Functional characterization of P-glycoprotein in the intertidal copepod Tigriopus japonicus and its potential role in remediating metal pollution

Aquatic Toxicology 156 (2014) 135–147

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Functional characterization of P-glycoprotein in the intertidal copepod Tigriopus japonicus and its potential role in remediating metal pollution Chang-Bum Jeong a,1 , Bo-Mi Kim b,1 , Rae-Kwon Kim a , Heum Gi Park c , Su-Jae Lee a , Kyung-Hoon Shin d , Kenneth Mei Yee Leung e , Jae-Sung Rhee f,∗ , Jae-Seong Lee b,∗∗ a

Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746, South Korea c Department of Marine Resource Development, College of Life Sciences, Gangneung-Wonju National University, Gangneung 210-702, South Korea d Department of Marine Sciences and Convergent Technology, College of Science and Technology, Hanyang University, Ansan 426-791, South Korea e School of Biological Sciences and the Swire Institute of Marine Science, The University of Hong Kong, Poklam Road, Hong Kong, China f Department of Marine Science, College of Natural Sciences, Incheon National University, Incheon 406-772, South Korea b

a r t i c l e

i n f o

Article history: Received 27 June 2014 Received in revised form 7 August 2014 Accepted 10 August 2014 Available online 19 August 2014 Keywords: P-glycoprotein Copepod Tigriopus japonicus Metal Pollution

a b s t r a c t The intertidal copepod Tigriopus japonicus has been widely used in aquatic toxicity testing for diverse environmental pollutants including metals. Despite relatively well-characterized in vivo physiological modulations in response to aquatic pollutants, the molecular mechanisms due to toxicity and detoxification are still unclear. To better understand the mechanisms of metal transport and further detoxification, T. japonicus P-glycoprotein (TJ-P-gp) with conserved motifs/domains was cloned and measured for protein activity against the transcript and protein expression profiles in response to metal exposure. Specifically, we characterized the preliminary efflux activity and membrane topology of TJ-P-gp protein that supports a transport function for chemicals. To uncover whether the efflux activity of TJ-P-gp protein would be modulated by metal treatment, copepods were exposed to three metals (Cd, Cu, and Zn), and were observed for both dose- and time-dependency on the efflux activity of TJ-P-gp protein with or without 10 ␮M of P-gp-specific inhibitors verapamil and zosuquidar (LY335979) for 24 h over a wide range of metal concentrations. In particular, treatment with zosuquidar induced metal accumulation in the inner body of T. japonicus. In addition, three metals significantly induced the transporting activity of TJ-P-gp in a concentration-dependent manner in both transcript and protein levels within 24 h. Together these data indicate that T. japonicus has a conserved P-gp-mediated metal defense system through the induction of transcriptional up-regulation of TJ-P-gp gene and TJ-P-gp protein activity. This finding provides further understanding of the molecular defense mechanisms involved in P-glycoprotein-mediated metal detoxification in copepods. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Metals have been used extensively in anthropogenic activities for thousands of years, and some metals are considered to be highly toxic environmental pollutants. Although adverse effects of metals have been recognized for a long time, a major problem is their potential for bioaccumulation and biomagnification due to their

∗ Corresponding author. ∗∗ Corresponding author. Tel.: +82 31 290 7011. E-mail addresses: [email protected] (J.-S. Rhee), [email protected] (J.-S. Lee). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.aquatox.2014.08.005 0166-445X/© 2014 Elsevier B.V. All rights reserved.

persistence (Rainbow, 2007). Moreover, the release of metals into the marine environment causes complications and ecotoxicological effects that are difficult to understand (Meria, 1991). In the aquatic environment, many organisms bioaccumulate metals through passive or facilitate uptake from the water and their diet. Thus, aquatic organisms, particularly those in water bodies receiving sewage discharges and/or surface runoff, may suffer from detrimental, toxic effects from exposure to high concentrations of assorted metals (Rainbow, 2007). In living organisms with an excessive uptake of a metal, the metal can accumulate, metabolize, and be excreted by cells or tissues (Rainbow, 2007). Toxic mechanisms of metals have different targets such as damage to plasma membranes, direct binding to

136

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

phospholipids and proteins, inhibition of ATPases and enzymes, lipid peroxidation, and DNA damage through the generation of reactive oxygen species (Stohs and Bagchi, 1995; Valko et al., 2005). The induction of metallothionein (MT) gene/protein, which can contribute to storage or detoxification of metals through binding to metals, is the best-characterized modulator of metal exposure (Klaassen et al., 1999). With the involvement of MT protein in resistance against metal exposure, the role of the ATP-binding cassette (ABC) transporter superfamily was also indicated in metal toxicity in terms of their cellular functions related to efflux and resistance against metal exposure in vertebrates (Endo et al., 2002; HuynhDelerme et al., 2005; Della Torre et al., 2012; Drobná et al., 2010; Long et al., 2011; Thevenod, 2010). Of eight distinct subfamilies of ABC transporters (A–H), P-glycoprotein (permeability glycoprotein, P-gp) is a drug efflux transporter of the ABCB subfamily that is involved in the mechanism of multidrug resistance and accumulation of chemicals. Previous studies suggest that P-gp has an important function in cellular efflux and intracellular resistance to metals in aquatic vertebrates and invertebrates (Broeks et al., 1996; Achard et al., 2004; Ivanina and Sokolova, 2008; Boˇsnjak et al., 2009; Venn et al., 2009; Zucchi et al., 2010). However, the protective role of P-gp still remains unclear and controversial in aquatic animals, while the efflux role of P-gp has been suggested as a biomarker for metal response. Since metals are widespread contaminants of aquatic environments, relevant studies should continue in order to better understand the role of P-gp in metal efflux or resistance to metal exposure. To date, multidrug resistance (MDR) transport activity is characterized in aquatic animals (Kurelec, 1992; Epel, 1998; Smital and Kurelec, 1998; Hamdoun et al., 2004). Particularly, transporting activity in response to cellular products and xenobiotics including metals has been extensively studied in sea urchin Strongylocentrotus purpuratus (Hamdoun et al., 2002, 2004; Boˇsnjak et al., 2009; Gökirmak et al., 2012; Cole et al., 2013). In addition, the gill tissue of the Asiatic clam Corbicula fluminea exhibited elevated levels of P-gp protein in response to metal (Cd, Cu, Hg, and Zn) exposures that was supported by field transplantation experiments of metal (Cd and Zn)-contaminated sites (Achard et al., 2004). Also the induced P-gp protein is the best endpoint of the xenobiotic-resistant phenotype for Cd pollution in the Eastern oyster Crassostrea virginica (Ivanina and Sokolova, 2008). In the Antarctic fish Trematomus bernacchii, the P-gp (e.g. ABCB1) gene has an important role in Cd exposure-triggered cellular detoxification among 5 ABC transporters (ABCB1, ABCC1, ABCC2, ABCC4, and ABCC9) based on its transcript profile and protein expression (Zucchi et al., 2010). The intertidal copepod Tigriopus japonicus as a potential model invertebrate in marine ecosystems has been known to show many promising advantages for ecotoxicology and environmental research (Raisuddin et al., 2007). With recently sequenced genomic DNA information (10,894 unigenes) and RNAseq (59,983 assembled ESTs; total length 78.3 Mb; N50 = 2319) from T. japonicus (Lee et al., 2010; unpublished data), diverse molecular mechanisms have been unveiled in this model copepod species in response to environmental changes (Kim et al., 2013). Reliable molecular biomarkers have been characterized which will allow for a better understanding of their tolerance and adaptation mechanisms during and after exposure to the selected metals (Rhee et al., 2009; Kim et al., 2011; Rhee et al., 2013). The present study primarily aims to identify and characterize the P-gp gene in T. japonicus, and analyzes in vivo activities and transcript profiles of three metal-mediated P-gp gene/protein modulations. Particularly, we examined whether metal contamination could modulate P-gp activities and mRNA/protein expression, and evaluated if P-gp could serve as a metal transporter for further detoxification and metabolism in T. japonicus. These results provide

new insight into the involvement of P-gp gene/protein in T. japonicus and its metal-mediated cellular stress response and protection mechanisms. 2. Materials and methods 2.1. Culture and maintenance The copepod T. japonicus was originally collected from a single rockpool at Haeundae beach (35◦ 9 29.57 N, 129◦ 9 36.60 E) in Busan (South Korea) in 2003; since then, we have continuously cultured them in a laboratory (the number of generation times ≈ 285; Sungkyunkwan University, Suwon, South Korea) with filtered artificial sea water (TetraMarine Salt Pro, TetraTM , Cincinnatti, OH, USA) adjusted to 25 ◦ C and a photoperiod of 12 h:12 h light/dark with a salinity of 30 practical salinity units (psu). The copepods were fed green algae Chlorella spp. (approximately 6 × 104 cells/ml). Identification of the species was made by morphological characteristics and the sequence identity of the universal life barcode marker, mitochondrial DNA cytochrome oxidase 1 (COI) (Jung et al., 2006). 2.2. Retrievement and annotation of P-gp gene from the intertidal copepod, T. japonicus genomic DNA database To obtain the copepod T. japonicus P-gp (TJ-P-gp) gene, we searched the T. japonicus genomic DNA database that was constructed in our previous study (Lee et al., 2010) with an internal local BLAST using BioEdit software (ver. 7.09). The obtained contigs and clones were subjected to BLASTX analysis in the NR database at GenBank. Subsequently, the TJ-P-gp gene was subjected to 5 and 3 -Rapid Amplification of cDNA Ends (RACE) to obtain the full length cDNAs according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). A series of RACE was performed with specific primers (Table 1) under the following conditions: 94 ◦ C/4 min; 40 cycles of 98 ◦ C/25 s, 55 ◦ C/30 s, 72 ◦ C/60 s; and 72 ◦ C/10 min. We also attempted to include the promoter region of TJ-P-gp gene using the Genome-walking kit according to the manufacturer’s protocol (SeeGene, Seoul, South Korea). The final PCR products were isolated from 1% agarose/TBE gel, cloned into pCR2.1 TA vectors (Invitrogen, Carlsbad, CA, USA) and sequenced with an ABI PRISM 3700 DNA analyzer (Bionics Co., Seoul, South Korea). The sequence of the promoter region of TJ-P-gp gene was analyzed with Genetyx software (ver. 7.0). 2.3. Amino acid comparison and topology prediction Multiple alignments of the P-gp genes between the copepod and human were performed using ClustalX software (ver. 1.83) at the level of deduced amino acid sequences. Domains and motifs were identified based on a previous report (Ambudkar et al., 2006). The membrane protein topology prediction was analyzed using the web-based software, TopPred (ver. 0.01) (http://mobyle.pasteur.fr). 2.4. Phylogenetic analysis To place the identified TJ-P-gp in the phylogenetic tree, we aligned them with those of other species at the level of the deduced amino acid sequence by ClustalX software (ver. 1.83). Gaps and missing data matrices were excluded from the analysis. The generated data matrix was converted to nexus format, and the data matrix was analyzed with Mr. Bayes program (ver. 3.1.2) using the general time-reversible (GTR) model incorporating invariable sites and a gamma distribution of rates across sites. A total of 1,000,000 generations were conducted, and the sampling frequency was assigned every 100 generations. After analysis, the first 10,000

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

137

Table 1 List of primers used in this study. Gene

Oligo name

Sequence (5 → 3 )

Amplicon size (bp)

Remarks

TJ-P-gp

5GSP1 5GSP2 3GSP1 3GSP2 GW-1 GW-2 Real-time RT-F Real-time RT-R Real-time RT-F Real-time RT-R

CAAACGTGTTAGCCAAGTCAC AAGAGCCGATGAATGGCC CGTTGGGCACTCTGTTCC CGGTTTTCATCCCCTTCG CCGCCACAATTGCCAAGAAAATCAGG CATTGTCCTTGGCTTCTTTCTCAGGTTC ATGCATGTTCTATGGCGG AGCCTTGTTGTAGTTGGGAG TCGGGCTGTCTCGTTCGTGATTC TGCCACAGTCGACAGTTGATAGG

348 229 1451 1361 561 623 139

5 -RACE

18S rRNA

generations were deleted as the “burn-in process”, and the consensus tree was constructed and visualized with Tree View software, PHYLIP.

2.5. Accumulation/efflux experiments In accumulation and efflux experiments, two potent P-gp inhibitors were used to confirm the transport activity of the TJP-gp protein. Verapamil is known to inhibit P-gp via its two planar aromatic domains with three hydrogen bond acceptor groups and one hydrogen bond donor group (Palmeira et al., 2012; Liu et al., 2013). Zosuquidar trihydrochloride (LY335979) is known as the most specific P-gp inhibitor based on both in vitro assay and in silico analysis (Dantzig et al., 2001; Liu et al., 2013) but is not a modulator of the ABCC subfamily proteins such as MRP1 and MRP2 (Dantzig et al., 2001). Overall methods for the accumulation and efflux experiment followed protocols described in previous studies with minor modifications (Cornwall et al., 1995; Rhee et al., 2012). Although verapamil has been used as a P-gp-specific model inhibitor, recent controversial reports suggested its non-specificity as a flexible tertiary structure in P-gp domains. Therefore, to confirm the verapamil-mediated accumulation/efflux activity of TJ-P-gp protein described by previous studies, we also employed another model inhibitor, zosuquidar trihydrochloride, that is selective for P-gp and does not modulate MRP1 (ABCC1) and MRP2 (ABCC2) (Dantzig et al., 2001; Kemper et al., 2004; Tang et al., 2008). Exposure concentration of both inhibitors was limited as 10 ␮M based on in vitro application levels (1–5 ␮M), although no acute toxicity was observed at 40 ␮M for 96 h. Efflux was measured with rhodamine fluorescence flown out from the copepod body, and accumulation was analyzed by rhodamine fluorescence in inside of copepod whole body. Live copepods (n ≈ 300 in 500 ml) were treated with 4 ␮M rhodamine B (Sigma–Aldrich, Inc., St. Louis, MO, USA; purity > 99%) with or without 10 ␮M of the two P-gp inhibitors, verapamil (Sigma–Aldrich, Inc., St. Louis, MO, USA) and zosuquidar trihydrochloride (LY335979; Selleckchem, Huston, TX, USA) for 2 h. For the control group, 0.01% dimethylsulfoxide (DMSO; Sigma–Aldrich, Inc., St. Louis, MO, USA) was used. No acute toxicity was observed at the treatment level of 50 ␮M rhodamine exposure for 96 h. The exposed copepods were washed three times with 100 ml of phosphate-buffered saline (PBS; 10 mM sodium phosphate, pH 7.6) and transferred to 10 ml of fresh artificial seawater (30 psu) in a 15 ml tube. Then, the values of fluorescent dye (rhodamine B) excreted from copepods were measured at 30, 60, 90, and 120 min using Varioskan Flash (Thermo Electron Corporation) over a calibration curve of pure rhodamine B (excitation 535 nm; emission 590 nm). Data were represented using Relative Fluorescence Unit (RFU). Accumulation was analyzed in the copepod whole body with the same experimental flow of efflux measurements. Results were presented using percentage (%) of RFU. The measured values were normalized on the basis of protein quantity from copepods in each

105

3 -RACE Genome-walking Real-time PCR amplification 18S rRNA real-time PCR amplification

sample, fluorescence of the blank well, and the control sample. Total proteins were determined using the Bradford method (Bradford, 1976). 2.6. Metal exposure To analyze the effects of metals on TJ-P-gp activity with or without 10 ␮M of verapamil and zosuquidar, copepods were exposed to three metals (cadmium, Cd; copper, Cu; zinc, Zn). No mortality was observed in copepods exposed to 10–40 ␮M of verapamil and zosuquidar for 96 h (data not shown). All the chemicals were purchased from Sigma (Sigma–Aldrich, Inc., St. Louis, MO, USA; purity > 99%). The stock solutions of metals were prepared in ultrapure water. The exposed concentrations of environmental toxicants were based on our previous studies from the no observed effect concentration (NOEC) results, LC10 , and LC50 of T. japonicus (Lee et al., 2007; Rhee et al., 2009). The highest concentration to which copepods were exposed was less than one tenth of the NOEC value for each metal; Cd (as CdCl2 , 10, 100, 1000 ␮g/L; equivalent to 8.9 nM, 89 nM, 890 nM, 8.9 ␮M), Cu (as CuCl2 , 10, 100, 1000 ␮g/L; equivalent to 15.7 nM, 157 nM, 1.57 ␮M, 15.7 ␮M), and Zn (as ZnCl2 , 10, 100, 1000 ␮g/L; equivalent to 15.3 nM, 153 nM, 1.53 ␮M, 15.3 ␮M). The exposures lasted for 24 h under static conditions. The exposed copepods were washed three times with 100 ml of PBS (10 mM sodium phosphate, pH 7.6), and were treated with 4 ␮M rhodamine B with or without 10 ␮M of verapamil and zosuquidar for 2 h. After three additional washings, each group was sampled at 0, 30, 60, 90, and 120 min to examine the temporal profile of activity changes in the TJ-P-gp protein. The fluorescence of rhodamine B was measured as previously described. Three replicates were used for each concentration with approximately 300 adult copepods (including both sexes) in each container (500 ml). To understand whether an inhibitor would affect metal toxicity, acute toxicity for 96 h was conducted as described in our previous study (Lee et al., 2007). Briefly, 10 newly-hatched nauplii (<24 h after hatching) per concentration were transferred to 12-well tissue culture plates (SPL Life Sciences, Seoul, South Korea) with a 4 ml working volume in three replicates (total 30 nauplii). After exposure to each metal, the acute toxicity value of the inhibitor-pretreated copepods was determined for 96 h at room temperature (RT). Test solutions were renewed (50% of the working volume) daily and the green algae Chlorella sp. (approximately 6 × 104 cells/ml) were added. Acute toxicity value was calculated using Probit analysis and compared with the value of inhibitor-free copepods. 2.7. Metal accumulation analysis with metal-responsive fluorophores To understand the modulatory effect of the P-gp-specific inhibitor, zosuquidar trihydrochloride, on metal accumulation in the whole bodies of T. japonicus, real-time-accumulated patterns

138

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

for each metal were analyzed with metal-responsive fluorophores such as LeadmiumTM Green AM Dye (490 nm excitation and 520 nm emission wavelengths; Molecular Probes® , Invitrogen detection technologies, Carlsbad, CA, USA) for Cd, Phen GreenTM FL Diacetate (490 nm excitation and 520 nm emission wavelengths; Molecular Probes® , Invitrogen detection technologies, Carlsbad, CA, USA) for Cu, and Newport GreenTM PDX Acetoxymethyl Ether (495 nm excitation and 520 nm emission wavelengths; Molecular Probes® , Invitrogen detection technologies, Carlsbad, CA, USA) for Zn using a fluorescent microscope (Olympus IX71) with the appropriate fluorescent filter. Entire results were represented using RFU. Essentially, the calcium-insensitive LeadmiumTM Green AM Dye becomes fluorescent in the presence of micromolar levels of cadmium. A stock solution was prepared by adding DMSO (50 ␮l) to one vial of dye and the working solution was prepared in 0.85% of NaCl (1:10). In the case of Phen GreenTM FL Diacetate, it fluoresces if it is not bound by copper. Particularly, the dye is quenched by both Cu+ and Cu2+ and has a lesser reactivity with iron. The resulting florescence quenching was analyzed as a decrease in the fluorescence signal in each experiment. Stock and working solutions were prepared in DMSO. In the case of Newport GreenTM PDX indicator, an increase in fluorescence emission is exhibited by binding intracellular-free Zn. All fluorescent dyes were protected from light during the entire experiment. Experiments were followed by the manufacturer’s instructions with minor modification. Thirty copepods were exposed to each metal at 100 ␮g/L for 24 h. After the exposure, copepods were transferred to clean ASW with or without 10 ␮M zosuquidar trihydrochloride and were incubated for 6 h in dark condition to allow copepods to release accumulated metal. After the incubation, copepods were washed with 0.01 M EDTA to remove the extracellular metal and were incubated in clean ASW with 1 ␮g/L LeadmiumTM Green or 1 ␮M Newport GreenTM PDX Acetoxymethyl Ether or 2 ␮M Phen GreenTM FL Diacetate for 30 min. Finally copepods were washed with DW and fixed with 3% formaldehyde. Subsequently, they were placed on a glass slide to observe their fluorescence. 2.8. Total RNA extraction and single-strand cDNA synthesis Pooled whole bodies (≈500) were homogenized in three volumes of TRIZOL® reagent (Invitrogen, Paisley, Scotland) with a tissue grinder and stored at −80 ◦ C until use. Total RNA was isolated from the tissues according to the manufacturer’s instructions. Genomic DNA was removed using DNase I (Sigma, St. Louis, MO, USA). The quantity of total RNA was measured at 230, 260, and 280 nm using a spectrophotometer (Ultrospec 2100 pro, Amersham Bioscience, Freiburg, Germany). To check the genomic DNA contamination, we loaded the total RNA in a 1% agarose gel that contained ethidium bromide (EtBr) and visualized the gel on a UV transilluminator (Wealtec Corp., Sparks, NV, USA). In addition, to verify the total RNA quality, we loaded total RNA in a 1% formaldehyde/agarose gel with EtBr staining and checked the 18/28S ribosomal RNA integrity and band ratio. Concentration of total RNAs in each sample was measured using a spectrophotometer (Ultrospec 2100 pro, Amersham Bioscience, Freiburg, Germany). Single-stranded cDNA was synthesized from the 2 ␮g/L of total RNA using an oligo(dT)20 primer for reverse transcription (SuperScriptTM III RT kit, Invitrogen, Carlsbad, CA, USA). 2.9. mRNA expression induced by metal exposure To check the dose-dependent effects of different metals on TJ-Pgp mRNA expression, we set several concentration ranges (1, 10, 100, and 1000 ␮g/L) within the range of the NOEC values. During exposure (24 h), we did not feed copepods in the static culture condition. Three replicates were used for each concentration with

approximately 500 adult copepods in each container. To check mRNA expression of TJ-P-gp in time-course, we exposed the fixed concentration (100 ␮g/L) of metals to copepods over time (0, 3, 6, 12, and 24 h). The concentration (100 ␮g/L) was pre-determined based on the dose–response results. 2.10. Real-time reverse transcriptase-polymerase chain reaction (real-time RT-PCR) Significant transcript changes were analyzed by real-time RTPCR using primers for TJ-P-gp designed after comparing the exon/intron boundaries with genomic DNA using GENRUNNER software (Hastings Software, Inc., NY, USA) confirmed with the Primer 3 program (Whitehead Institute for Biomedical Research, Cambridge, MA, USA). Primer efficiency was calculated with the slope of the standard curve plot for each gene in a 7-fold dilution series. The slope values were −3.2567 for 18S rRNA gene (efficiency: 102%) and −3.351 for the TJ-P-gp gene (efficiency: 98%), respectively. To determine the amplicon identity, all the PCR products were cloned into a pCR2.1 TA vector, and sequenced with an ABI 3700 DNA analyzer (Bionics Co., Seoul, South Korea). Conditions were optimized according to the CFX96TM real-time PCR protocol (Bio-Rad, Hercules, CA, USA). For real-time RT-PCR amplification, each reaction consisted of 1 ␮␭ of cDNA that had been reverse transcribed from 2 ␮g of total RNA and 0.2 ␮M each of real time RT-F/R and reference gene primers for 18S rRNA RT-F/R (Table 1). All the real-time RT-PCR was carried out in an unskirted, low 96-well clear plate (Bio-Rad, Hercules, CA, USA). The reaction conditions were 94 ◦ C/4 min; 35 cycles of 94 ◦ C/30 s, 55 ◦ C/30 s, 72 ◦ C/30 s; and 72 ◦ C/10 min. SYBR® Green (Molecular Probe Inc., Invitrogen) was used to detect the specific amplified products. To confirm the amplification of the specific products, cycles continued to check the melting curve under the following conditions: 95 ◦ C/1 min, 55 ◦ C/1 min, and 80 cycles of 55 ◦ C/10 s with a 0.5 ◦ C increase per cycle. All the PCR products were sequenced at Bionics Co. (Seoul, South Korea). Amplification and detection of the SYBR Green-labeled products were performed using the CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA). Data from the triplicate independent experiments using the same DNA sample were expressed relative to the 18S rRNA that had been used to normalize for any difference in the reverse transcriptase efficiency. The fold change for the relative gene expression was determined by the 2−CT method (Livak and Schmittgen, 2001). 2.11. Western blot analysis Overall Western blot method for analyzing P-gp protein expression was described previously (Rhee et al., 2013). After copepods were exposed to 10, 100, and 1000 ␮g/L of metals for 24 h, whole bodies of copepods (≈700 adult copepods) were homogenized for protein extraction in lysis buffer (40 mM Tris–HCl (pH 8.0), 120 mM NaCl, 0.1% Nonidet-P40) containing a complete protease inhibitor cocktail (Roche, NY, USA). Proteins were separated by 12% SDSPAGE, and transferred to a nitrocellulose membrane (Amersham, Arlington Heights, IL, USA). The membrane was blocked with 5% non-fat dry milk in Tris-buffered saline, and incubated with a mouse MDR1 monoclonal antibody (C219; Novus Biologicals, Littleton, CO, USA) overnight at 4 ◦ C. The C219 antibody recognizes internally specific and highly conserved amino acid sequences, VQAALD and VQEALD, corresponding with the N- and C-terminal regions of P-glycoprotein (Georges et al., 1990). We observed these amino acid sequences, 622 VQAALD627 and 1304 VQEALD1309 in TJP-gp protein, and revealed that the C219 antibody could strongly bind to the specific epitopes of TJ-P-gp protein. The C219 antibody stained a protein with a range from 145 to 150 kD in T. japonicus, in both control and metal-exposed groups. The blot was

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

2.12. Statistical analysis The SPSS ver. 17.0 (SPSS Inc., IL, USA) software package was used for statistical analysis. Data are expressed as mean ± S.D. Significant differences between the observations of the control and the exposed groups were analyzed using Student’s paired t-test and one-way and/or multiple-comparison ANOVA followed by Tukey’s test. Any difference showing P < 0.05 was considered significant.

A) Rhodamine fluorescence (RFU)

developed with a peroxidase-conjugated secondary antibody, and proteins were visualized by enhanced chemoluminescence (ECL) procedures (Amersham, Arlington Heights, IL, USA) according to the manufacturer’s protocol.

139

50

Control Ver 2 M Ver 4 M Ver 10 M

40

c

c

30

c

20 c

c

To confirm the topology of the TJ-P-gp as a membrane protein, we analyzed the hydrophobicity and conformational parameters of the TJ-P-gp amino acid sequence in comparison to the human P-gp protein. TJ-P-gp has a conserved structure, consisting of two transmembrane (TM) domains, which contain six TM segments and two nucleotide-binding domains (Fig. S5). 3.3. Accumulation/efflux experiment of TJ-P-gp in live copepods The function of the TJ-P-gp protein was characterized using an accumulation/efflux assay with fluorescent dye and two model P-gp

a

b

a

a

0

Rhodamine fluorescence (RFU)

B)

3.2. Topology of TJ-P-gp

b

a

30

60 90 Exposure time (min)

120

50

Control ZSQ 2 M ZSQ 4 M ZSQ 10 M

40

c c c

30 c

b

c

20

b

c b b

10

ab

a a

b

a a

0

30

60 90 Exposure time (min)

120

C) Rhodamine fluorescence (% of RFU)

The full-length cDNA of the P-gp gene in T. japonicus was completely sequenced and deposited at GenBank (Accession No. JX457337). The complete cDNA sequence of the TJ-P-gp gene was 4199 bp in length including 71 bp in 5 -untranslated region (UTR), 4023 bp in the open reading frame (ORF), and 105 bp in 3 -UTR with poly(A) signal sequence and poly(A) tail (Fig. S1). The ORF encoded a polypeptide of 1341 amino acids with a predicted molecular weight of 146.1 kDa and theoretical pI, 5.59. The promoter region of genomic sequence revealed the presence of 1 metal response element (MRE) sequence (Fig. S2). Two conserved nucleotide-binding domains (NBDs) of the TJ-P-gp gene were observed in the amino acid sequence with evolutionarily conserved motifs/domains for ATP-binding active sites such as A-loop (Y425 ), Q-loop (499 QE501 ), D-loop (597 ALD598 ), and H-loop (H611 ) for NBD1 and A-loop (Y1105 ), Q-loop (1179 QE1181 ), D-loop (1278 ALD1280 ), and H-loop (H1293 ) for NBD2. The conserved Walker motifs were identified as Walker A (451 GASGCGKST459 ) and Walker B (579 DE580 ) for NBD1, and Walker A (1131 GPSGCGKST1139 ) and Walker B (1261 DE1262 ) for NBD2. In addition, two signature domains were detected in the C-region (LSGGQ) from 555 to 559 for NBD1 and C-region (LSGGQ) from 1237 to 1241 for NBD2 (Fig. S3). To confirm the TJ-P-gp gene’s molecular phylogenetic placement within the diverse ABC transporter superfamily, phylogenetic analysis was performed. Prior to checking its specific placement, a preliminary test was conducted to determine its expected placement in the ABC transporter superfamily, including both mammals and invertebrates. As a result, the TJ-P-gp gene was found to belong to the ABCB clan (data not shown). An in-depth phylogenetic analysis, including other invertebrates, revealed that the TJ-P-gp gene was separated from nodes of other ABC clans, but clustered into the ABCB1 clan in mammals with other P-gps (Fig. S4).

b b

b

10

3. Results 3.1. cDNA sequence analysis and in silico analysis of deduced amino acid of TJ-P-gp

b

c

Ver ZSQ

250

c d b

200 c b

150 a

a

a

100

50

0

0

2

4

10

Inhibitor concentrations ( M) Fig. 1. (A) Efflux of rhodamine B in the absence or presence of P-gp inhibitor (verapamil) for 120 min. Data are represented as Relative Fluorescence Unit (RFU). (B) Efflux of rhodamine B in the absence or presence of P-gp inhibitor, zosuquidar trihydrochloride, for 120 min. Data are represented as RFU. (C) Intracellular retention of rhodamine B in the absence or presence of P-gp inhibitors, verapamil or zosuquidar trihydrochloride, for 120 min. Data are represented using percentage (%) of RFU. Fluorescence values were normalized to a blank well containing buffer solution and protein concentration of copepods for each sample. Error bars indicate mean ± S.D. of three replicates. Significant difference over the values of control are indicated by different letters on the data bar (P < 0.05) as analyzed by multiple-comparison ANOVA.

inhibitors, verapamil and zosuquidar. As expected, different concentrations (2, 4, and 10 ␮M) of verapamil and zosuquidar strongly inhibited the efflux of rhodamine in a concentration-dependent manner during a 120 min period (Fig. 1A and B), leading to a high fluorescence value for cellular retention in the 10 ␮M verapamiland zosuquidar-treated copepod sample (Fig. 1C). Moreover, 10 ␮M exposures of both inhibitors significantly increased metal toxicity for 96 h after exposure to LC10 values of each metal.

140

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

Specifically, these treatments increased toxicity by approximately 10–14% (verapamil-treated group: 8.5 mg/L; zosuquidar-treated group: 10.2 mg/L), 7–9% (verapamil-treated group: 1.3 mg/L; zosuquidar-treated group: 0.9 mg/L), and 8–12% (verapamiltreated group: 2.8 mg/L; zosuquidar-treated group: 2.5 mg/L) due to exposure to Cd, Cu, and Zn, compared to the LC10 value of metalexposed control groups (without inhibitors). These data suggest that TJ-P-gp-blockage would reduce metal tolerance of T. japonicus. 3.4. Metal accumulation analysis In the absence of Cd, T. japonicus whole-body samples showed a negligible LeadmiumTM Green fluorescence signal compared to Cdtreated samples, whereas zosuquidar-treated T. japonicus showed the accumulated green fluorescence (Fig. 2A). Cu uptake and accumulation were analyzed using Phen GreenTM FL Diacetate in T. japonicus whole-body samples for 24 h (Fig. 2B). Zosuquidar treatment elevated overall Cu levels, compared to the control and

zosuquidar-untreated groups, as the fluorescence of Phen GreenTM FL Diacetate is inversely proportional to the abundance of intracellular Cu ions. Addition of Zn led to an increase in the intrinsic fluorescence of Newport GreenTM PDX indicator, while accumulation of Zn was induced in response to exposure of zosuquidar in T. japonicus whole bodies (Fig. 2C). In Zn-exposed copepods, overall fluorescence of the zosuquidar-treated group was similar with that of the zosuquidar-free group. However, Zn-accumulated cells were obviously observed only in the zosuquidar-treated group for 24 h. Taken together, these results suggest that T. japonicus P-gp contributes to metal transport, as P-gp-specific inhibitors cause accumulation of three metal ions in body of T. japonicus. 3.5. Effect of metals on TJ-P-gp activity In order to check the effect of metals on TJ-P-gp activity, the copepods were exposed to different concentrations (10, 100, and 1000 ␮g/L) of three different metals for 24 h. After exposure to

Fig. 2. (A) Effects of zosuquidar treatment on Cd uptake and accumulation in T. japonicus whole bodies for 24 h. Upper part in each picture represents LeadmiumTM Green fluorescence, and lower parts are merged images. (a–c) T. japonicus not treated with Cd. (d–f) T. japonicus treated with Cd. (g–i) T. japonicus treated with Cd and zosuquidar. (B) Effects of zosuquidar treatment on Cu uptake and accumulation in T. japonicus whole bodies for 24 h. Upper part in each picture represents Phen GreenTM FL Diacetate, and lower parts are merged images. (a–c) T. japonicus not treated with Cu. (d–f) T. japonicus treated with Cu. (g–i) T. japonicus treated with Cu and zosuquidar. (C) Effects of zosuquidar treatment on Zn uptake and accumulation in T. japonicus whole bodies for 24 h. Upper part in each picture represents Newport GreenTM PDX Acetoxymethyl Ether, and lower parts merged images. (a–c) T. japonicus not treated with Zn. (d–f) T. japonicus treated with Zn. (g–i) T. japonicus treated with Zn and zosuquidar.

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

different metals, TJ-P-gp activity was induced in a concentrationdependent manner (Fig. 3). In the presence of the P-gp inhibitors (10 ␮M), rhodamine fluorescence was highly retained in the metal exposed-group compared to the inhibitor only group, indicating that metals affected TJ-P-gp activity differentially, resulting in the accumulated retention of fluorescent dye in the copepod (Fig. 3). 3.6. Effect of metals on TJ-P-gp mRNA expression After exposure to three metals with different concentrations (1, 10, 100, and 1000 ␮g/L) for 24 h, we found that TJ-P-gp transcript levels significantly increased at 100 and 1000 ␮g/L after 12 and 24 h of exposure (P < 0.05) (Fig. 4A). Both Cd and Cu significantly induced TJ-P-gp mRNA levels at 12 and 24 h (Fig. 4B) after exposure to 100 ␮g/L of metal. In case of Zn exposure, TJ-P-gp transcripts were slightly induced at 24 h. 3.7. Effect of metals on TJ-P-gp protein expression To investigate the effect of metals on the expression of P-gp protein in T. japonicus, copepods were exposed to different concentrations (1, 10, 100, and 1000 ␮g/L) of three metals for 24 h. All

141

Cd exposure levels (10, 100, and 1000 ␮g/L) increased the expression of TJ-P-gp protein, compared to the control group (Fig. 5A). Also, expression of TJ-P-gp protein was induced by treatment with 10 and 100 ␮g/L of Cu for 24 h (Fig. 5B), but the expression was recovered to the control level in 1000 ␮g/L of Cu-exposed copepods. It can be explained that P-gp protein would be differentially expressed over time, as P-gp mRNA was differentially regulated by Cu exposure from 12 to 24 h. In the case of Zn exposure, TJ-P-gp protein increased for 24 h in a concentration dependent manner (Fig. 5C). Taken together, these results suggest that metal exposure induced both transcriptional and translational expression of P-gp in terms of toxic effluent transporting activity in T. japonicus. 4. Discussion The intertidal copepod, T. japonicus has been shown the exhibit a strong tolerance for diverse environmental conditions, metal exposure in particular (Lee et al., 2007; Raisuddin et al., 2007). Previous toxicity data in the genus Tigriopus revealed its high resistance against metal exposure compared with other aquatic invertebrates (Table S1). T. japonicus and some other copepods have shown in vivo resistance to metals with different susceptibilities (Kwok et al.,

Fig. 2. (Continued)

142

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

2008, 2009; Lee et al., 2007; Mohammed et al., 2010). In the case of Tigriopus, there were different LC50 values reported, as shown in Table S1; T. japonicus from South Korea was 3.9 mg/L and T. japonicus from Hong Kong was 1.024 mg/L, however, it must be taken into account that the developmental stages employed in toxicity tests were different. It is also possible that a difference in metal toxicity tolerance is related to a difference in fitness that has shaped the evolutionary history of this taxon. In several of our previous studies, we have worked to better understand the molecular mechanism of cellular defense systems induced in response to metal exposures in T. japonicus with gene/protein expression analysis. We hypothesized that the Korean strain of T. japonicus may express metal detoxification through a molecular detoxification system composed of phase I/II metabolizing enzymes and phase III transporters such as the ABC transporter superfamily. A large family of transporters may be involved in the efflux of a wide range of xenobiotics and their biotransformed products. However, the role of ABC transporters in metal regulation is still unclear, and most studies have focused on mammalian transporting systems upon metal exposure. Among the ABC transporters, P-gp has been extensively characterized for its specificity to the xenobiotic efflux transporter, and mammalian P-gps have been shown to be involved

in metal tolerance (Endo et al., 2002; Liu et al., 2001). Subsequently, several putative P-gps were identified in invertebrates and characterized for their role in metal tolerance or toxicity (Broeks et al., 1996; Callaghan and Denny, 2002; Achard et al., 2004; Kurz et al., 2007; Ivanina and Sokolova, 2008; Boˇsnjak et al., 2009). The current study provides the first comparative analysis between P-gp presence and function in a copepod species, focusing on P-gp-mediated metal detoxification in T. japonicus. To date, P-gps or P-gp-like genes have been cloned in several aquatic invertebrates, while molecular and biochemical approaches have been continuously used in a sea urchin model (Hamdoun et al., 2002, 2004; Boˇsnjak et al., 2009; Gökirmak et al., 2012, 2013; Cole et al., 2013). However, the annotation and characterization of P-gps remains difficult due to a lack of genomic information and the complicated organization of their subfamily. In the TJ-P-gp gene, a series of analyses such as cDNA/amino acid similarity, domain/motif similarity, phylogenetic distance, and hydrophobic topology supported clear evidence for the annotation of the TJ-P-gp gene. With in silico parameters, in vivo characterization of TJ-P-gp activities confirmed TJ-P-gp’s efflux function using the fluorescent pump substrate rhodamine and P-gp-specific inhibitors (Cornwall et al., 1995; Dantzig et al., 2001; Eufemia and

Fig. 2. (Continued).

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

Epel, 2000; Ivanina and Sokolova, 2008; Rhee et al., 2012; Shabbir et al., 2005). In the present study, the efflux rate of the TJ-P-gp protein was inhibited by both inhibitor, and intracellular fluorescence of rhodamine retention increased with inhibitor exposure. These results clearly demonstrated the presence and transport activity of the P-gp-like protein in T. japonicus, as the P-gp-blockage significantly increased metal accumulation and toxicity. Thus, copepods may use this kind of transport system to reduce the accumulation of diverse environmental pollutants as one of their molecular defense systems. The TJ-P-gp protein has been shown to be involved in the efflux of excess metal uptake in this study, although metals are not

A

A)

100

*

Control Cd 10 g/L Cd 100 g/L Cd 1000 g/L

80

* * *

60

* *

* *

*

40 *

*

considered to be a substrate of ABC transporters. A significant increase in rhodamine fluorescence upon metal exposure revealed that transport activity of the TJ-P-gp protein is triggered by excess metal intake. This result supports previous reports as discussed below, and also indicates that the TJ-P-gp protein has an important role in the transport of metals. Previously, P-gp’s efflux activity for metal transport was tested in in vitro mammalian systems (Endo et al., 2002; Huynh-Delerme et al., 2005). These studies suggest that the efflux function of P-gp in different cell lines prevents cellular metal accumulation. In aquatic animals, similar functions of P-gp due to metal exposure have been proposed (Broeks et al., 1996; Achard et al., 2004; Kurz et al., 2007; Ivanina and Sokolova, 2008;

*

20

Rhodamine fluorescence (RFU)

Rhodamine fluorescence (RFU)

A)

B 80

60

Control Cu 10 g/L Cu 100 g/L Cu 1000 g/L

*

40

30

60

90

30

120

60 *

40

*

* *

*

*

* *

20

Rhodamine fluorescence (RFU)

Rhodamine fluorescence (RFU)

B) Ver 10 M Cd 10 g/L, Ver 10 M Cd 100 g/L, Ver 10 M Cd 1000 g/L, Ver 10 M

*

60

90

120

80

60

Ver 10 M Cu 10 g/L, Ver 10 M Cu 100 g/L, Ver 10 M Cu 1000 g/L, Ver 10 M * *

40

*

*

*

*

20

0

0

30

60

90

30

120

60

Exposure time (min) ZSQ 10 M Cd 10 g/L, ZSQ 10 M Cd 100 g/L, ZSQ 10 M Cd 1000 g/L, ZSQ 10 M

60

* * * *

20

*

*

* *

*

Rhodamine fluorescence (RFU)

C) 100

40

90

120

Exposure time (min)

C)

Rhodamine fluorescence (RFU)

*

*

Exposure time (min)

100

80

*

20

Exposure time (min)

80

*

0

0

B)

143

80

60

ZSQ 10 M Cu 10 g/L, ZSQ 10 M Cu 100 g/L, ZSQ 10 M Cu 1000 g/L, ZSQ 10 M * *

40

20 *

0

0

30

60

90

Exposure time (min)

120

30

60

90

120

Exposure time (min)

Fig. 3. Time-course rhodamine B assay of (A) cadmium, (B) copper and (C) zinc treatment on TJ-P-gp activity at different sampling time points (30, 60, 90, and 120 min) in the absence or presence of 10 ␮M of verapamil or 10 ␮M of zosuquidar. Data are represented as Relative Fluorescence Unit (RFU). Data are mean ± S.D. of three replicates of exposed copepods.

144

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

Boˇsnjak et al., 2009). Taken together, we suggest that the efflux activities of P-gps are functionally conserved across taxa, and the transport function can be considered one of the detoxification pathways. P-gp and some ABC transporters act as a cellular barrier by preventing uptake of a wide variety of chemicals in phase 0 of cellular detoxification. They are also involved in the efflux of diverse metabolites in phase III of the detoxification system (Bard, 2000; Szakács et al., 2008; Xu et al., 2005). In this context, the activity of the TJ-P-gp protein provides valuable evidence for the adaptive mechanism of copepods to tolerate metal exposure. Results of the transcriptional and translational inductions of the TJ-P-gp gene upon metal exposure supported our in vivo results as well as previously published studies on aquatic animals. For

Rhodamine fluorescence (RFU)

A)

example, in the nematode, Caenorhabditis elegans, both P-gp-1deleted and multidrug resistance-associated protein 1 (MRP-1) mutant worms showed hypersensitivity to metal exposure (Broeks et al., 1996), while mRNA expression of the nematode P-gp-5 gene increased after Cd exposure (Kurz et al., 2007). In reef coral, mRNA expression of P-gp increased following Cu exposure (Venn et al., 2009). Also, the mRNA expression level of the P-gp (ABCB1) gene was four-fold higher in Cd-exposed Antarctic fish (Zucchi et al., 2010). One possible modulator for P-gp mRNA expression would be the metal responsive element (MRE) in its promoter region. Metalresponsive control of certain genes is regulated by MRE-binding transcription factor (MTF) via MRE motif in promoter region. Chin

C 60

Control Zn 10 g/L Zn 100 g/L Zn 1000 g/L

50

*

*

40

30 * *

20

10

*

*

0

30

60

90

120

Exposure time (min) Rhodamine fluorescence (RFU)

B)

60

Ver 10 M Zn 10 g/L, Ver 10 M Zn 100 g/L, Ver 10 M Zn 1000 g/L, Ver 10 M

50

40

* *

*

*

30 *

20

*

* *

10

*

*

0

30

60

90

120

Exposure time (min) Rhodamine fluorescence (RFU)

C)

60

50

ZSQ 10 M Zn 10 g/L, ZSQ 10 M Zn 100 g/L, ZSQ 10 M Zn 1000 g/L, ZSQ 10 M

*

40 *

30

* *

20

10

0

30

60

90

Exposure time (min) Fig. 3. (Continued).

120

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

145

A) Relative TJ-P-gp mRNA expression

7

Cd Cu Zn

6

*

5 * *

4

*

3

* *

2 1 0 0

1

10

100

1000

Concentration ( g/L)

B) Relative TJ-P-gp mRNA expression

7 *

Cd 100 g/L Cu 100 g/L Zn 100 g/L

6

Fig. 5. Effects of metal exposure, (A) Cd, (B) Cu, and (C) Zn, on P-gp protein expression at different concentrations (1, 10, 100, and 1000 ␮g/L) in the intertidal copepod, T. japonicus. Tubulin-␣ was employed as an endogenous control for this experiment.

*

5 *

4

*

3 *

2 1 0 0

3

6

12

24

Exposure time (h) Fig. 4. (A) Effects of metal exposure on P-gp mRNA expression with different concentrations (1, 10, 100, and 1000 ␮g/L) in the intertidal copepod, T. japonicus. (B) Time-course effects of a single concentration (100 ␮g/L) of each metal on P-gp mRNA expression at different sampling time points (30, 60, 90, and 120 min). Pgp mRNA expressions are shown as relative to 18S rRNA, which was used as a reference/housekeeping gene. Data are mean ± S.D. of three replicates of exposed copepods. The symbol (*) indicates P < 0.05.

et al. (1990) suggested this role of MRE from evidence in human P-gp (MDR1) transcript induction. Mutation in the MRE site of European flounder CYP1A promoter resulted in direct abolishment of transcriptional regulation (Lewis et al., 2006). In fact, Cd exposure strongly induced fluorescence of the GFP-encoding gene that was under the control of the upstream P-gp 5 promoter (Kurz et al., 2007). A positive correlation between mRNA and protein expression was observed in numerous studies, including P-gp-related works (Liu et al., 2002; Taipalensuu et al., 2004; Prenkert et al., 2009; Zucchi et al., 2010). However, Ivanina and Sokolova (2008) suggested that P-gp activity may be post-translationally regulated, and P-gp mRNA levels are not a good marker due to an insignificant change in Cd-exposed in Eastern oysters. Based on our mRNA and protein expression results and the demonstrated induction of protein activity, we suggest that modulation of the TJ-P-gp gene would be a potential indicator of metal exposure in T. japonicus. ABC transporters are one of the largest families of transport proteins, constituting several subfamilies that are classified by gene structure and domains. Therefore, an alternative reason for metal tolerance in T. japonicus might be possible. In fact, we recently identified 46 T. japonicus putative ABC transporters using in silico

analysis, and characterized their full-length cDNA sequences (Jeong et al., 2014). Of them, only a single P-gp gene, ABCB1 full transporter, was analyzed here in T. japonicus, while multiple types of ABCB1/P-gp/MDR1 genes have been reported in invertebrates that originate from tandem duplication as the primary event leading to ABCB diversity during evolution. For example, the ectoparasitic copepod Lepeophtheirus salmonis has single P-gp gene (Heumann et al., 2012), although two putative P-gp genes were reported previously in L. salmonis that was a misannotation of ABC transporters unrelated to P-gp (Tribble et al., 2007). Therefore, TJ-P-gp has a representative function of biochemical transport in response to metals and other diverse molecules. Nevertheless, apart from the P-gp, synergistic effects of other ABC proteins may contribute to metal resistance in T. japonicus. Therefore, comparative analysis of ABC transporter mRNA and/or protein expression is necessary in order to better understand the role of P-gp for its possible uses in biomonitoring. Also in sea urchin, inorganic mercury (Hg(II)) is actively transported by ABC transporters including P-gp than organic mercury (MeHg) (Boˇsnjak et al., 2009, 2013). Thus, differentially biotransformed metal (ion) or metal mixture will be another target for P-gp-mediated metabolism. At this point, however, our results clearly show that the TJ-P-gp gene/protein may be strongly involved in metal tolerance, although further studies would be required to clarify the major contribution of P-gp and/or other transporters to metal tolerance in this copepod species. In conclusion, several pieces of evidence identified in this study strongly support our explanation of how T. japonicus is tolerant to metal exposure. First, metal accumulation/efflux results obtained from the two model P-gp inhibitors showed similar inhibitory mechanisms, as confirmed in aquatic animals or in vitro systems; revealing that these inhibitors directly modulate the TJP-gp. Second, mortality was significantly increased by inhibitor exposure in metal-treated groups, indicating that P-gp inhibitormediated disruption of the substrate efflux mechanism may lead to metal accumulation, thereby increasing mortality. Thirdly, the transcriptional and translational profiles of the TJ-P-gp gene, and the presence of MRE at the promoter region, suggest that the TJ-P-gp gene would be strongly regulated by metals at both the transcriptional and translational levels, even though the T. japonicus has a single copy number of the P-gp gene in the genome. Together, these

146

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147

results suggest that P-gp plays an important role in metal regulation in this species. Acknowledgements We thank Dr. Hans-U. Dahms for useful comments on early drafts of this manuscript and also thank two anonymous reviewers for their constructive comments on the manuscript. This work was supported by a grant of National Research Foundation (NRF2012R1A2A2A02012617) funded to Jae-Seong Lee. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aquatox. 2014.08.005. References Achard, M., Baudrimont, M., Boudou, A., Bourdineaud, J.P., 2004. Induction of a multixenobiotic resistance protein (MXR) in the Asiatic clam Corbicula fluminea after heavy metal exposure. Aquat. Toxicol. 67, 347–357. Ambudkar, S.V., Kim, I.W., Xia, D., Sauna, Z.E., 2006. The A-loop, a novel conserved aromatic acid subdomain upstream of the Walker A motif in ABC transporters, is critical for ATP binding. FEBS Lett. 13, 1049–1055. Bard, S.M., 2000. Multixenobiotic resistance as a cellular defense mechanism in aquatic organisms. Aquat. Toxicol. 48, 357–389. ˇ c, ´ J., Coale, K., Epel, D., Boˇsnjak, I., Uhlinger, K.R., Heim, W., Smital, T., Franekic´ Coli Hamdoun, A., 2009. Multidrug efflux transporters limit accumulation of inorganic, but not organic mercury in sea urchin embryos. Environ. Sci. Technol. 43, 8374–8380. ´ I., Borra, M., Mladineo, I., 2013. Quantification and in situ Boˇsnjak, I., Lepen Pleic, localisation of abcb1 and abcc9 genes in toxicant-exposed sea urchin embryos. Environ. Sci. Pollut. Res. 20, 8600–8611. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Broeks, A., Gerrard, B., Allikmets, R., Dean, M., Plasterk, R.H., 1996. Homologues of the human multidrug resistance genes MRP and MDR contribute to heavy metal resistance in the soil nematode Caenorhabditis elegans. EMBO J. 15, 6132–6143. Callaghan, A., Denny, N., 2002. Evidence for an interaction between p-glycoprotein and cadmium toxicity in cadmium-resistant and -susceptible strains of Drosophila melanogaster. Ecotoxicol. Environ. Saf. 52, 211–213. Chin, K.-W., Tanaka, S., Darlington, G., Pastan, I., Gottesmann, M., 1990. Heat shock and arsenite increase expression of the multidrug resistance (MDR1) gene in human renal carcinoma cells. J. Biol. Chem. 265, 221–226. Cole, B.J., Hamdoun, A., Epel, D., 2013. Cost, effectiveness and environmental relevance of multidrug transporters in sea urchin embryos. J. Exp. Biol. 216, 3896–3905. Cornwall, R., Toomey, B.H., Bard, S., Bacon, C., Jarman, W.M., Epel, D., 1995. Characterization of multixenobiotic/multidrug transport in the gills of the mussel Mytilus californianus and identification of environmental substrates. Aquat. Toxicol. 31, 277–296. Dantzig, A.H., Law, K.L., Cao, J., Starling, J.J., 2001. Reversal of multidrug resistance by the P-glycoprotein modulator LY335979, from the bench to the clinic. Curr. Med. Chem. 8, 39–50. Della Torre, C., Zaja, R., Loncar, J., Smital, T., Focardi, S., Corsi, I., 2012. Interaction of ABC transport proteins with toxic metals at the level of gene and transport activity in the PLHC-1 fish cell line. Chem.-Biol. Interact. 198, 9–17. ´ Drobná, Z., Walton, F.S., Paul, D.S., Xing, W., Thomas, D.J., Styblo, M., 2010. Metabolism of arsenic in human liver: the role of membrane transporters. Arch. Toxicol. 84, 3–16. Endo, T., Kimura, O., Sakata, M., 2002. Effects of P-glycoprotein inhibitors on cadmium accumulation in cultured renal epithelial cells, LLC-PK1, and OK. Toxicol. Appl. Pharmacol. 185, 166–171. Epel, D., 1998. Use of multidrug transporters as first lines of defense against toxins in aquatic organisms. Comp. Biochem. Physiol. A 120, 23–28. Eufemia, N.A., Epel, D., 2000. Induction of the multixenobiotic defense mechanism (MXR) P-glycoprotein, in the mussel Mytilus californianus as a general cellular response to environmental stresses. Aquat. Toxicol. 49, 89–100. Georges, E., Bradley, G., Gariepy, J., Ling, V., 1990. Detection of P-glycoprotein isoforms by gene-specific monoclonal antibodies. Proc. Natl. Acad. Sci. U.S.A. 87, 152–156. Gökirmak, T., Campanale, J.P., Shipp, L.E., Moy, G.W., Tao, H., Hamdoun, A., 2012. Localization and substrate selectivity of sea urchin multidrug (MDR) efflux transporters. J. Biol. Chem. 287, 43876–43883. Hamdoun, A.M., Griffin, F.J., Cherr, G.N., 2002. Tolerance to biodegraded crude oil in marine invertebrate embryos and larvae is associated with expression of a multixenobiotic resistance transporter. Aquat. Toxicol. 61, 127–140.

Hamdoun, A.M., Cherr, G.N., Roepke, T.A., Epel, D., 2004. Activation of multidrug efflux transporter activity at fertilization in sea urchin embryos (Strongylocentrotus purpuratus). Dev. Biol. 276, 452–462. Heumann, J., Carmichael, S., Bron, J.E., Tildesley, A., Sturm, A., 2012. Molecular cloning and characterisation of a novel P-glycoprotein in the salmon louse Lepeophtheirus salmonis. Comp. Biochem. Physiol. C 155, 198–205. Huynh-Delerme, C., Huet, H., Noel, L., Frigieri, A., Kolf-Clauw, M., 2005. Increased functional expression of P-glycoprotein in Caco-2 TC7 cells exposed long-term to cadmium. Toxicol. In Vitro 19, 439–447. Ivanina, A.V., Sokolova, I.M., 2008. Effects of cadmium exposure on expression and activity of P-glycoprotein in eastern oysters, Crassostrea virginica Gmelin. Aquat. Toxicol. 88, 19–28. Jeong, C.-B., Kim, B.-M., Lee, J.-S., Rhee, J.-S., 2014. Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus. BMC Genomics 15, 651. Jung, S.-O., Lee, Y.-M., Park, T.-J., Park, H.G., Hagiwara, A., Leung, K.M.Y., Dahms, H.U., Lee, W., Lee, J.-S., 2006. The complete mitochondrial genome of the intertidal copepod Tigriopus sp. (Copepoda, Harpactidae) from Korea and phylogenetic considerations. J. Exp. Mar. Biol. Ecol. 333, 251–262. Kemper, E.M., Cleypool, C., Boogerd, W., Beijnen, J.H., van Tellingen, O., 2004. The influence of the P-glycoprotein inhibitor zosuquidar trihydrochloride (LY335979) on the brain penetration of paclitaxel in mice. Cancer Chemother. Pharmacol. 53, 173–178. Kim, B.-M., Rhee, J.-S., Park, G.-S., Lee, J., Lee, Y.-M., Lee, J.-S., 2011. Cu/Zn- and Mnsuperoxide dismutase (SOD) from the copepod Tigriopus japonicus: molecular cloning and expression in response to environmental pollutants. Chemosphere 84, 1467–1475. Kim, B.-M., Choi, B.-S., Lee, K.-W., Ki, J.-S., Kim, I.-C., Choi, I.-Y., Rhee, J.-S., Lee, J.S., 2013. Expression profile analysis of antioxidative stress and developmental pathway genes in the manganese-exposed intertidal copepod Tigriopus japonicus with 6K oligochip. Chemosphere 92, 1214–1223. Klaassen, C.D., Liu, J., Choudhuri, S., 1999. Metallothionein: an intracellular protein to protect against cadmium toxicity. Annu. Rev. Pharmacol. Toxicol. 39, 267–294. Kurelec, B., 1992. The multixenobiotic resistance mechanism in aquatic organisms. Crit. Rev. Toxicol. 22, 23–43. Kurz, C.L., Shapira, M., Chen, K., Baillie, D.L., Tan, M.W., 2007. Caenorhabditis elegans pgp-5 is involved in resistance to bacterial infection and heavy metal and its regulation requires TIR-1 and a p38 map kinase cascade. Biochem. Biophys. Res. Commun. 363, 438–443. Kwok, K.W., Leung, K.M., Bao, V.W., Lee, J.-S., 2008. Copper toxicity in the marine copepod Tigropus japonicus: low variability and high reproducibility of repeated acute and life-cycle tests. Mar. Pollut. Bull. 57, 632–636. Kwok, K.W., Grist, E.P., Leung, K.M., 2009. Acclimation effect and fitness cost of copper resistance in the marine copepod Tigriopus japonicus. Ecotoxicol. Environ. Saf. 72, 358–364. Lee, J.-S., Rhee, J.-S., Kim, R.-O., Hwang, D.-S., Han, J., Choi, B.-S., Park, G.-S., Kim, I.-C., Park, H.G., Lee, Y.-M., 2010. The copepod Tigriopus japonicus genomic DNA information (574 Mb) and molecular anatomy. Mar. Environ. Res. 69, S21–S23. Lee, K.-W., Raisuddin, S., Hwang, D.-S., Park, H.G., Lee, J.-S., 2007. Acute toxicities of trace metals and common xenobiotics to the marine copepod Tigriopus japonicus: evaluation of its use as a benchmark species for routine ecotoxicity tests in Western pacific coastal regions. Environ. Toxicol. 22, 532–538. Lewis, N.A., Williams, T.D., Chipman, J.K., 2006. Functional analysis of a metal response element in the regulatory region of European flounder cytochrome P450 1A and implications for environmental monitoring of pollutants. Toxicol. Sci. 92, 387–393. Liu, H., Ma, Z., Wu, B., 2013. Structure–activity relationships and in silico models of P-glycoprotein (ABCB1) inhibitors. Xenobiotica 43, 1018–1026. Liu, J., Chen, H., Miller, D.S., Saavedra, J.E., Keefer, L.K., Johnson, D.R., Klaassen, C.D., Waalkes, M.P., 2001. Overexpression of glutathione S-transferase II and multidrug resistance transport proteins is associated with acquired tolerance to inorganic arsenic. Mol. Pharmacol. 60, 302–309. Liu, Z.L., Onda, K., Tanaka, S., Toma, T., Hirano, T., Oka, K., 2002. Induction of multidrug resistance in MOLT-4 cells by anticancer agents is closely related to increased expression of functional P-glycoprotein and MDR1 mRNA. Cancer Chemother. Pharmacol. 49, 391–397. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2-Ct method. Methods 25, 402–408. Long, Y., Li, Q., Wang, Y., Cui, Z., 2011. MRP proteins as potential mediators of heavy metal resistance in zebrafish cells. Comp. Biochem. Physiol. C 153, 310–317. Meria, E., 1991. Metals and Their Compounds in the Environment. Occurrence, Analysis and Biological Relevance. Verlag Chemie, New York. Mohammed, E.H., Wang, G., Jiang, J., 2010. The effects of nickel on the reproductive ability of three different marine copepods. Ecotoxicology 19, 911–916. Palmeira, A., Sousa, E., Vasconcelos, M.H., Pinto, M.M., 2012. Three decades of Pgp inhibitors: skimming through several generations and scaffolds. Curr. Med. Chem. 19, 1946–2025. Prenkert, M., Uggla, B., Tina, E., Tidefelt, U., Strid, H., 2009. Rapid induction of P-glycoprotein mRNA and protein expression by cytarabine in HL-60 cells. Anticancer Res. 29, 4071–4076. Rainbow, P.S., 2007. Trace metal bioaccumulation: models, metabolic availability and toxicity. Environ. Int. 33, 576–582. Raisuddin, S., Kwok, K.W., Leung, K.M., Schlenk, D., Lee, J.-S., 2007. The copepod Tigriopus: a promising marine model organism for ecotoxicology and environmental genomics. Aquat. Toxicol. 83, 161–173.

C.-B. Jeong et al. / Aquatic Toxicology 156 (2014) 135–147 Rhee, J.-S., Raisuddin, S., Lee, K.-W., Seo, J.S., Ki, J.-S., Kim, I.-C., Park, H.G., Lee, J.S., 2009. Heat shock protein (Hsp) gene responses of the intertidal copepod Tigriopus japonicus to environmental toxicants. Comp. Biochem. Physiol. C 149, 104–112. Rhee, J.-S., Jeong, C.-B., Kim, B.-M., Lee, J.-S., 2012. P-glycoprotein (P-gp) in the monogonont rotifer, Brachionus koreanus: molecular characterization and expression in response to pharmaceuticals. Aquat. Toxicol. 114/115, 104–118. Rhee, J.-S., Yu, I.-T., Kim, B.-M., Jeong, C.-B., Lee, K.-W., Kim, M.-J., Lee, S.-J., Park, G.S., Lee, J.-S., 2013. Copper induces apoptotic cell death through reactive oxygen species-triggered oxidative stress in the intertidal copepod Tigriopus japonicus. Aquat. Toxicol. 132/133, 182–189. Shabbir, A., DiStasio, S., Zhao, J., Cardozo, C.P., Wolff, M.S., Caplan, A.J., 2005. Differential effects of the organochlorine pesticide DDT and its metabolite p,p’-DDE on p-glycoprotein activity and expression. Toxicol. Appl. Pharmacol. 203, 91–98. Smital, T., Kurelec, B., 1998. The chemosensitizers of multixenobiotic resistance mechanisms in aquatic invertebrates: a new class of pollutants. Mutat. Res. 399, 43–53. Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 18, 321–336. Szakács, G., Váradi, A., Ozvegy-Laczka, C., Sarkadi, B., 2008. The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox). Drug Discov. Today 13, 379–393. Taipalensuu, J., Tavelin, S., Lazorova, L., Svensson, A.C., Artursson, P., 2004. Exploring the quantitative relationship between the level of MDR1 transcript, protein and

147

function using digoxin as a marker of MDR1-dependent drug efflux activity. Eur. J. Pharm. Sci. 21, 69–75. Tang, R., Faussat, A.M., Perrot, J.Y., Marjanovic, Z., Cohen, S., Storme, T., Morjani, H., Legrand, O., Marie, J.P., 2008. Zosuquidar restores drug sensitivity in Pglycoprotein expressing acute myeloid leukemia (AML). BMC Cancer 8, 51. Thevenod, F., 2010. Catch me if you can! Novel aspects of cadmium transport in mammalian cells. Biometals 23, 857–875. Tribble, N.D., Burka, J.F., Kibenge, F.S., 2007. Evidence for changes in the transcription levels of two putative P-glycoprotein genes in sea lice (Lepeophtheirus salmonis) in response to emamectin benzoate exposure. Mol. Biochem. Parasitol. 153, 59–65. Valko, M., Morris, H., Cronin, M.T., 2005. Metals, toxicity and oxidative stress. Curr. Med. Chem. 12, 1161–1208. Venn, A.A., Quinn, J., Jones, R., Bodnar, A., 2009. P-glycoprotein (multi-xenobiotic resistance) and heat shock protein gene expression in the reef coral Montastraea franksi in response to environmental toxicants. Aquat. Toxicol. 93, 188– 195. Xu, C.J., Li, C.Y.T., Kong, A.N.T., 2005. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharmacol. Res. 28, 249–268. Zucchi, S., Corsi, I., Luckenbach, T., Bard, S.M., Regoli, F., Focardi, S., 2010. Identification of five partial ABC genes in the liver of the Antarctic fish Trematomus bernacchii and sensitivity of ABCB1 and ABCC2 to Cd exposure. Environ. Pollut. 158, 2746–2756.