Functional characterization of PeIF5B as eIF5B homologue from Pisum sativum

Biochimie 118 (2015) 36e43

Contents lists available at ScienceDirect

Biochimie journal homepage: www.elsevier.com/locate/biochi

Research paper

Functional characterization of PeIF5B as eIF5B homologue from Pisum sativum Sheeba Rasheedi a, Madhuri Suragani b, Podili Raviprasad b, Sudip Ghosh b, Rajasekhar N.V.S. Suragani c, Kolluru V.A. Ramaiah c, Nasreen Z. Ehtesham d, * a

Laboratory of Molecular and Cellular Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500 001, India Molecular Biology Unit, National Institute of Nutrition, Hyderabad 500 007, India Department of Biochemistry, University of Hyderabad, Prof. C. R. Rao Road, Hyderabad 500 046, India d Inflammation Biology and Cell Signaling Laboratory, National Institute of Pathology, Safdarjung Hospital, New Delhi 110029, India b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 20 January 2015 Accepted 21 July 2015 Available online 26 July 2015

We earlier reported ‘PeIF5B’ as a novel factor from Pisum sativum that has sequence similarity to eIF5B (S. Rasheedi, S. Ghosh, M. Suragani et al., P. sativum contains a factor with strong homology to eIF5B, Gene 399 (2007) 144e151). The main aim of the present study was to perform functional characterization of PeIF5B as an eIF5B homologue from plant system. PeIF5B shows binding to Met
tRNAf Met , hydrolyses GTP and interacts with ribosomes. In vivo growth complementation analysis shows that PeIF5B partially complements its yeast homologue. Interestingly, PeIF5B mainly localizes in the nucleus as confirmed by nuclear localization signal (NLS) prediction, confocal imaging and immunoblots of cellular fractions. Similar to the yeast eIF5B but unlike the human orthologue, PeIF5B is an intron-less gene. This study highlights PeIF5B's role as a functional eIF5B homologue possibly participating in nuclear translation in plant system.
te
Française de Biochimie et Biologie Mole
culaire (SFBBM). All rights © 2015 Elsevier B.V. and Socie reserved.

Keywords: PeIF5B Pisum sativum Translation initiation factor Growth complementation analysis Nuclear localization signal Nuclear translation

1. Introduction Protein biosynthesis is an important step during gene expression where the genetic information on the messenger RNA (mRNA) is translated into amino acid sequence. The most critical step of protein translation process is “translation initiation” where several translation initiation factors are involved to load mRNA and the initiator tRNA onto the ribosome complex [1]. This process requires three initiation factors in prokaryotes (IF1, IF2 and IF3) whereas in eukaryotes there are around eleven initiation factors. Characterization of these factors participating during translation initiation is extremely critical to understand this rate-limiting step of protein synthesis. The fundamental mechanism of translation initiation is quite similar in all eukaryotes, ranging from plants, animals and yeasts with some marked differences. Study of the translation initiation machinery from various systems has implication in

Abbreviations: NLS, nuclear localization signal; IRES, internal ribosome entry site; DAPI, 40 , 60 -diamidino-2-phenylindole. * Corresponding author. E-mail address: [email protected] (N.Z. Ehtesham).

unwinding the underlying functional differences in regulation of protein synthesis. We earlier reported a novel factor, ‘PeIF5B’, from Pisum sativum that showed sequence similarity to the universal translation initiation factor eIF5B [2]. eIF5B is a translation initiation factor that participates during cellular translation initiation process [3]. eIF5B mediates dissociation of initiation factors from 40S ribosomal subunit in 48S initiation complex and helps joining of 60S ribosomal subunit to 48S complex to produce a translationally competent 80S initiation complex [4]. eIF5B is also reported to participate during conditions of pathophysiological stress when there is a switch from “eIF2a-dependent” to “eIF5B-dependent” translation initiation [5] and also during some viral RNA translation when the virus makes use of internal ribosome entry site (IRES) driven bacterial-like translational pathway [6]. Recently eIF5B is shown to play a critical role during cell-cycle transition and some specific developmental stages [7]. We further reported PeIF5B showing similar ligand binding properties as other eIF5B homologues by biophysical approach [8] and quite interestingly, PeIF5B displays chaperon activity similar to several other translation factors [9].

http://dx.doi.org/10.1016/j.biochi.2015.07.017
te
Française de Biochimie et Biologie Mole
culaire (SFBBM). All rights reserved. 0300-9084/© 2015 Elsevier B.V. and Socie

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

The present study focuses on the functional characterization of PeIF5B. Charged initiator tRNA binding, GTPase assay, interaction with ribosomes and in vivo complementation assay highlight its functional similarity to the universal translation initiation factor eIF5B. Collectively our data suggest PeIF5B is a functional eIF5B homologue from P. sativum. Interestingly, it is found to have a functional nuclear localization signal (NLS). Furthermore intronexon analysis of PeIF5B gene showed it to be an intron-less gene. This is the first report of functional characterization of an eIF5B factor from any plant system.

37

Ehtesham et al., 1999 [12]. The isolated ribosomes were incubated with anti-PeIF5B antibodies in the presence or absence of rPeIF5B overnight at 4  C in 1X RIPA buffer [5 mM TriseHCl (pH 8.0), 70 mM NaCl, 2.5 mM iodoacetamide, 0.25% Triton-X100, 0.05% SDS and 0.05% sodium deoxycholate]. The reaction was later incubated with equilibrated protein G-Sepharose beads (Pharmacia) at 25  C for 1 h with constant shaking. The beads were later washed with 1X RIPA buffer at 4  C. Bound proteins were eluted in 1X SDS sample buffer and resolved on 10% SDS-polyacrylamide gel. 2.8. Growth complementation analysis

2. Materials and methods 2.1. Protein expression and purification Recombinant PeIF5B (rPeIF5B) was expressed, purified and obtained in its active form in 20 mM TriseHCl (pH 8.0) and 100 mM NaCl as described earlier [8] and used for all biochemical studies. 2.2. Raising polyclonal anti-PeIF5B antibodies Polyclonal antisera against full-length recombinant PeIF5B were raised in rabbit following standard protocol.

Saccharomyces cerevisiae strain J111 (ura3-52 leu2-3 leu2-112 fun12D) having a chromosomal deletion of eIF5B encoded by FUN12 and J111-FUN12 strain carrying a plasmid expressing the wild type yeast eIF5B (ura3-52 leu2-3 leu2-112 fun12D p[FUN12,URA3]) were kind gifts of Prof. Thomas Dever, NIH, Bethesda, USA. J111-vector and J111-PeIF5B carried pEMBL-yex4 and PeIF5B cloned in pEMBL-yex4, respectively. Growth rates of J111-FUN12, J111-PeIF5B and J111-vector strains were compared at 30  C in minimal SD broth supplemented with leucine by measuring the absorbance at 600 nm. 2.9. Expression of PeIF5B as eGFP fusion protein in mammalian system

2.3. Charging tRNAf Met with [35S]methionine 50 mg of formyl methioinine specific Escherichia coli tRNA (Sigma Aldrich, St. Louis, MO), 2 mM ATP, 100 mM TriseHCl (pH 7.5), 5 mM MgCl2, 2 mM [35S]methionine (1000 Ci/mmol) and 100 units of E. coli aminoacyl tRNA synthetase (Sigma Aldrich) was incubated at 37  C for 10 min. Reaction was terminated by adding 30 ml of 1 M sodium acetate (pH 5.0) followed by phenol extraction. Aqueous phase was dialysed against high salt dialysis buffer [50 mM sodium acetate (pH 5.0) and 0.5 M NaCl] followed by low salt dialysis buffer [20 mM sodium acetate (pH 5.0)]. 2.4. Met
tRNAf Met binding assay 0e4 mg of rPeIF5B was incubated at 37  C for 10 min with Met
tRNAf (~100,000 cpm) in presence of 20 mM TriseHCl (pH 7.8), 2 mM DTT, 1.5 mM MgCl2, 250 mM GTP, 75 mM KCl and 130 mg BSA. Reaction was terminated by adding ice-cold wash buffer [20 mM TriseHCl (pH 7.8), 100 mM KCl and 5 mM MgCl2] and later passed through 0.45 mm nitrocellulose filters (EMD Millipore Corp, Billerica, MA). The filters were washed, dried and radioactivity quantified using liquid scintillation counter. ½35 SMet

pEGFP-PeIF5B carrying PeIF5B ORF with C-terminal eGFP was generated by cloning NheI-XhoI fragment from pETPeIF5B [8] into pEGFP-N1 (Clontech). Hence full-length PeIF5B was expressed as a fusion protein with eGFP (PeIF5B-eGFP). The NLS-deleted clone of PeIF5B with N-terminal eGFP (pEGFP-PeIF5BD180) was constructed by cloning the amplified fragment from pPeIF5B [2] using primers: FP-GGAATTCGAAGGTAAATTGTTAACCGGTAAG and RPTCTCGAGTTGTATCTTGAAAAGACTCTTCAATTTC into pCR2.1 (Invitrogen). From pCR2.1 the fragment was isolated using restriction enzymes KpnI and ApaI and cloned in KpnI and ApaI sites in pEGFPC3 (Clontech). In this case, NLS-deleted PeIF5B was expressed as a fusion protein with eGFP (PeIF5BD180-eGFP). 2.10. Confocal imaging of HeLa cells transfected with PeIF5B-GFP fusion clones Hela cells transfected with pEGFP-PeIF5B, pEGFP-PeIF5BD180 and vector control were incubated for 10 h at 37  C and fixed in 2% paraformaldehyde. Cells were examined with a Nikon A-1R confocal microscope and images were collected and analysed.

2.5. GTPase activity

2.11. Cytoplasmic-nuclear extract preparation

25 nM solution of rPeIF5B was incubated with 35 mM [g-32P]GTP for 5 min at 65  C in a buffer containing 70 mM KCl, 25 mM TriseHCl (pH 7.5), 7 mM MgCl2 and 1 mM DTT. Sample was resolved on polyethyleneimine cellulose thin layer chromatography (TLC) plate and scanned in Storm PhosphorImager (GE Healthcare Biosciences, Piscataway, NJ).

Cytoplasmic extract (CE) and nuclear extract (NE) were prepared from 10 days old leaves of Oryza sativa as previously described [13]. Briefly, the leaves were homogenized in NE-1 buffer [0.55 M sucrose, 50 mM TriseHCl (pH 8.0), 10 mM MgCl2, 25 mM KCl, 10 mM Na2S2O3, 7 mM 2-mercaptoethanol and 0.5 mM PMSF] at 4  C and later filtered through Miracloth. The filtrate was centrifuged at 1000 g for 10 min at 4  C. The pellet was resuspended in NE-1 buffer with 2.5% Triton-X-100 and incubated for half an hour at 4  C followed by centrifugation at 2000 g for 30 min at 4  C. The supernatant was used as cytoplasmic extract (CE). The pellet (nuclear) was resuspended in NE-2 buffer [600 mM KCl, 50 mM Tris/HCl pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol, 0.5 mM PMSF, 0.5 uM leupeptin, 1 mM pepstatin] and homogenized followed by centrifugation at 12,000 g for 30 min at 4  C. The supernatant was dialysed against 50 mM KCl, 50 mM Tris/HCl pH 8, 20% glycerol and used as nuclear extract (NE).

2.6. Ribosome isolation Ribosomes were isolated from E. coli as described previously [10]. Ribosome concentration was calculated spectrophotometrically using OD260 nm ¼ 1 unit for 18 pmol of ribosomes [11]. 2.7. Immunoprecipitation Immunoprecipitation

(IP)

was

performed

as

shown

by

38

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

2.12. Phosphorylation

3.3. PeIF5B-ribosome interaction

Phosphorylation of 1.25 mM of rPeIF5B by 20 units of each of protein kinase A (PKA), protein kinase C (PKC), casein kinase II (CKII) and DNA-dependent protein kinase (DNA-PK) (Promega, Madison, WI) was carried out in presence of 10 mCi of [g-32P]ATP (3000 Ci/mol) at 30  C for 10 min [14]. Phosphorylation was observed by autoradiography on X-ray film.

To show the interaction between PeIF5B and ribosome particles, crude preparation of E. coli ribosomes (Fig. 1F, lane 1) was incubated with anti-PeIF5B antibodies (lane 2) in the absence and presence of rPeIF5B (lanes 3 and 4). It was found that several ribosomal proteins were pulled down in presence of purified PeIF5B. However, in absence of PeIF5B there was no cross-talk between anti-PeIF5B antibodies and ribosomal proteins. This conclusively proves that the eIF5B homologue from P. sativum interacts with ribosomes (directly or indirectly).

2.13. Exon-intron analysis Different regions covering the entire PeIF5B gene were amplified using different sets of primers (Table 1). PCR amplification was carried out using both the cDNA clone, pPeIF5B [2] as well as P. sativum genomic DNA as template. PCR products were visualized on 1% agarose gel.

3. Results 3.1. PeIF5B binds to charged initiator tRNA PeIF5B, predicted after in silico analysis as translation initiation factor eIF5B homologue, was checked for interaction with charged initiator tRNA by filter binding assay. The formation of ternary complex (TC) by PeIF5B was evaluated by incubating E. coli charged initiator tRNA ðMet
tRNAf Met Þ with increasing amounts of protein (0e4 mg) in the presence of 1.5 mM MgCl2 and 250 mM GTP (Fig. 1A). The optimum binding was observed at 2 mg of PeIF5B protein. Further it was observed that formation of TC increased in a dosedependent manner with increasing GTP concentration till it reached saturation at 250 mM GTP (Fig. 1B). However, minimal counts were detected in the presence of GDP. The formation of ternary complex by PeIF5B was found to be optimum at 1 mM Mg2þ ion concentration and further increase in metal ion concentration appears to be inhibitory (Fig. 1C). To identify nucleotide-specificity, 2 mg of PeIF5B was incubated with 250 mM of one of the nucleotides (UTP, ATP, CTP, dGTP or GTP) in presence of 1.5 mM MgCl2. Formation of ternary complex appears to be favoured by GTP and dGTP but not by CTP, ATP or UTP (Fig. 1D).

3.2. PeIF5B shows metal ion-dependent GTPase activity Since GTPase activity is a universal feature of eIF5B and since PeIF5B shows GTP-binding [8], we checked GTPase activity of PeIF5B. rPeIF5B (0e20 pmoles) was incubated with [g-32P]GTP in presence of 5 mM MgCl2 (Fig. 1E, lanes 1e4). It is apparent from the figure that PeIF5B shows significant dose-dependent GTPase activity that was inhibited in presence of 10 mM EDTA (Fig. 1E, lane 5). These data point to metal dependent GTPase activity of PeIF5B.

3.4. PeIF5B functionally complements yeast eIF5B Since PeIF5B showed significant homology to its yeast counterpart [2] we examined if it can functionally complement yeast eIF5B in a growth complementation assay. For this purpose the growth rate of J111-FUN12, J111-PeIF5B and J111-vector strains was compared in minimal SD broth supplemented with leucine. It was clear from the growth curves (Fig. 2) that J111-vector has a slower growth phenotype, whereas, J111-FUN12 displayed a typical sigmoidal growth curve because of the rescue of endogenous FUN12 gene function by the extra-chromosomal plasmid carrying functional yeast eIF5B (yIF2). It is interesting to note that J111PeIF5B shows an intermediate growth rate between that of J111vector strain and J111-FUN12 strain. This demonstrates that PeIF5B partially complements the loss of yeast eIF5B in J111 strain.

3.5. PeIF5B has a functional NLS An NLS is predicted in PeIF5B as a short sequence stretch of lysine rich positively charged amino acids from residues 45 to 60 (http://cubic.bioc.columbia.edu/cgi/var/nair/resonline.pl) (Fig. 3A). In vivo localization study of PeIF5B in Hela cells shows that cells expressing full-length PeIF5B as a fusion protein with eGFP (PeIF5BeGFP) show fluorescence mainly in the nucleus while those expressing NLS-deleted PeIF5B as a fusion protein with eGFP (PeIF5BD180-eGFP) have fluorescence restricted to the cytoplasm (Fig. 3B). On the other hand, cells transfected with the vector control expressing free eGFP monomer show similar distribution as PeIF5B-eGFP. Since it is known that eGFP monomers are enriched in the nucleus versus the cytoplasm [15], this conclusively shows that full-length PeIF5B is mostly localized in the nucleus and hence the NLS is functional and drives the protein to the nucleus. This observation is complemented by the western blot analysis of cellular extracts of O. sativa leaves probed for PeIF5B (Fig. 3C). It can be seen from the figure that a distinct signal at a position corresponding to 132 kDa is visible in NE that corresponds to the predicted molecular weight of PeIF5B homologue in O. sativa. However, no such band was detected in CE. Hence, this observation further confirms that PeIF5B is mainly present in the nucleus.

Table 1 Primers to amplify different regions of the open reading frame in pPeIF5B clone. Primers

Region amplified

Sequence

Position in pPeIF5B

I-FP I-RP II-FP II-RP III-FP III-RP IV-FP IV-RP

I I II II III III IV IV

AAAAAGAAGAAAAAGAAGA ACATCATCCCAGCTTCTAG GAAGATGATGTTGAGGATG CAGGGGTGACTTTGACAT GGTTATTGAAGGCCATGG GTCTACCTCTATAAACCGG GCAAAGAAAGGGCAGAAAGTA CTTGTACACCATGGAAACC

204e222 923e941 895e913 2414e2431 1887e1904 3097e3115 2752e2772 3329e3347

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

39

Fig. 1. Biochemical properties of PeIF5B (A) Interaction of [35S]Met-charged initiator tRNA with rPeIF5B in presence of 250 mM GTP and 1.5 mM MgCl2. (B) Charged initiator tRNA and protein interaction as a function of 50e500 mM GTP (blue) and GDP (red) in presence of 1.5 mM MgCl2 (C) tRNA binding to rPeIF5B (2 mg) in presence of 250 mM GTP and Met increasing concentration of MgCl2. (D) 2 mg of protein was incubated with ½35 SMet
tRNAf in presence of 1.5 mM MgCl2 and 250 mM of different nucleotides. (E) GTPase activity 32 of PeIF5B. 0, 5, 10 and 20 pmoles protein incubated with g- PGTP (lanes 1, 2, 3 and 4, respectively) in presence of 5 mM Mgþ2 ions. Lane 5 is same as lane 4 with 10 mM EDTA (F) IP of E. coli ribosomes (lane 1) pulled down using anti-PeIF5B antibodies (lane 2) in absence and presence of rPeIF5B (lanes 3 and 4, respectively).

3.6. PeIF5B is phosphorylated by PKA and PKC

3.7. Pea eIF5B is an intron-less gene

In silico analysis of PeIF5B sequence predicted several phosphorylation sites. We checked for phosphorylation of PeIF5B by different kinases (Fig. 4), namely, PKA (lane 1), PKC (lane 2), CKII (lane 5) and DNA-PK (lane 6) in presence of [g-32P]ATP. It is clear from the autoradiograph that PeIF5B is phosphorylated by PKA and PKC (lanes 1 and 2) and not by CKII and DNA-PK (lanes 5 and 6). Lanes 3 and 4 show the control reactions where autophosphorylation status was checked for PKC and PKA, respectively. Therefore, it can be concluded that PeIF5B gets specifically phosphorylated by PKA and PKC.

To check for the presence or absence of introns in PeIF5B gene, different overlapping regions of PeIF5B (Regions IeV) (Fig. 5A) were amplified using various primer sets (Table 1) from both cDNA clone (pPeIF5B) and genomic DNA. It was observed that the size of PCR amplified products for all regions were the same when either cDNA or genomic DNA was used as template (Fig. 5B). This is only possible if there is no intron present in the genomic DNA within PeIF5B open reading frame proving PeIF5B as an intron-less gene.

4. Discussion Eukaryotic translation initiation factor 5B (eIF5B) plays a role in recognition of the AUG codon in the presence of other translation

40

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

Absorbance (600 nm)

2.5 2 1.5 1 0.5

213

183

161

137

113

90

71

59

35

19

0

0 Time (Hrs) Fig. 2. Growth complementation by PeIF5B in yeast. : J111 strain expressing yIF2; J111 strain expressing PeIF5B; A J111 strain transformed with vector control.

Fig. 4. PeIF5B phosphorylation with PKA (lane 1), PKC (lane 2), CK2 (lane 5) and DNAPK (lane 6). Lanes 3 and 4 showing phosphorylation by PKC and PKA, respectively, in the absence of rPeIF5B. Position of PeIF5B is marked by an arrow.

Fig. 3. PeIF5B is a nuclear protein (A) Diagrammatic representation of the position of NLS in PeIF5B polypeptide. (B) Subcellular localization of full-length PeIF5B fusion with eGFP (PeIF5B-eGFP) and NLS-deleted (PeIF5BD180-eGFP) forms of PeIF5B in Hela cells. As a control, hela cells were transfected with plasmid expressing free eGFP. (C) Western blot of NE and CE of Oryza sativa probed with anti-PeIF5B antibodies.

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

41

Fig. 5. Exon-intron analysis of PeIF5B. (A) Diagrammatic representation of different regions (IeV) of pPeIF5B clone. (B) PCR amplification of different regions (IeV) of pPeIF5B using cDNA (C) and genomic DNA (G) as templates.

factors, and promotes joining of the 60S ribosomal subunit. Although translation initiation factor eIF5B is reported from plant kingdom, like O. sativa, Arabidopsis thaliana, but functional characterization has not been done for any plant eIF5B. Here we present detailed functional characterization of PeIF5B that highlights its role in the cell. Cellular eIF5B facilitates the binding of initiator tRNA to the small ribosomal subunit [3,16]. PeIF5B showed dose-dependent tRNA-binding that was facilitated by GTP and Mg2þ ion. Guillon et al. [17] successfully showed the formation of a complex between charged initiator tRNA and yeast eIF5B and aIF5B from Sulfolobus solfataricus and Pyrococcus abyssi. Subsequent to charged initiator tRNA stabilization and ribosomal subunit joining, GTP-hydrolysis is required for the release of eIF5B along with eIF1A from the 80S ribosome [18]. Through UVcrosslinking experiment we confirmed the binding of PeIF5B to GTP [8]. Interestingly, PeIF5B showed metal ion-dependent and dose-dependent GTPase activity. Maone et al. [19] have shown ribosome-dependent GTPase activity for aIF5B from S. solfataricus. It is worth mentioning at this point that the possibility of minimal contamination of ribosomal proteins in PeIF5B preparation during purification of recombinant PeIF5B expressed in E. coli cannot be ruled out. Minimal ribosomal contamination may be enough to facilitate the inherent property of PeIF5B to hydrolyse GTP. Eukaryotic eIF5B is essential for the joining of ribosomal subunits in the presence of eIF1A in the late translation initiation step [18,20]. As evident from immunoprecipitation, PeIF5B shows interaction with bacterial ribosomal proteins. At present we have no evidence to conclude if this interaction is direct or indirect. It is to be noted that PeIF5B is a homologue of bacterial IF2 and as reported earlier [19] all IF2 like translation initiation factors maintain a broad ribosome-binding capacity.

Finally, by growth complementation assay, PeIF5B's functionality in cellular translation process was validated in S. cerevisiae. PeIF5B was found to partially complement the yeast counterpart. Similar partial complementation of the slow growth phenotype of defective yeast strain has been reported for human eIF5B and aIF5B from Methanocaldococcus jannaschii [21]. Jun et al. [22] have similarly shown that Candida albicans eIF5B complemented the slowgrowth phenotype of the fun12D strain. PeIF5B therefore appears to constitute a critical component of cellular translation machinery. From in vivo localization study by confocal microscopy, it was apparent that full-length PeIF5B was present in the nucleus whereas NLS-deleted PeIF5B was limited to the cytoplasm only. The Full length PeIF5B:GFP fusion protein was transported to the nucleus despite its large size due to the presence of the NLS which was recognized by nuclear transport machinery. The NLS deleted PeIF5B:GFP fusion protein, however, was unable to enter the nucleus due to possible size constrain. GFP protein alone could easily diffuse to the nucleus as reported earlier [15]. These results demonstrate that the N-terminal NLS drives PeIF5B protein into the nucleus. PeIF5B distribution was checked in O. sativa since PeIF5B shows 66% sequence identity and 80% similarity to its O. sativa homologue [2]. Accordingly, NE and CE were prepared from O. sativa and probed with anti-PeIF5B antibody. Complementing our earlier confocal data, PeIF5B homologue was detected in the NE. PeIF5B localization into the nucleus raises interesting questions. Apart from playing an important role in the cellular translation, PeIF5B may form a part of the nuclear translation machinery too. Despite skepticism regarding nuclear translation, several reports support the view that eukaryotic mRNA translation occurs both in the nucleus and the cytoplasm [23,24]. Several constituents of translation including aminoacylated tRNAs, ribonucleoparticles

42

S. Rasheedi et al. / Biochimie 118 (2015) 36e43

and several translation factors have been detected in the nucleus [25e27]. In vivo evidence for nuclear translation performed by active nuclear ribosomes in mammalian nuclei was given by Iborra et al. [23]. Using the ribopuromycylation method (RPM), David et al. [28] have provided convincing experimental evidence for translation in the nucleoplasm and nucleolus. Apcher et al. [29] have also supported the concept of nuclear translation by tracking the translational origin of MHC class I peptides. The Drosophila homologue of eIF5B has been shown by immunostaining to be present at transcription sites within the nucleus [24]. The other explanation for PeIF5B nuclear localization can be that it might have some other function unrelated to protein synthesis. Similar to PeIF5B, when analysed for the presence of NLS in human eIF5B by in silico analysis, a distinct NLS was predicted. However, human eIF5B is reported to be restricted in the cytoplasm [30]. At this stage we can only say that PeIF5B has the potential to translocate in and out of the nucleus. Further investigation will throw light on not just the mechanistic aspects of this trafficking but also on the likely functional significance. In vitro phosphorylation assay reveals that PeIF5B gets specifically phosphorylated by PKA and PKC. Phosphorylation is known to modulate translation factors functions in plants, mammals and yeast during development, stress and viral infection [31]. It is known that phosphorylation of eIF4A in hypoxic maize roots and eIF2a is a mode of stress-induced translational control [32e34] whereas eIF5 is phosphorylated by CKII during cell cycle progression and proliferation [35]. Specific phosphorylation of PeIF5B by PKA and PKC hints towards the possibility that it might be a means of regulating protein translation. Studying its functional significance can be an interesting aspect for in depth study. Another interesting feature associated with PeIF5B, not common to all eIF5B homologues, is that PeIF5B is an intron-less gene as apparent from exon-intron analysis. Yeast eIF5B also shares this characteristic. This correlates well with our phylogenetic tree analysis reported earlier where we have shown genetic closeness of PeIF5B with its yeast homologue [2]. This indicates a functional homology between these two homologues and their involvement in very similar mechanisms of translation initiation. Having said that, since PeIF5B might be part of this primitive machinery, this raises the possibility that PeIF5B not only takes part in nuclear translation but is itself synthesized in the nucleus and commute between the nucleus and the cytoplasm. At present there is no evidence in support or against the two scenarios. In conclusion, this is the first functional characterization study of an eIF5B homologue from plant system that helps us to build a better understanding of the cellular translation process in plants. The study supports the notion of universality of the eIF5B/IF2 mediated initiation process. It also highlights the interesting directions concerning a potential role of PeIF5B in nuclear translation in the nucleus. Further detailed studies on the mechanism and regulation of PeIF5B transport into the nucleus will significantly increase our knowledge of the regulation of gene expression by PeIF5B.

[2]

[3]

[4] [5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24]

Acknowledgements

[25]

S.R. and M.S. thank the CSIR and ICMR, respectively, for Senior Research Fellowship. Authors are thankful to Prof. Thomas Dever, NIH, Bethesda, USA for providing the yeast mutants. Authors also acknowledge the help provided by Jisha Chalissery in performing the GTPase assay.

[26]

References

[29]

[1] T.V. Pestova, J.R. Lorsch, C.U.T. Hellen, The mechanism of translation initiation

[27]

[28]

in eukaryotes, in: M. Mathews, N. Sonenberg, J.W.B. Hershey (Eds.), Translational Control in Biology and Medicine, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2007, pp. 87e128. S. Rasheedi, S. Ghosh, M. Suragani, N. Tuteja, S.K. Sopory, S.E. Hasnain, N.Z. Ehtesham, Pisum sativum contains a factor with strong homology to eIF5B, Gene 399 (2007) 144e151. S.K. Choi, J.H. Lee, W.L. Zoll, W.C. Merrick, T.E. Dever, Promotion of MettRNAMet binding to ribosomes by yIF2, a bacterial IF2 homolog in yeast, Scii ence 280 (1998) 1757e1760. A.G. Hinnebusch, J.R. Lorsch, The mechanism of eukaryotic translation initiation: new insights and challenges, Cold Spring Harb. Perspect. Biol. 4 (2012). N. Thakor, M. Holcik, IRES-mediated translation of cellular messenger RNA operates in eIF2a-independent manner during stress, Nucleic Acids Res. 40 (2012) 541e552. E. Galmozzi, A. Aghemo, M. Colombo, Eukaryotic initiation factor 5B: a new player for the anti-hepatitis C virus effect of ribavirin, Med. Hypotheses 79 (2012) 471e473. S. Lee, S.S. Truesdell, S.I. Bukhari, J.H. Lee, O. LeTonqueze, S. Vasudevan, Upregulation of eIF5B controls cell-cycle arrest and specific developmental stages, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) 4315e4322. S. Rasheedi, M. Suragani, S.K. Haq, Sachchidanand, R. Bhardwaj, S.E. Hasnain, N.Z. Ehtesham, Expression, purification and ligand binding properties of the recombinant translation initiation factor (PeIF5B) from Pisum sativum, Mol. Cell. Biochem. 344 (2010) 33e41. M. Suragani, S. Rasheedi, S.E. Hasnain, N.Z. Ehtesham, The translation initiation factor, PeIF5B, from Pisum sativum displays chaperone activity, Biochem. Biophys. Res. Commun. 414 (2011) 390e396. T.P. Primm, S.J. Andersen, V. Mizrahi, D. Avarbock, H. Rubin, C.E. Barry III, The stringent response of Mycobacterium tuberculosis is required for long-term survival, J. Bacteriol. 182 (2000) 4889e4898. G. Spedding, Isolation and analysis of ribosomes from prokaryotes, eukaryotes, and organelles, in: G. Spedding (Ed.), Ribosomes and Protein Synthesis: a Practical Approach, IRL Press, New York, 1990, pp. 1e29. N.Z. Ehtesham, T.-N. Phan, A. Gaikwad, S.K. Sopory, N. Tuteja, Calnexin from Pisum sativum: cloning of the cDNA and characterization of the encoded protein, DNA Cell Biol. 18 (1999) 853e862. T.N. Phan, N.Z. Ehtesham, R. Tuteja, N. Tuteja, A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 30 /50 direction, Eur. J. Biochem. 270 (2003) 1735e1745. R.N.V.S. Suragani, S. Ghosh, N.Z. Ehtesham, K.V.A. Ramaiah, Expression and purification of the subunits of human translational initiation factor 2 (eIF2): phosphorylation of eIF2a and b, Protein Expr. Purif. 47 (2006) 225e233. N.M. Seibel, J. Eljouni, M.M. Nalaskowski, W. Hampe, Nuclear localization of enhanced green fluorescent protein homomultimers, Anal. Biochem. 368 (2007) 95e99. B. Kuhle, R. Ficner, Structural insight into the recognition of amino-acylated initiator tRNA by eIF5B in the 80S initiation complex, BMC Struct. Biol. 14 (2014) 20. L. Guillon, E. Schmitt, S. Blanquet, Y. Mechulam, Initiator tRNA binding by e/ aIF5B, the eukaryotic/archaeal homologue of bacterial initiation factor IF2, Biochemistry 44 (2005) 15594e15601. J.M. Fringer, M.G. Acker, C.A. Fekete, J.R. Lorsch, T.E. Dever, Coupled release of eukaryotic translation initiation factors 5B and 1A from 80S ribosomes following subunit joining, Mol. Cell Biol. 27 (2007) 2384e2397. E. Maone, M.D. Stefano, A. Berardi, D. Benelli, S. Marzi, A.L. Teana, P. Londei, Functional analysis of the translation factor aIF2/5B in the thermophilic archaeon Sulfolobus solfataricus, Mol. Microbiol. 65 (2007) 700e713. B.-S. Shin, M.G. Acker, J.R. Kim, K.N. Maher, S.M. Arefin, J.R. Lorsch, T.E. Dever, Structural integrity of {alpha}-helix H12 in translation initiation factor eIF5B is critical for 80S complex stability, RNA 17 (2011) 687e696. J.H. Lee, S.K. Choi, A. Roll-Mecak, S.K. Burley, T.E. Dever, Universal conservation in translation initiation revealed by human and archaeal homologs of bacterial translation initiation factor IF2, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 4342e4347. K.O. Jun, E.J. Yang, B.J. Lee, J.R. Park, J.H. Lee, S.K. Choi, Functional equivalence of translation factor eIF5B from Candida albicans and Saccharomyces cerevisiae, Mol. Cells 25 (2008) 172e177. F.J. Iborra, D.A. Jackson, P.R. Cook, Coupled transcription and translation within nuclei of mammalian cells, Science 293 (2001) 1139e1142. S. Brogna, T.A. Sato, M. Rosbash, Ribosome components are associated with sites of transcription, Mol. Cell 10 (2002) 93e104. S. Sarkar, A.K. Azad, A.K. Hopper, Nuclear tRNA aminoacylation and its role in nuclear export of endogenous tRNAs in Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 14366e14371. G. Mangiarotti, Coupling of transcription and translation in Dictyostelium discoideum nuclei, Biochemistry 38 (1999) 3996e4000. E.M. Chudinova, P.A. Ivanov, E.S. Nadezhdina, Nuclear localization signals in p170, the large subunit of translation initiation factor 3, Mol. Biol. 38 (2004) 575e581. A. David, B.P. Dolan, H.D. Hickman, J.J. Knowlton, G. Clavarino, P. Pierre, J.R. Bennink, J.W. Yewdell, Nuclear translation visualized by ribosome-bound nascent chain puromycylation, J. Cell Biol. 197 (2012) 45e57. S. Apcher, G. Millot, C. Daskalogianni, A. Scherl, B. Manoury, R. Fåhraeus, Translation of pre-spliced RNAs in the nuclear compartment generates peptides for the MHC class I pathway, Proc. Natl. Acad. Sci. U. S. A. 110 (2013)

S. Rasheedi et al. / Biochimie 118 (2015) 36e43 17951e17956. [30] M.T. Bohnsack, K. Regener, B. Schwappach, R. Saffrich, E. Paraskeva, € rlich, Exp5 exports eEF1A via tRNA from nuclei and synE. Hartmann, D. Go ergizes with other transport pathways to confine translation to the cytoplasm, EMBO J. 21 (2002) 6205e6215. [31] D.R. Gallie, H. Caldwell, C. Le, R.L. Tanguay, N.X. Hoang, K.S. Browning, The phosphorylation state of translation initiation factors is regulated developmentally and following heat shock in wheat, J. Biol. Chem. 272 (1997) 1046e1053. [32] C. Webster, R.L. Gaut, K.S. Browning, J.M. Ravel, J.K.M. Roberts, Hypoxia enhances phosphorylation of eukaryotic initiation factor 4A in maize root tips,

43

J. Biol. Chem. 266 (1991) 23341e23346. [33] M.J. Clemens, Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis, Prog. Mol. Subcell. Biol. 27 (2001) 57e89. [34] T. O'Connor, K.R. Sadleir, E. Maus, R.A. Velliquette, J. Zhao, S.L. Cole,
bert, W.A. Eimer, B. Hitt, L.A. Bembinster, S. Lammich, S.F. Lichtenthaler, S.S. He B. De Strooper, C. Haass, D.A. Bennett, R. Vassar, Phosphorylation of the translation initiation factor eIF2alpha increases BACE1 levels and promotes amyloidogenesis, Neuron 60 (2008) 988e1009. [35] M.K. Homma, I. Wada, T. Suzuki, J. Yamaki, E.G. Krebs, Y. Homma, CK2 phosphorylation of eukaryotic translation initiation factor 5 potentiates cell cycle progression, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 15688e15693.