a dithiothreitol-provided thiolate, although we cannot eliminate the possibility that an untested amino acid residue serves this function. Merkle et al.23 have shown previously that a C-terminally truncated zinc finger peptide folds in the absence of the C-terminal histidine residue, and that a water molecule fills the fourth metal
Analysis of C-terminal Domains of S. pombe TFIIIA
327
Figure 5. A, Summary of data from multiple experiments in which the transcriptional activity of severely impaired TFIIIA mutants was measured as a function of increasing mutant TFIIIA concentration. The data are the same as those shown in Figure 4, but are plotted on a more informative scale. The curves presented were generated using non-linear curve-fitting methods. B, Transcription saturation values of the same mutants, relative to wild-type.
coordination site in the folded peptide in the absence of exogenous ligands. Titration with b-mercaptoethanol suggested that thiolate is preferred over water as the fourth metal ligand, but is not required for folding of the truncated zinc finger.23 It seems likely that S. pombe zinc finger nine is a naturally occurring example of a zinc finger with metal coordination properties similar to those of the synthetic, truncated peptide studied by Merkle et al., and that folding occurs in the absence of a fourth zinc ligand provided by the protein. An intact finger nine is necessary for the wildtype pattern of DNase I protection of the 5 S rRNA gene over a large region at the 50 end of the binding site. Individual finger disruptions of the
X. laevis protein have been shown previously to eliminate protection of only two to four bases on either strand.16 The loss of protection resulting from the disruption or deletion of S. pombe TFIIIA finger nine, therefore, suggests that this structure is required for the positioning of a large part of the protein on the binding site. In addition, the observation that disruption of finger nine significantly decreases binding affinity and stability of the protein –5 S rRNA gene complex indicates a substantial contribution to DNA binding from the C-terminal end of the protein. The DNase I protection patterns generated by the finger nine mutants also indicate that S. pombe TFIIIA binds to the 5 S rRNA gene in the same orientation as other homologues previously
328
characterized, with the C terminus of the protein contacting the 50 end of the internal control region. Finger nine also functions in the support of 5 S rRNA gene transcription, as its disruption results in a modest decrease in transcription activity, relative to wild-type. Analysis of the F9C2A mutant suggests that a folded zinc finger, and not simply the presence of the appropriate primary sequence, is required for the support of transcription. It is tempting to presume that the decreased DNAbinding affinity of this protein leads to the reduction in transcriptional activity, but this is unlikely to be the case. As we have shown previously with mutants of X. laevis TFIIIA, DNAbinding affinity does not correlate with transcriptional activity.21 The binary complex of TFIIIA and the 5 S rRNA gene is greatly stabilized by the subsequent association of TFIIIC and TFIIIB. Thus, at equilibrium, transcription complex assembly is largely independent of the equilibrium-binding constant of a binary complex of TFIIIA with the 5 S rRNA gene. As a consequence, mutations in TFIIIA would be expected to affect transcription activity only if the mutation affects later steps in transcription complex assembly or the activity of the assembled complex. We believe, therefore, that disruption of finger nine of S. pombe TFIIIA adversely affects steps in transcription complex assembly subsequent to initial DNA binding, or the activity of the assembled complex. This effect could either be direct, by preventing contact with one or more components of the transcription apparatus, or indirect, by improperly positioning more C-terminal domains of the protein (see below) that mediate direct contacts with TFIIIC, TFIIIB, RNA polymerase III, or other factors involved in 5 S rRNA synthesis. The disruption or deletion of finger ten has little effect on the DNA-binding affinity of S. pombe TFIIIA, or on its protection of the 5 S rRNA gene from DNase I digestion. Consequently, finger ten is unlikely to be involved in DNA recognition at all. The deletion or disruption of this motif is, however, severely detrimental to the transcriptional activity of the protein. Deletion of the spacer preceding finger ten is similarly detrimental. In order to explore possible functional interactions between finger ten and the spacer, we have analyzed a mutant containing both a deletion of the spacer and disruption of finger ten (DS/ F10C2A, Figure 1). If the functions of these portions of the protein are independent, the combined mutation would result in a greater reduction in activity than either of the individual mutations. The combined mutation did result in a slightly more severe reduction in transcriptional activity than either deletion of the spacer or disruption of finger ten alone, suggesting some independence of function. Unfortunately, however, the extremely low activities of all three mutants makes it difficult to assess the relative activities quantitatively, precluding a definitive resolution of the question of finger ten/spacer independence.
Analysis of C-terminal Domains of S. pombe TFIIIA
It will be interesting to more precisely identify the sequences within the spacer region and finger ten that are responsible for the support of transcription. It is interesting to note that the sequences serving this function in X. laevis (KRSLASRLT GYIPPK19) and S. cerevisiae TFIIIA (NGLNLLLN20) are not at all similar, and the identification of the functionally analogous sequences in S. pombe TFIIIA could expand our understanding of the manner in which this protein nucleates the assembly of the transcription complex on the 5 S rRNA gene.
Materials and Methods Mutant construction and purification Mutant forms of S. pombe TFIIIA were constructed by a two-step PCR-based mutagenesis method similar to overlap extension PCR described by Ho et al.24 Two primers, each including the desired change were designed to anneal to both strands of pET-SP3A, a bacterial vector that allows expression of wild-type TFIIIA.11 A primer complementary to the 50 end of the coding region (TAACCTACATGTGTCATTTCAATG) was paired in a first round PCR with a mutagenic primer that annealed to the template strand. Another firstround reaction was done with one primer complementary to the 30 end of the coding region (TTGCTTGG ATCCTTATTATGAAGAGAAGCT) paired with a mutagenic primer that annealed to the non-template strand. These two purified PCR products were mixed together in a second PCR with additional 50 and 30 primer in order to “stitch” the two half-molecules together. The final products included an AflIII site at the 50 end and a BamHI site at the 30 end for subcloning between the NcoI and BamHI sites of pET-11D (Novagen). The specific primer sequences for each mutant construction are listed below. DF9 : (GGAACAGCTAAATG CCATATTACCTTC and ATGGCATTTCTGGAGCGCGG CACTTGT). F9C2A : (TCCAAATTTGGTACCAGCGCT ATCAGCATGAAATGCCATATT and AATATGGCATTT CATGCTGATAGCGCTGGTACCAAATTTGGA). G289H: (AGCTTTTTTACAAGTGTGGCGCTCCAGGTGTCG and CGACACCTGGAGCGCCACACTTGTAAAAAAGCT). F10C2A : (CCGGTAATTAGCTTCTGGAAAGGAAGCG CTGTATTCTCGGGCTTC and GAATACAGCGCTTCC DS: TTTCCAGAAGCTAATTACCGGTTCAAACGG). (GGCTTCTTTACAAGTGCCGCGCTCCAG and GGCA CTTGTAAAGAAGCCCGAGAATAC). DF9=S : (GGAA CAGCTAAATGCCATATTACCTTC and ATGGCATTTA GCTGTTCCTTTCCAGAA). DF10 was constructed in a single PCR using the 50 primer described above and a 30 mutagenic primer that added a stop codon prior to the sequence of finger ten and that also added a BamHI site to the new 30 end (GCATTCTGGATCCGATCAGCT GTATTCTCGGGC). Combined mutants were made similarly, using as template a mutant TFIIIA construct including one of the desired mutations and mutagenizing a second site with primers described above. The second round PCR products were ligated between the NcoI and BamHI sites of pET-11d (Novagen). The resulting constructs were transformed into E. coli BL21 (DE3) cells, and the recombinant proteins were expressed and purified as described.11,25
Analysis of C-terminal Domains of S. pombe TFIIIA
329
Determination of equilibrium-binding constants
National Institute of General Medical Sciences to D.R.S. (GM48035).
Scatchard26 analysis of gel mobility shift data was used to determine the equilibrium-binding constant ðKd Þ for each of the mutant proteins complexed to 5 S rDNA as described.11,27 The DNA probe used was a 390-basepair fragment of pGP-SP5S that included the entire S. pombe 5 S rRNA gene.11 Data from multiple determinations were combined and used to determine a best estimate of the Kd and an associated standard error using analysis of covariance. Determination of rate constants for dissociation The rate constant for dissociation of TFIIIA from the 5 S rRNA gene was measured by analysis of gel shift data, as described.11,27 The fraction of 5 S rDNA remaining bound to protein in a single reaction mixture, as a function of time following addition of “trap” DNA to an equilibrated binding reaction mixture, was determined. The resulting data were fit to the equation Bt ¼ A e2kt þ C; where Bt is the fraction of DNA bound at time t and A; C; and k are fitted parameters. k is the dissociation rate constant ðkoff Þ: DNase I protection analysis A PCR fragment including S. pombe 5 S rRNA gene sequence from 263 to þ185 was generated using a 50 end-labeled oligonucleotide in a PCR with pGP-SP5S11 as template. For analysis of the template strand, the 50 primer was labeled with [g-32P]ATP and for analysis of the non-template strand, the 30 primer was labeled. Aliquots of the binding reaction mixture were removed for analysis by EMSA just prior to addition of DNase I to ensure that virtually all the labeled DNA fragment was bound to protein. The details of the analysis are described elsewhere.11 Transcription assays S. pombe extract was prepared using a modification of a protocol developed by Schultz et al.28 – 31 and fractionated on phosphocellulose (Whatman P11) as described.11 Transcription reactions were performed at 30 8C in a total volume of 20 ml with 200 ng (4.1 nM) pGP-SP5S as template, with 0.6 mM CTP, 0.6 mM UTP, 0.6 mM ATP, 0.05 mM GTP, 2 mCi [a-32P]GTP (3000 Ci/mmol), in 20 mM Hepes (pH 7.9), 10% (v/v) glycerol, 10 mM ZnCl2, 0.1 mM BSA, 2.5 mM MgCl2, 0.4 mM DTT, and 3 ml of the 0.6 M P11 fraction (amount of P11 fraction used was preparation-specific). The monovalent salt concentration (NaCl/KCl) was held constant in each reaction at 100 mM (significant salt is carried over from the recombinant TFIIIA preparation). TFIIIA was added at variable concentrations. Reactions were stopped, extracted, precipitated, and run on a denaturing gel. The dried gel was analyzed on a phosphorimager using Image Quant software (Molecular Dynamics).
Acknowledgements We thank Brittany Cone for technical assistance. This work was supported by a grant from the
References 1. Ginsberg, A. M., King, B. O. & Roeder, R. G. (1984). Xenopus 5 S gene transcription factor, TFIIIA: characterization of a cDNA clone and measurement of RNA levels throughout development. Cell, 39, 479 –489. 2. Gaskins, C. J., Smith, J. F., Ogilvie, M. K. & Hanas, J. S. (1992). Comparison of the sequence and structure of transcription factor IIIA from Bufo americanus and Rana pipiens. Gene, 120, 197– 206. 3. Gaskins, C. J. & Hanas, J. S. (1990). Sequence variation in transcription factor IIIA. Nucl. Acids Res. 18, 2117 – 2123. 4. Gaskins, C. J., Fiser-Littell, R. M., Duke, A. L. & Hanas, J. S. (1989). Species variation in transcription factor IIIA. Nucl. Acids Res. 17, 781– 794. 5. Ogilvie, M. K. & Hanas, J. S. (1997). Molecular biology of vertebrate transcription factor IIIA: cloning and characterization of TFIIIA from channel catfish oocytes. Gene, 203, 103– 112. 6. Drew, P. D., Nagle, J. W., Canning, R. D., Ozato, K., Biddison, W. E. & Becker, K. G. (1995). Cloning and expression analysis of a human cDNA homologous to Xenopus TFIIIA. Gene, 159, 215– 218. 7. Arakawa, H., Nagase, H., Hayashi, N., Ogawa, M., Nagata, M., Fujiwara, T. et al. (1995). Molecular cloning, characterization, and chromosomal mapping of a novel human gene (GTF3A) that is highly homologous to Xenopus transcription factor IIIA. Cytogenet. Cell Genet. 70, 235– 238. 8. Hanas, J. S., Hocker, J. R., Cheng, Y. G., Lerner, M. R., Brackett, D. J., Lightfoot, S. A. et al. (2002). cDNA cloning, DNA binding, and evolution of mammalian transcription factor IIIA. Gene, 282, 43– 52. 9. Archambault, J., Milne, C. A., Schappert, K. T., Baum, B., Friesen, J. D. & Segall, J. (1992). The deduced sequence of the transcription factor TFIIIA from Saccharomyces cerevisiae reveals extensive divergence from Xenopus TFIIIA. J. Biol. Chem. 267, 3282 –3288. 10. Woychik, N. A. & Young, R. A. (1992). Genes encoding transcription factor IIIA and the RNA polymerase common subunit RPB6 are divergently transcribed in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 89, 3999– 4003. 11. Schulman, D. B. & Setzer, D. R. (2002). Identification and characterization of transcription factor IIIA from Schizosaccaromyces pombe. Nucl. Acids Res. 30, 2772– 2781. 12. Miller, J., McLachlan, A. D. & Klug, A. (1985). Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 4, 1609 –1614. 13. Berg, J. M. (1988). Proposed structure for the zincbinding domains from transcription factor IIIA and related proteins. Proc. Natl Acad. Sci. USA, 85, 99 – 102. 14. Bohm, S., Frishman, D. & Mewes, H. W. (1997). Variations of the C2H2 zinc finger motif in the yeast genome and classification of yeast zinc finger proteins. Nucl. Acids Res. 25, 2464– 2469. 15. Engelke, D. R., Ng, S. Y., Shastry, B. S. & Roeder, R. G. (1980). Specific interaction of a purified transcription
330
16.
17.
18.
19. 20.
21. 22.
23.
factor with an internal control region of 5 S RNA genes. Cell, 19, 717– 728. Del Rio, S., Menezes, S. R. & Setzer, D. R. (1993). The function of individual zinc fingers in sequencespecific DNA recognition by transcription factor IIIA. J. Mol. Biol. 233, 567– 579. Braun, B. R., Riggs, D. L., Kassavetis, G. A. & Geiduschek, E. P. (1989). Multiple states of protein – DNA interaction in the assembly of transcription complexes on Saccharomyces cerevisiae 5 S ribosomal RNA genes. Proc. Natl Acad. Sci. USA, 86, 2530– 2534. Rowland, O. & Segall, J. (1996). Interaction of wildtype and truncated forms of transcription factor IIIA from Saccharomyces cerevisiae with the 5 S RNA gene. J. Biol. Chem. 271, 12103– 12110. Mao, X. & Darby, M. K. (1993). A position-dependent transcription-activating domain in TFIIIA. Mol. Cell. Biol. 13, 7496– 7506. Rowland, O. & Segall, J. (1998). A hydrophobic segment within the 81-amino-acid domain of TFIIIA from Saccharomyces cerevisiae is essential for its transcription factor activity. Mol. Cell. Biol. 18, 420– 432. Del Rio, S. & Setzer, D. R. (1993). The role of zinc fingers in transcriptional activation by transcription factor IIIA. Proc. Natl Acad. Sci. USA, 90, 168–172. Milne, C. A. & Segall, J. (1993). Mapping regions of yeast transcription factor IIIA required for DNA binding, interaction with transcription factor IIIC, and transcription activity. J. Biol. Chem. 268, 11364– 11371. Merkle, D. L., Schmidt, M. H. & Berg, J. M. (1991).
Analysis of C-terminal Domains of S. pombe TFIIIA
24.
25. 26. 27. 28.
29. 30.
31.
Design and characterization of a ligand-binding metallopeptide. J. Am. Chem. Soc. 113, 5450– 5451. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene, 77, 51 – 59. Del Rio, S. & Setzer, D. R. (1991). High yield purification of active transcription factor IIIA expressed in E. coli. Nucl. Acids Res. 19, 6197–6203. Scatchard, G. (1949). The attractions of proteins for small molecules and ions. Ann. N.Y. Acad. Sci. 51, 660– 672. Setzer, D. R. (1999). Measuring equilibrium and kinetic constants using gel retardation assays. Methods Mol. Biol. 118, 115 – 128. Schultz, M. C., Choe, S. Y. & Reeder, R. H. (1991). Specific initiation by RNA polymerase I in a wholecell extract from yeast. Proc. Natl Acad. Sci. USA, 88, 1004– 1008. Nichols, M., Willis, I. & Soll, D. (1990). Yeast suppressor mutations and transfer RNA processing. Methods Enzymol. 181, 377– 394. Liu, Z., Zhao, A., Chen, L. & Pape, L. (1997). Activated levels of rRNA synthesis in fission yeast are driven by an intergenic rDNA region positioned over 2500 nucleotides upstream of the initiation site. Nucl. Acids Res. 25, 659– 667. Rodicker, F., Ossenbuhl, F., Michels, D. & Benecke, B. J. (1999). Faithful in vitro transcription by fission yeast RNA polymerase III reveals unique alphaamanitin sensitivity. Gene Expr. 8, 165– 174.
Edited by Sir A. Klug (Received 15 May 2003; accepted 5 June 2003)