Functional and antigenic analyses of the 1918 influenza virus haemagglutinin using a recombinant vaccinia virus expression system

Virus Research 122 (2006) 11–19

Functional and antigenic analyses of the 1918 influenza virus haemagglutinin using a recombinant vaccinia virus expression system Alex J. Elliot a,1 , David A. Steinhauer a,2 , Rod S. Daniels a , John S. Oxford b,∗ a

b

Division of Virology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK Department of Medical Microbiology and Retroscreen Virology Ltd., Queen Mary’s School of Medicine and Dentistry, St. Bart’s and the London, 327 Mile End Road, London E1 4NS, UK Received 14 February 2006; received in revised form 5 June 2006; accepted 7 June 2006 Available online 9 August 2006

Abstract The influenza pandemic of 1918 caused unprecedented levels of morbidity and mortality in its 12-month period of circulation around the globe. The haemagglutinin molecule has been shown to affect the pathogenicity of some subtypes of influenza A viruses. Using a recombinant vaccinia system that allowed expression of the 1918 influenza haemagglutinin, we performed functional assays to assess the glycoprotein’s involvement in determining the high pathogenicity of the 1918 virus. We show that in respect of expression levels, proteolytic processing, receptor-binding, membrane fusion and antigenic properties, the haemagglutinin of the 1918 virus is unremarkable when compared with the haemagglutinins of other ‘early’ H1 influenza viruses. This suggests that whilst the 1918 haemagglutinin, as a new/novel antigen in the human population, was responsible for the influenza pandemic its functions per se were not responsible for the high mortality and acute symptoms experienced by patients infected with the 1918 influenza virus. © 2006 Elsevier B.V. All rights reserved. Keywords: Influenza virus; Haemagglutinin; 1918 Pandemic; Pathogenicity; Recombinant vaccinia virus; Protein expression

1. Introduction The influenza pandemic of 1918 remains the greatest single outbreak of disease the human race has encountered to date. During a 12-month period of circulation, it is estimated that the 1918 influenza pandemic infected approximately half of the world’s human population (one billion) and claimed at least 20–40 million lives (Phillips and Killingray, 2003). An unusual feature of the 1918 influenza pandemic was the distribution of mortality in different age groups with the majority of victims being young healthy adults (Luk et al., 2001; Simonsen et al., 1998). Blocks of formalin-fixed, paraffin-embedded (FFPE) tissue and bodies exhumed from permafrost have provided the

∗

Corresponding author. Tel.: +44 208 709 4901; fax: +44 208 709 4949. E-mail address: [email protected] (J.S. Oxford). 1 Present address: Birmingham Research Unit of the Royal College of General Practitioners, Lordswood House, 54 Lordswood Road, Harborne, Birmingham B17 9DB, UK. 2 Present address: Department of Microbiology and Immunology, Emory University School of Medicine, 1510 Clifton Road, Atlanta, GA 30322, USA. 0168-1702/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2006.06.004

raw material to study the genetic composition of the viruses responsible for the 1918 pandemic (Krafft et al., 1995; Oxford, 2000; Taubenberger et al., 1997). Protein encoding nucleotide sequences for all eight gene segments have now been published, but analyses of protein translation products have not identified specific mutations that in isolation might have accounted for the associated pathogenicity of the virus (Basler et al., 2001; Geiss et al., 2002; Reid et al., 1999, 2000, 2002, 2004; Taubenberger et al., 2005). The 1918 influenza virus has been reconstructed using reverse genetics and the resulting virus was shown to be highly virulent/pathogenic in mice and embryonated chicken eggs, characteristics classically associated with the original 1918 virus in humans (Tumpey et al., 2005). This study, and others, also tested the role of individual gene segment products in this pathogenicity, by creating chimeric influenza A viruses, incorporating either single or multiple combinations of 1918 virus-derived genes, that were tested in the mouse model (Basler et al., 2001; Geiss et al., 2002; Kash et al., 2004; Kobasa et al., 2004; Tumpey et al., 2004, 2005). The Kobasa et al. (2004) study demonstrated that the 1918 influenza haemagglutinin (HA) conferred, in mice, high pathogenicity to human influenza viruses

12

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

that were normally non-pathogenic. It was also shown that these viruses could induce high levels of macrophage-derived chemokines and cytokines in lungs, resulting in infiltration of inflammatory cells and severe haemorrhage, a pathology that shows remarkable similarity to that reported during the 1918 pandemic (Kash et al., 2004). The HA surface glycoprotein of influenza has two functions in the virus infectious cycle. It forms the attachment protein, binding to sialylated receptor molecules on the surface of target cells, and mediates fusion between viral and endosomal membranes (Skehel and Wiley, 2000). Anchored to the viral envelope, the HA molecule forms homotrimers, with each monomer synthesised as a single polypeptide, HA0. Following proteolytic cleavage of HA0, two disulphide-linked subunits are formed, the membrane-distal domain (HA1) and membrane-proximal ␣-helix-rich stem structure (HA2). Cleavage is essential for virus infectivity (Klenk et al., 1975) and generation of the short hydrophobic N-terminus of HA2, the fusion peptide (Skehel and Waterfield, 1975). Certain molecular changes in the haemagglutinin have been shown to affect the pathogenicity of some types of influenza viruses (Goto and Kawaoka, 1998; Goto et al., 2001; Hatta et al., 2001; Perdue and Suarez, 2000; Seo et al., 2002; Subbarao et al., 1998; Walker and Kawaoka, 1993). Therefore, the HA gene is a prime candidate for being the cause of the features associated with the pathogenicity reported for the 1918 influenza virus. Overall, the nucleotide and amino acid sequence data have revealed no unusual mutations in the 1918 HA gene (Reid et al., 1999), but post-translational events occurring during the transport and processing of the HA could influence functions of the protein (Banks and Plowright, 2003; Banks et al., 2001). Indeed, we have detected a change in a 1918 HA recovered from the lung sample of a London-based victim that maps in the vicinity of the receptor-binding site (Reid et al., 2003). This change has been shown to affect receptor-binding and may be associated with adaptation to the human host (Glaser et al., 2005). To further investigate potentially unique properties of the 1918 HA we expressed it using a recombinant vaccinia system both for X-ray crystallographic analysis (Gamblin et al., 2004) and biological and antigenic characterisation. In this report we present a study of the functions of the 1918 influenza HA and compare them to a panel of HAs isolated from ‘early’ influenza A H1N1 viruses which were first isolated from swine in 1930 and humans in 1933. In terms of expression, trypsin sensitivity, receptor-binding, fusogenicity and antigenicity, the 1918 HA was unremarkable compared to the HAs of other ‘early’ influenza A H1N1 viruses. 2. Materials and methods 2.1. Expression of influenza H1 HAs The HA gene for South Carolina/1/18 (SC/18) was made synthetically using 84 40-mer oligonucleotides (Stemmer et al., 1995). The HA genes from A/Swine/Iowa/15/30 (Sw/30), A/Swine/Iowa/1976/31 (Sw/31), A/Wilson Smith/33 (WS/33), A/Puerto Rico/8/34 (PR/34), A/Swine/Cambridge/39 (Sw/39),

and A/Fort Monmouth/1/47 (FM/47) were rescued from virus grown in the allantoic cavity of fertile hens’ eggs by RT-PCR using oligonucleotide primers SPHAF1V (AGCGATGCTAGC AGCAAAAGCAGGGGAAAATA Nhe I) and SPHAR20V (AGCGATAAGCTTAGTAGAAACAAGGGTGTTTTT Hind III). All HA genes were ligated into the vaccinia shuttle vector pRB21 using Nhe I and Hind III restriction sites, the ligations used to transform DH5␣ E. coli and resultant clones sequenced prior to being used in the production of recombinant vaccinia (Copenhagen strain) viruses (Blasco and Moss, 1995; Steinhauer et al., 1995). Recombinant vaccinia viruses were plaque purified twice in CV-1 cells before use in experiments (Steinhauer et al., 1995). To assess the expression of HAs, CV-1 cells were infected with recombinant vaccinia virus at a multiplicity of infection (moi) of 1. At 16 h post-infection cells were harvested, resuspended in 1 ml of phosphate-buffered saline (PBS) and centrifuged (6 K/30 s). Cell pellets were resuspended in 120 ␮l SDS-loading buffer (2% SDS, 62.5 mM Tris pH 6.8, 5% ␤mercaptoethanol, 0.1% bromophenol blue) and separated by polyacrylamide gel electrophoresis (PAGE). Western blotting was performed using anti-Sw/39 rabbit polyclonal serum diluted 1:1000, with HRP-labelled Protein A (Amersham Biosciences) secondary antibody diluted 1:2000. Blots were developed using Enhanced Chemiluminescence (ECL; Amersham Biosciences). 2.2. Proteolytic cleavage of influenza H1 HAs To estimate the trypsin cleavability of expressed HAs, CV-1 cells were infected with recombinant vaccinia virus at a moi of 1. At 16 h post-infection cells were washed with Dulbecco’s modified Eagle medium (DMEM; Invitrogen) and incubated with l-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)treated trypsin (5 ␮g/ml; Sigma) for 10 min at 37 ◦ C. Cells were then incubated with trypsin inhibitor (5 ␮g/ml; Sigma) for 10 min at 37 ◦ C, washed with PBS and cell lysates prepared. Lysates were analysed by PAGE and Western blot as described above. 2.3. Surface expression of influenza H1 HAs The expression of influenza HA on the surface of infected cells was determined by ELISA. Briefly, cells were grown in 96-well tissue culture plates and infected, moi of 1, with recombinant vaccinia virus. At 16 h post-infection, cells were washed with PBS and fixed with 0.25% glutaraldehyde. Cells were incubated with anti-Sw/39 rabbit polyclonal antibody diluted 1:1000, prepared in PBS, Tween (0.1%), non-fat milk (5%, w/v), for 1 h at 37 ◦ C. After washing four times with PBS Tween (0.05%) and blotting dry, cells were incubated with HRP-labelled Protein A secondary antibody diluted 1:2000, for 1 h at 37 ◦ C and washed as described above. Finally, cells were incubated with OPD (Sigma) substrate in the dark at room temperature; OD readings (450 nm) were taken after 15 min incubation. 2.4. Binding of influenza H1 HAs to human erythrocytes HeLa cells were grown in 24-well tissue culture plates and infected, moi of 1, with recombinant vaccinia virus. At 16 h

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

post-infection cells were washed twice with cell buffer (150 mM NaCl, 10 mM HEPES pH 7.4, 2 mM CaCl2 ) and treated with C. perfringens neuraminidase (30 mU; Roche) for 1 h at 37 ◦ C. Cell monolayers were washed with cell buffer then treated with TPCK-trypsin (2.5 ␮g/ml, 5 min, 37 ◦ C) followed by trypsin inhibitor (2.5 ␮g/ml, 5 min, 37 ◦ C). Human erythrocytes (1% haematocrit) were incubated with infected cell monolayers at 37 ◦ C for 15 min. Cells were extensively washed with cell buffer to remove unbound erythrocytes and fixed with 0.25% glutaraldehyde. The binding of erythrocytes was determined by simple microscopic observation of cell monolayers after fixing. 2.5. HA-mediated fusion of mammalian cells Membrane fusion assays were performed following a method described previously (Steinhauer et al., 1991). Briefly, BHK-21 cells were grown in 24-well plates and infected, moi of 1, with recombinant vaccinia virus. At 16 h post-infection, cells were washed with DMEM and incubated with 5 ␮g/ml TPCK-treated trypsin for 5 min at 37 ◦ C. Cells were then treated with low pH cell buffer (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2 , adjusted to a range of low pH with citrate) for 30 s, after which pH was returned to neutral. Cells were incubated in complete medium for 30 min at 37 ◦ C and the formation of heterokaryons observed using light microscopy. Heterokaryons were fixed with 0.25% glutaraldehyde and stained with 1% Toludine Blue (Sigma). 2.6. Antigenic characterisation of influenza H1 HAs Post-infection ferret antisera were raised against each virus studied by intranasal infection with 500 ␮l virus-containing allantoic fluid diluted to contain approximately 106 EID50 /ml. Sera were treated with receptor destroying enzyme (Vibrio cholerae; National Institute for Biological Standards and Controls) and haemagglutination inhibition tests (HI) performed with corresponding egg-grown virus to test the specificity of each serum (Kendal et al., 1982). To analyse the 1918 HA, an ELISA was developed that enabled antigenic analysis using vaccinia-expressed HA. Briefly, HeLa cells were grown in 96well mictotitre plates and infected with recombinant vaccinia viruses at a moi of 1. At 16 h post-infection, cells were washed with PBS and fixed with 0.05% glutaraldehyde at 4 ◦ C over night. After washing, cells were incubated with doubling dilutions of ferret antisera and incubated at 37 ◦ C for 1 h. Cells were then washed, incubated with anti-ferret IgG (1:500 dilution; Insight Biotech) for 1 h at 37 ◦ C and, following a final wash, incubated with OPD substrate according to manufacturer’s instructions (Sigma). Antibody binding was determined by OD measurements at 450 nm after 15 min incubation at room temperature. Controls used in the assay included non-infected and wild type vaccinia virus-infected cells. Reciprocal dilutions were made of each recombinant virus and two replicate wells infected; each assay was performed in duplicate to confirm the results. In analysing the results, OD values greater than twice the background OD measurement were classed as positive; endpoints were determined as the reciprocal dilution at which the

13

first positive OD value was recorded. To enable comparison with assays based on egg-grown viruses, results were presented in a format identical to the traditional HI assay. 3. Results 3.1. Recombinant vaccinia viruses express 1918 and early H1 influenza HAs in CV-1 cells Cell lysates were prepared from CV-1 cells infected with recombinant vaccinia viruses and separated by PAGE. Expression of HA was determined by Western blot using a polyclonal rabbit antisera raised against Sw/39. A band of approximately 75 kDa could be detected for all virus samples, corresponding to the predicted size of influenza HA0 (Fig. 1). Expression of HA0 was relatively constant for each vaccinia-expressed HA except Sw/31, for which expression levels appeared lower, despite all seven HA genes having open reading frames (Fig. 2). Cell lysates expressing the H1 HAs were incubated in the presence of TPCKtreated trypsin, which resulted in the cleavage of the precursor HA0 into two subunits of approximately 55 and 28 kDa, respectively, corresponding to the predicted sizes of HA1 and HA2 (Fig. 1). Bands corresponding to the HA2 subunit were detected by Western blot for each vaccinia expressed HA, but detection of bands corresponding to the HA1 subunit was more variable. Distinct bands were detected for SC/18, WS/33, and Sw/39, weak bands for Sw/30, PR/34 and FM/47, whilst HA1 was not detected for Sw/31. This probably reflects either antigenic or sequence differences between the HAs, particularly in the HA1 component, or differences in HA expression levels. Further, it was noted that for most HA species the HA0 precursor and HA1 subunit were present as ‘doublet bands’, possibly reflecting differences in post-translational glycosylation. When recombinant vaccinia infected CV-1 cell lysates were analysed by PAGE under non-reducing conditions, bands cor-

Fig. 1. Expression of 1918 and early H1 HAs in CV-1 cells. CV-1 cells were infected with the parental vaccinia virus (vRB12) and recombinant vaccinia viruses expressing particular HAs as indicated. Sixteen hours post-infection, cells lysates were prepared, resuspended in SDS-loading buffer (2% SDS, 62.5 mM Tris pH 6.8, 5% ␤-mercaptoethanol, 0.1% bromophenol blue) and separated by PAGE. Western blotting was performed using a 1:1000-dilution of rabbit anti-Sw/39 polyclonal serum, with HRP-labelled Protein A (Amersham Biosciences, 1:2000-dilution) secondary antibody. Blots were developed using ECL. To cleave the HA0 precursor into HA1 and HA2 subunits, cell were incubated with (+) 5 ␮g/ml trypsin, cell lysates prepared, and then analysed as described above.

14

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

Fig. 2. H1 haemagglutinin alignment. The seven HA genes cloned into pRB21 and used to generate recombinant vaccinia viruses were sequenced using a genewalking approach with ABI Big-dye kits and a MegaBACE 1000. Translation product sequences were aligned against the SC/18 sequence and a pretty print generated using GDE (Smith et al., 1994). All potential N-linked glycosylation sequons (NXS/T) are highlighted and identity to the SC/18 sequence (·) and gaps introduced to improve the alignment (−) are shown. For WS/33 and Sw/39, which do not haemadsorb human erythrocytes, shared positions of divergence from the SC/18 sequence are underlined.

responding to HA monomers, dimers and trimers could be seen (results not shown). The trimeric structure of the 1918 HA has been solved using protein extracted from the plasma membranes of recombinant vaccinia infected CV-1 cells (Gamblin et al., 2004). 3.2. Binding of human erythrocytes by 1918 and early H1 influenza HAs The receptor-binding of the influenza H1 HAs was studied by observing the binding of human erythrocytes to HeLa cells infected with recombinant vaccinia viruses (Table 1). Binding of erythrocytes to expressed HA was observed for SC/18, indicating that it has affinity for receptors on human cells, and other HA species, with the exceptions of WS/33 and Sw/39 for which no binding could be detected. Application of a cell surface expres-

sion ELISA assay (Steinhauer et al., 1995) confirmed that all HAs were present on HeLa cell surfaces (results not shown). Hence, other factors must have been responsible for the lack of binding of WS/33 and Sw/39 HAs to human erythrocytes. In this context, the two latter HAs differ at eight positions in HA1 compared to the other five and notably changes at positions 106 and 179 (Fig. 2) result in the removal and insertion of N-linked glycosylation sequons respectively in the vicinity of the receptor-binding pocket. 3.3. Membrane fusion characteristics of 1918 and early H1 influenza HAs The pH at which influenza HA mediates the fusion of cell membranes can vary and this property can have biological significance (Daniels et al., 1985). BHK-21 cells infected with

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

15

Table 1 Receptor-binding and cell membrane fusion mediated by influenza H1 HAs HAa

SC/1/18 Sw/30 Sw/31 WS/33 PR/8/34 Sw/39 FM/1/47 vRB12

Receptor-bindingb

+++ +++ +++ − +++ − +++ −

Fusion pHc pH 4.4

pH 4.6

pH 4.8

pH 5.0

pH 5.2

pH 5.4

pH 5.6

pH 5.8

No pH drop

− + − − + − ++ −

+ ++ − − + − ++ −

++ ++ − − ++ − +++ −

+++ +++ + − +++ − ++ −

− − − − − − − −

− − − − − − − −

− − − − − − − −

− − − − − − − −

− − − − − − − −

To assess receptor-binding of the HAs, the adsorption of human erythrocytes to HeLa cell monolayers expressing the indicated HA was monitored. Fusion was assessed using recombinant vaccinia virus infected BHK-21 cells. At 16 h post-infection, cells were incubated with 5 ␮g/ml TPCK-treated trypsin for 5 min at 37 ◦ C. Cells were then treated with low pH cell buffer (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2 , adjusted to a range of low pH with citrate) for 30 s, after which pH was returned to neutral. Cells were incubated at 37 ◦ C for 30 min. Formation of heterokaryons was observed using light microscopy. a Recombinant vaccinia virus expressing HA. b Haemadsorption (percentage of infected cell monolayer binding erythrocytes) was monitored by light microscopy: −, <10% binding; +, 10–40% binding; ++, 40–70% binding; +++, >70% binding. c The pH at which fusion (heterokaryon formation) of BHK-21 cells occurred: −, <10%; +, 10–40%; ++, 40–70%; +++, >70%.

recombinant vaccinia viruses were treated with TPCK trypsin and then exposed to a range of low pH buffers to trigger the conformational changes required to activate their fusogenic forms. Quantification of fusion was performed by a visual characterisation of the proportion of the available cell monolayer that had undergone heterokaryon formation. All vaccinia-expressed HAs mediated the fusion of BHK-21 cells at low pH except for Sw/39 and WS/33 HA, for which no fusion could be detected (Table 1). As for HeLa cells, a cell-surface ELISA showed significant expression of all HAs under study, including Sw/39 and WS/33, for recombinant vaccinia infected BHK-21 cells (results not shown). Therefore, other factors, probably relating to the lack of binding to human erythrocytes, were responsible for the negative fusion results for these two HAs. The pH at which the H1 HAs mediated the fusion of BHK-21 cells was relatively constant for the range of virus HAs tested here. The endpoint of fusion (the highest pH at which heterokaryon formation could be detected) for cells infected with vaccinia recombinants expressing SC/18, Sw/30, Sw/31, PR/34 and FM/47 HA was pH 5.0. For cells expressing SC/18, Sw/30 and PR/34, the highest levels of fusion occurred at the endpoint pH whilst cells expressing FM/47 had the highest levels of fusion at pH 4.8. 3.4. Antigenic properties of SC/18 HA compared to viruses isolated in 1930–1947 A panel of post-infection ferret antisera, raised against the early H1 influenza viruses studied here, was used to analyse the antigenic profiles of each parental virus (Table 2). Individual ferret antisera showed high reactivity titres to their homologous vaccinia-expressed HA with the exception of Sw/31, which produced a higher surface ELISA titre against Sw/30 HA. This probably reflects the low level expression of Sw/31 HA since the antiserum was equally effective in standard HI assays with Sw/30 and Sw/31 influenza viruses (Table 2) and the HAs of these two viruses show high homology (Fig. 2). Whilst a homol-

ogous antiserum was not available for SC/18, it’s HA showed the closest antigenic homology to the early swine viruses, namely Sw/30 (titre 320) and Sw/31 (titre 80); these results were similar to findings of a recently published antigenic analysis of the 1918 HA (Tumpey et al., 2004). Generally, ferret antisera showed specificity for either human or swine virus groups with the exception of the Sw/39 specific antiserum, which had surface ELISA titres of 80, 40 and 40 against WS/33, PR/34 and FM/47, respectively (Table 2). WS/33 and Sw/39 HAs were the Table 2 Antigenic characterisation of H1 HAs Ferret antisera Sw/30

Sw/31

WS/33

PR/34

Sw/39

FM/47

320 1280 160 80 <20 40 <20

80 1280 80 40 <20 80 <20

<20 <20 <20 320 80 160 <20

<20 <20 <20 80 2560 80 <20

<20 80 40 80 40 2560 40

<20 20 <20 80 40 40 160

Virus b Sw/30 >2560 Sw/31 >2560 WS/33 <20 PR/34 <20 Sw/39 160 FM/47 <20

>2560 2560 <20 <20 640 <20

<20 <20 1280 <20 40 80

<20 <20 40 >2560 <20 <20

80 80 20 <20 >2560 <20

<20 <20 <20 <20 <20 >2560

HAa SC/18 Sw/30 Sw/31 WS/33 PR/34 Sw/39 FM/47

HeLa cells were infected with recombinant vaccinia viruses. Sixteen hours postinfection cells were washed with PBS and fixed with 0.05% glutaraldehyde at 4 ◦ C over-night. After washing, cells were incubated with doubling dilutions of ferret antisera and incubated at 37 ◦ C for 1 h, then washed and incubated with anti-ferret IgG (1:500 dilution) for 1 h at 37 ◦ C. Following a final wash, OPD substrate was added and signal allowed to develop for 15 min prior to determining OD readings at 450 nm. a Recombinant vaccinia virus expressing HA. b Haemagglutination inhibition determined on turkey erythrocytes using egggrown virus. For both assays, homologous interactions are shown in bold type.

16

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

only ones recognised by all ferret antisera used in the current analysis. 4. Discussion The functions of influenza HA have been shown to affect virus pathogenicity (Goto and Kawaoka, 1998; Goto et al., 2001; Hatta et al., 2001; Perdue and Suarez, 2000; Seo et al., 2002; Subbarao et al., 1998; Walker and Kawaoka, 1993). In this study, we have investigated functions of the 1918 (SC/18) influenza HA. For this purpose, we produced recombinant vaccinia viruses that expressed the 1918 HA in mammalian cell culture and analysed certain characteristics of the glycoprotein. Results show that, when expressed in isolation from the other influenza gene products, the 1918 influenza HA is unremarkable in respect of expression levels, multimeric form, proteolytic processing, receptor-binding, membrane fusion and antigenic characteristics compared to HAs derived from early H1N1 viruses. However, the recent reconstruction of an influenza virus bearing all eight gene segments of the 1918 pandemic virus has demonstrated the importance of the HA in determining the high pathogenicity of that virus in the murine system (Tumpey et al., 2005). Our recombinant vaccinia studies were performed with the same 1918 HA gene product (Reid et al., 1999) and biochemical/biological analyses of the expressed HA revealed no unusual characteristics that could account for such high pathogenicity. This discrepancy illustrates the complex and as yet unknown nature of the interactions between the 1918 HA and the other gene products of the pandemic virus, which resulted in a highly virulent strain. Further research into these interactions is required to fully understand the nature of highly pathogenic influenza viruses with the potential to cause pandemics. Processing of influenza HA0 by trypsin-like proteases is essential for virus infectivity and the generation of the fusion peptide, a short hydrophobic sequence at the N-terminus of HA2 (Klenk et al., 1975; Skehel and Waterfield, 1975). Using a panel of influenza H1 HAs, we compared functions of the 1918 HA with HAs isolated from other influenza H1N1 viruses that circulated in humans or swine over the years/decades following the 1918 pandemic (1918–1947). In the absence of trypsin, H1 HAs were produced in the size range expected for HA0 precursors, and it was processed into HA1/HA2 when samples were incubated in the presence of the protease, although significant amounts of HA0 remained unprocessed, presumably representing intracellular protein that was not accessible to trypsin (Fig. 1). The sensitivity of SC/18 HA0 to trypsin cleavage was comparable to the HA0s of other H1 viruses. Previously published nucleotide sequence data show that the HA1/HA2 cleavage site of influenza viruses that circulated during the 1918/1919 pandemic did not contain any mutations that might have affected cleavage (Reid et al., 2003). Our results confirm this in respect of protein function. To assess the functions of the H1 HAs, expression of the proteins at mammalian cell surfaces was essential. We were able to detect HA at the surface of infected cells with the majority of the protein being in a trimeric form (results not shown). Indeed, the trimeric structures of SC/18 HA (purified from recombinant

vaccinia infected CV-1 cell membranes) and those of Sw/30 and PR/34 (purified from egg-grown influenza viruses) have been determined (Gamblin et al., 2004). Protein analysis by Western blotting was performed using a rabbit polyclonal antiserum raised against Sw/39. The HA2 subunit was detected for all cleaved HA species (Fig. 1) as might be expected since HA2 is not subject to significant immunological pressure and therefore does not undergo as much antigenic change as the HA1 subunit (Cox and Bender, 1995). In contrast, HA1 detection varied dependent on the HA species. As expected, the band of highest intensity detected by Western blot was for the homologous Sw/39 HA1 and the next most intense band was seen for SC/18 HA1, suggesting a higher degree of antigenic similarity between the SC/18 and Sw/39 viruses than between Sw/39 and either WS/33 or PR/34 (Fig. 1) although this is not obvious from sequence comparisons (Fig. 2). Whilst such detection differences may result from variable expression levels between the individual vaccinia recombinants, all recombinant viruses were plaque titrated, used to infect cells at a moi of 1 and incubated for the same period, so it is probable that the differences resulted from divergence in the antigenic properties of the HAs rather than experimental variation. The unusual antigenic properties of Sw/39 have been reported previously (Kanegae et al., 1994; Neumeier and Meier-Ewert, 1992; Neumeier et al., 1994), and phylogenetic analysis of the Sw/39 HA1 subunit places it close to the root of the human clade (Reid et al., 1999). Receptor-binding, the initial event in virus infection, is mediated by the HA and was analysed for the H1 HAs used in this study by monitoring binding to human erythrocytes (haemadsorption). Since sialylated glycolipids present on the infected cells could block the receptor-binding site thereby inhibiting binding to erythrocytes, recombinant vaccinia-infected cells used in receptor-binding experiments were treated with C. perfringens neuraminidase to remove any surface bound sialic acid on the effector cells. Whilst HA0 processing (Fig. 1) and cell surface expression of all HAs was confirmed by ELISA (data not shown), haemadsorption showed that all but those derived from WS/33 and Sw/39 were able to bind human erythrocytes (Table 1). These results support two recent studies in which the structures of the SC/18 HA and two early H1 HAs were solved by X-ray crystallography (Gamblin et al., 2004; Stevens et al., 2004). Overall, results from such studies demonstrate that although the 1918 HA retains amino acids characteristic of an avian HA, it can bind to human receptors suggesting a probable cause of transmission into the human population. Following cleavage of HA0 into HA1/HA2 and HA1 binding to cell surface sialic acid receptors, low pH treatment is required to induce the conformational changes in HA that trigger the extrusion of the HA2 fusion peptide and subsequent membrane fusion (Skehel and Wiley, 2000). All H1 HAs used in this study, with the exception of WS/33 and Sw/39, were able to mediate fusion of BHK-21 cells (Table 1). Both the pH endpoint of fusion and the pH at which optimal fusion occurred were relatively consistent between the different HA species. The failure of the WS/33 and Sw/39 recombinant vaccinia systems to initiate fusion was unexpected as both HAs were derived from infectious egg-grown viruses and expression exper-

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

iments had shown that both HAs were produced in mammalian cells and processed by trypsin into HA1/HA2 (Fig. 1), whilst surface expression of each HA had been confirmed by ELISA. Thus, prerequisite criteria for membrane fusion had been met. Proteases that cleave the HA1/HA2 processing site by removing the HA2 N-terminus glycine, e.g. bromelain and thermolysin, yield non-infectious viruses that cannot undergo fusion (Garten et al., 1981; Steinhauer et al., 1995). It is possible that the HA1/HA2 cleavage site of WS/33 and Sw/39 had undergone additional non-specific cleavage, removing the N-terminus glycine, thus preventing the protein from fusing adjacent cells but this seems unlikely as all seven HAs studied have identical sequences spanning the processing site and fusion peptide (Fig. 2). Thus it is more likely that alterations in receptor-binding account for the WS/33 and Sw/39 lack of fusion and the insertion of an N-linked glycosylation site at position 179 (Fig. 2), 165 in the H3-HA numbering system (Wilson et al., 1981), is probably significant. Carbohydrate in this position will pack against the receptorbinding site of an adjacent HA subunit in the trimeric complex resulting in partial occlusion of the site. The Trp at position 222 in the H3-HA structure prevents the carbohydrate attached to Asn 165 occluding the receptor-binding site. H1-HAs contain a highly conserved Lys at the 222 residue equivalent which would be less efficient at preventing such occlusion. An analysis of over 700 H1-HA sequences available in the database (http://www.flu.lanl.gov), derived from human, swine and avian hosts, showed possession of an Asn 165-linked carbohydrate to be a rare event suggesting that carbohydrate at this location is detrimental to H1-HA function. In contrast, the majority of post-1947 human isolates do possess N-linked sequons based on Asn 163. This probably reflects a method of avoiding antibody neutralization whilst preserving HA function (Abe et al., 2004; Schulze, 1997; Skehel et al., 1984). In comparison to the other HAs, Sw/31 HA generated low heterokaryon formation (Table 1). This probably reflects poor expression levels of this protein. Despite all expression experiments being performed with the same moi of recombinant vaccinia virus, there was evidence to suggest that the level of Sw/31 HA expression was poor in comparison to other HAs when using this system (Fig. 1). The haemagglutination inhibition (HI) assay (Kendal et al., 1982) is the traditional method for analysing the antigenic characteristics of influenza viruses. Since infectious 1918 influenza virus was not available to us, we adapted a cell-based ELISA (Steinhauer et al., 1995) to study the HAs produced by a recombinant vaccinia virus system. Cells were infected with recombinant viruses and, following overnight incubation, post-infection ferret antisera were used to detect the expressed HA. Signal was quantified by subsequent detection of HA-specific antibody using an anti-ferret IgG labelled with horseradish peroxidase. An advantage of using the ELISA-based system over HI is the removal of erythrocytes from the assay, since molecular changes occurring within the HA can alter a virus’s binding-specificity pattern for erythrocytes derived from different animal species thereby affecting the HI results (Ciappi et al., 1997; Medeiros et al., 2001; Nobusawa et al., 2000). Indeed, two of the HA species used in this study (WS/33 and Sw/39) did not bind human erythrocytes (Table 1) but were clearly reactive in the

17

surface ELISA and HI assays performed with turkey erythrocytes (Table 2). Given that both these viruses grew well in eggs, receptor-binding and fusion functions must have been intact, and since the HA gene sequences cloned into the recombinant vaccinia system were identical to those of the parental viruses, the lack of binding to human erythrocytes must be a species related phenomenon. In general, results from HI and ELISA were comparable; one exception was Sw/31, which had good HI titres but low ELISA titres. This may simply have been due to a relatively poor expression efficiency of the Sw/31 HA in the recombinant vaccinia system, as demonstrated in Fig. 1. Our ELISA results show that of the range of virus HAs tested, the 1918 HA most resembled Sw/30; there being little reactivity with ferret sera raised against later H1 viruses (Tumpey et al., 2004). This suggests, as supported by Fig. 2, that by the 1930s, the HA gene of the virus responsible for the 1918/1919 pandemic was not circulating in the human population, having been replaced by a drifted antigenic variant. Similar conclusions have been drawn from a study using recombinant influenza viruses carrying the SC/18 HA in HI assays and a range of H1N1 viruses spanning the period 1918–1999 (Tumpey et al., 2004). There is a void in our knowledge in regard to the human influenza viruses that circulated the world in the years preceding the 1918/1919 pandemic, and there are no data relating to the viruses that circulated from 1919 to 1933, when the first human influenza virus was isolated in London (Smith et al., 1933). It is likely that the virus responsible for causing the 1918/1919 pandemic either ran out of susceptible hosts, or lost some aspect of its infectiousness/virulence through mutation, thereby curtailing the morbidity/mortality associated with the main wave of the pandemic. To gain further understanding of the fate of the 1918 virus we need to determine nucleotide and amino acid sequence from influenza viruses that circulated over the years 1919–1933. We have access to FFPE lung tissue samples taken from patients who died from influenza at the Royal London Hospital. We plan to extract influenza RNA from these samples and amplify regions of the HA, notably the HA1 domain, for analysis. Acknowledgements We thank members of the Division of Virology, NIMR for provision of immunologic reagents and influenza viruses used in this study (D. Stevens, Dr. Y. Lin, V. Gregory and R. Gonsalves) and discussion of results emerging (Drs. S. Wharton and R. Russell). We also thank Alex Mann (Retroscreen Virology Ltd.) for providing the panel of hyperimmune ferret antisera. A.J.E. was supported by a grant from the Wellcome Trust. References Abe, Y., Takashita, E., Sugawara, K., Matsuzaki, Y., Muraki, Y., Hongo, S., 2004. Effect of the addition of oligosaccharides on the biological activities and antigenicity of influenza A/H3N2 virus hemagglutinin. J. Virol. 78, 9605–9611. Banks, J., Plowright, L., 2003. Additional glycosylation at the receptor binding site of the hemagglutinin (HA) for H5 and H7 viruses may be an adaptation to poultry hosts, but does it influence pathogenicity? Avian Dis. 47, 942–950.

18

A.J. Elliot et al. / Virus Research 122 (2006) 11–19

Banks, J., Speidel, E.S., Moore, E., Plowright, L., Piccirillo, A., Capua, I., Cordioli, P., Fioretti, A., Alexander, D.J., 2001. Changes in the haemagglutinin and the neuraminidase genes prior to the emergence of highly pathogenic H7N1 avian influenza viruses in Italy. Arch. Virol. 146, 963–973. Basler, C.F., Reid, A.H., Dybing, J.K., Janczewski, T.A., Fanning, T.G., Zheng, H., Salvatore, M., Perdue, M.L., Swayne, D.E., Garcia-Sastre, A., Palese, P., Taubenberger, J.K., 2001. Sequence of the 1918 pandemic influenza virus nonstructural gene (NS) segment and characterization of recombinant viruses bearing the 1918 NS genes. Proc. Natl. Acad. Sci. U.S.A. 98, 2746–2751. Blasco, R., Moss, B., 1995. Selection of recombinant vaccinia viruses on the basis of plaque formation. Gene 158, 157–162. Ciappi, S., Azzi, A., Stein, C.A., De Santis, R., Oxford, J.S., 1997. Isolation of influenza A(H3N2) virus with “O” → “D” phase variation. Res. Virol. 148, 427–431. Cox, N.J., Bender, C.A., 1995. The molecular epidemiology of influenza viruses. Semin. Virol. 6, 359–370. Daniels, R.S., Downie, J.C., Hay, A.J., Knossow, M., Skehel, J.J., Wang, M.L., Wiley, D.C., 1985. Fusion mutants of the influenza virus hemagglutinin glycoprotein. Cell 40, 431–439. Gamblin, S.J., Haire, L.F., Russell, R.J., Stevens, D.J., Xiao, B., Ha, Y., Vasisht, N., Steinhauer, D.A., Daniels, R.S., Elliot, A., Wiley, D.C., Skehel, J.J., 2004. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303, 1838–1842. Garten, W., Bosch, F.X., Linder, D., Rott, R., Klenk, H.D., 1981. Proteolytic activation of the influenza virus hemagglutin: The structure of the cleavage site the enzymes involved in cleavage. Virology 115, 361–374. Geiss, G.K., Salvatore, M., Tumpey, T.M., Carter, V.S., Wang, X., Basler, C.F., Taubenberger, J.K., Bumgarner, R.E., Palese, P., Katze, M.G., Garcia-Sastre, A., 2002. Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: the role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc. Natl. Acad. Sci. U.S.A. 99, 10736–10741. Glaser, L., Stevens, J., Zamarin, D., Wilson, I.A., Garcia-Sastre, A., Tumpey, T.M., Basler, C.F., Taubenberger, J.K., Palese, P., 2005. A single amino acid substitution in 1918 influenza virus hemagglutinin changes receptor binding specificity. J. Virol. 79, 11533–11536. Goto, H., Kawaoka, Y., 1998. A novel mechanism for the acquisition of virulence by a human influenza A virus. Proc. Natl. Acad. Sci. U.S.A. 95, 10224–10228. Goto, H., Wells, K., Takada, A., Kawaoka, Y., 2001. Plasminogen-binding activity of neuraminidase determines the pathogenicity of influenza A virus. J. Virol. 75, 9297–9301. Hatta, M., Gao, P., Halfmann, P., Kawaoka, Y., 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293, 1840–1842. Kanegae, Y., Sugita, S., Shortridge, K.F., Yoshioka, Y., Nerome, K., 1994. Origin and evolutionary pathways of the H1 hemagglutinin gene of avian, swine and human influenza viruses: cocirculation of two distinct lineages of swine virus. Arch. Virol. 134, 17–28. Kash, J.C., Basler, C.F., Garcia-Sastre, A., Carter, V., Billharz, R., Swayne, D.E., Przygodzki, R.M., Taubenberger, J.K., Katze, M.G., Tumpey, T.M., 2004. Global host immune response: pathogenesis and transcriptional profiling of type A influenza viruses expressing the hemagglutinin and neuraminidase genes from the 1918 pandemic virus. J. Virol. 78, 9499–9511. Kendal, A.P., Pereira, M.S., Skehel, J.J., 1982. Hemagglutination inhibition. In: Kendal, A.P., Pereira, M.S., Skehel, J.J. (Eds.), Concepts and Procedures for Laboratory-based Influenza Surveillance. Centers for Disease Control and Prevention and Pan American Health Organization, Atlanta GA, pp. B17–B35. Klenk, H.D., Rott, R., Orlich, M., Blodorn, L., 1975. Activation of influenza A viruses by trypsin treatment. Virology 68, 426–439. Kobasa, D., Takada, A., Shinya, K., Hatta, M., Halfmann, P., Theriault, S., Suzuki, H., Nishimura, H., Mitamura, K., Sugaya, N., Usui, T., Murata, T., Maeda, Y., Watanabe, S., Suresh, M., Suzuki, T., Suzuki, Y., Feldmann, H., Kawaoka, Y., 2004. Enhanced virulence of influenza A viruses with the haemagglutinin of the 1918 pandemic virus. Nature 431, 703–707. Krafft, A., Lichy, J.H., Lipscomb, T.P., Klaunberg, B.A., Kennedy, S., Taubenberger, J.K., 1995. Postmortem diagnosis of morbillivirus infection in bot-

tlenose dolphins (Tursiops truncatus) in the Atlantic and Gulf of Mexico epizootics by polymerase chain reaction-based assay. J. Wildl. Dis. 31, 410–415. Luk, J., Gross, P., Thompson, W.W., 2001. Observations on mortality during the 1918 influenza pandemic. Clin. Infect. Dis. 33, 1375–1378. Medeiros, R., Escriou, N., Naffakh, N., Manuguerra, J.C., van der Werf, S., 2001. Hemagglutinin residues of recent human A (H3N2) influenza viruses that contribute to the inability to agglutinate chicken erythrocytes. Virology 289, 74–85. Neumeier, E., Meier-Ewert, H., 1992. Nucleotide sequence analysis of the HA1 coding portion of the haemagglutinin gene of swine H1N1 influenza viruses. Virus Res. 23, 107–117. Neumeier, E., Meier-Ewert, H., Cox, N.J., 1994. Genetic relatedness between influenza A (H1N1) viruses isolated from humans and pigs. J. Gen. Virol. 75, 2103–2107. Nobusawa, E., Ishihara, H., Morishita, T., Sato, K., Nakajima, K., 2000. Change in receptor-binding specificity of recent human influenza A viruses (H3N2): a single amino acid change in hemagglutinin altered its recognition of sialyloligosaccharides. Virology 278, 587–596. Oxford, J.S., 2000. Influenza A pandemics of the 20th century with special reference to 1918: virology, pathology and epidemiology. Rev. Med. Virol. 10, 119–133. Perdue, M.L., Suarez, D.L., 2000. Structural features of the avian influenza virus hemagglutinin that influence virulence. Vet. Microbiol. 74, 77–86. Phillips, H., Killingray, D., 2003. The Spanish Influenza Pandemic of 1918–1919: New Perspectives. Routledge, London. Reid, A.H., Fanning, T.G., Hultin, J.V., Taubenberger, J.K., 1999. Origin and evolution of the 1918 “Spanish” influenza virus hemagglutinin gene. Proc. Natl. Acad. Sci. U.S.A. 96, 1651–1656. Reid, A.H., Fanning, T.G., Janczewski, T.A., Lourens, R.M., Taubenberger, J.K., 2004. Novel origin of the 1918 pandemic influenza virus nucleoprotein gene. J. Virol. 78, 12462–12470. Reid, A.H., Fanning, T.G., Janczewski, T.A., McCall, S., Taubenberger, J.K., 2002. Characterization of the 1918 “Spanish” influenza virus matrix gene segment. J. Virol. 76, 10717–10723. Reid, A.H., Fanning, T.G., Janczewski, T.A., Taubenberger, J.K., 2000. Characterization of the 1918 “Spanish” influenza virus neuraminidase gene. Proc. Natl. Acad. Sci. U.S.A. 97, 6785–6790. Reid, A.H., Janczewski, T.A., Lourens, R.M., Elliot, A.J., Daniels, R.S., Berry, C.L., Oxford, J.S., Taubenberger, J.K., 2003. 1918 influenza pandemic caused by highly conserved viruses with two receptor-binding variants. Emerg. Infect. Dis. 9, 1249–1253. Schulze, I.T., 1997. Effects of glycosylation on the properties and functions of influenza virus hemagglutinin. J. Infect. Dis. 176, S24–S28. Seo, S.H., Hoffmann, E., Webster, R.G., 2002. Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat. Med. 8, 950–954. Simonsen, L., Clarke, M.J., Schonberger, L.B., Arden, N.H., Cox, N.J., Fukuda, K., 1998. Pandemic versus epidemic influenza mortality: a pattern of changing age distribution. J. Infect. Dis. 178, 53–60. Skehel, J.J., Stevens, D.J., Daniels, R.S., Douglas, A.R., Knossow, M., Wilson, I.A., Wiley, D.C., 1984. A carbohydrate side chain on hemagglutinins of Hong Kong influenza viruses inhibits recognition by a monoclonal antibody. Proc. Natl. Acad. Sci. U.S.A. 81, 1779–1783. Skehel, J.J., Waterfield, M.D., 1975. Studies on the primary structure of the influenza virus hemagglutinin. Proc. Natl. Acad. Sci. U.S.A. 72, 93– 97. Skehel, J.J., Wiley, D.C., 2000. Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu. Rev. Biochem. 69, 531–569. Smith, S.W., Overbeek, R., Woese, C.R., Gilbert, W., Gillevet, P.M., 1994. The genetic data environment an expandable GUI for multiple sequence analysis. Comput. Appl. Biosci. 10, 671–675. Smith, W., Andrewes, C.H., Laidlaw, P.P., 1933. A virus obtained from influenza patients. Lancet ii, 66–68. Steinhauer, D.A., Wharton, S.A., Skehel, J.J., Wiley, D.C., 1995. Studies of the membrane fusion activities of fusion peptide mutants of influenza virus hemagglutinin. J. Virol. 69, 6643–6651. Steinhauer, D.A., Wharton, S.A., Skehel, J.J., Wiley, D.C., Hay, A.J., 1991. Amantadine selection of a mutant influenza virus containing an acid-stable

A.J. Elliot et al. / Virus Research 122 (2006) 11–19 hemagglutinin glycoprotein: evidence for virus-specific regulation of the pH of glycoprotein transport vesicles. Proc. Natl. Acad. Sci. U.S.A. 88, 11525–11529. Stemmer, W.P., Crameri, A., Ha, K.D., Brennan, T.M., Heyneker, H.L., 1995. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene 164, 49–53. Stevens, L., Corper, A.L., Basler, C.F., Taubenberger, J.K., Palese, P., Wilson, I.A., 2004. Structure of the uncleaved human H1 hemagglutinin from the extinct 1918 influenza virus. Science 303, 1866–1870. Subbarao, K., Klimov, A., Katz, L., Regnery, H., Lim, W., Hall, H., Perdue, M., Swayne, D., Bender, C., Huang, J., Hemphill, M., Rowe, T., Shaw, M., Xu, X., Fukuda, K., Cox, N., 1998. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. Science 279, 393–396. Taubenberger, J.K., Reid, A.H., Krafft, A.E., Bijwaard, K.E., Fanning, T.G., 1997. Initial genetic characterization of the 1918 “Spanish” influenza virus. Science 275, 1793–1796.

19

Taubenberger, J.K., Reid, A.H., Lourens, R.M., Wang, R., Jin, G., Fanning, T.G., 2005. Characterization of the 1918 influenza virus polymerase genes. Nature 437, 889–993. Tumpey, T.M., Basler, C.F., Aguilar, P.V., Zeng, H., Solorzano, A., Swayne, D.E., Cox, N.J., Katz, J.M., Taubenberger, J.K., Palese, P., Garcia-Sastre, A., 2005. Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science 310, 77–80. Tumpey, T.M., Garcia-Sastre, A., Taubenberger, J.K., Palese, P., Swayne, D.E., Basler, C.F., 2004. Pathogenicity and immunogenicity of influenza viruses with genes from the 1918 pandemic virus. Proc. Natl. Acad. Sci. U.S.A. 101, 3166–3171. Walker, J.A., Kawaoka, Y., 1993. Importance of conserved amino acids at the cleavage site of the haemagglutinin of a virulent avian influenza A virus. J. Gen. Virol. 74, 311–314. Wilson, I.A., Skehel, J.J., Wiley, D.C., 1981. Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3 A resolution. Nature 289, 366–373.