Functional characterization of the Helicobacter pylori chaperone protein HP0795

Microbiological Research 193 (2016) 11–19

Contents lists available at ScienceDirect

Microbiological Research journal homepage: www.elsevier.com/locate/micres

Functional characterization of the Helicobacter pylori chaperone protein HP0795 Dongjie Fan a , Qiming Zhou b,c , Chuanpeng Liu b , Jianzhong Zhang a,∗ a State Key Laboratory of Infectious Disease Prevention and Control, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China b School of Life Science and Technology, Harbin Institute of Technology, 2 Yikuang Street, Harbin, 150080, China c Beijing CapitalBio MedLab, 88 D2, Branch Six Street, Economic and Technological Development Zone, Beijing 101111, China

a r t i c l e

i n f o

Article history: Received 20 May 2016 Received in revised form 9 August 2016 Accepted 20 August 2016 Available online 23 August 2016 Keywords: Chaperone Trigger factor Peptidyl prolyl cis-trans isomerase Helicobacter pylori

a b s t r a c t Trigger factor (TF) is one of the multiple bacterial chaperone proteins interacting with nascent peptides and facilitating their folding in bacteria. While TF is well-characterized in E. coli, HP0795, a TF-like homologue gene identified earlier in the pathogenic Helicobacter pylori (H. pylori), has not been studied biochemically to date. To characterize its function as a chaperone, we performed 3D-modeling, crosslinking and in vitro enzyme assays to HP0795 in vitro. Our results show that HP0795 possesses peptidyl prolyl cis-trans isomerase activity and exhibits a dimeric structure in solution. In addition, stable expression of HP0795 in a series of well-characterized E. coli chaperone-deficient strains rescued the growth defects in these mutants. Furthermore, we showed that the presence of HP0795 greatly reduced protein aggregation caused by deficiencies of chaperones in these strains. In contrast to other chaperone genes in H. pylori, gene expression of HP0795 displays little induction under acidic pH conditions. Together, our results suggest that HP0795 is a constitutively expressed TF-like protein of the prokaryotic chaperone family that may not play a major role in acid response. Given the pathogenic properties of H. pylori, our insights might provide new avenues for potential future medical intervention for H. pylori-related conditions. © 2016 Elsevier GmbH. All rights reserved.

1. Introduction Chaperones are a family of proteins presented in both prokaryotic and eukaryotic cells, where they fulfill essential functions in nascent peptides folding, in preventing misfolding or aggregation of proteins and in maintaining protein homeostasis. Trigger factor (TF) is an archetypical E. coli chaperone, both in terms of its structure as well as its function. In the prokaryotic protein folding pathway, TF is the first chaperone in the pathway, where it interacts co-translationally with newly synthesized polypeptides emerging from the bacterial ribosome. TF maintains the nascent polypeptide in a non-aggregated state until completion of folding. In addition, TF promotes protein folding and participates in both the post-translational assembly of large protein complexes as well as in ribosome biogenesis (Merz et al., 2008; Hartl and Hayer-Hartl, 2009; Martinez-Hackert and Hendrickson, 2009; Hoffmann et al., 2010). E. coli TF, with ∼50 kDa molecular weight, is composed of

∗ Corresponding author. E-mail address: [email protected] (J. Zhang). http://dx.doi.org/10.1016/j.micres.2016.08.012 0944-5013/© 2016 Elsevier GmbH. All rights reserved.

three distinct domains: the N-terminal ribosome-binding domain, the C-terminal chaperone domain and the peptidyl-prolyl cis-trans isomerase (PPIase) domain in the centre (Kramer et al., 2004b; Merz et al., 2006). TF exhibits partial functional overlapping with DnaK, which is a central organizer of the chaperone network involved in proper protein folding in E. coli. In vivo, DnaK was shown to partially compensate TF knockout, as observed by the lack of defects in either growth or detectable protein folding in TF-deficient E. coli strains (Deuerling et al., 1999; Teter et al., 1999). In addition to their overlapping functions, TF possesses specific traits in the absent of DnaK. For instance, TF is essential for the biogenesis of outer membrane proteins (Calloni et al., 2012). Importantly, upon double-knockout of both DnaK and TF, E. coli growth is suppressed at most physiological temperatures, and was only viable in a narrow temperature range. Importantly, within this range protein aggregates were observed to accumulate (Deuerling et al., 1999; Teter et al., 1999; Genevaux et al., 2004). Together, these findings show that in vivo, the cooperation of TF and DnaK is necessary for maintaining proteostasis in vivo.

12

D. Fan et al. / Microbiological Research 193 (2016) 11–19

Helicobacter pylori (H. pylori) is the most important pathological bacterium to exclusively colonize the human stomach. Chronic infection with H. pylori is the pathological basis of peptic ulcer, stomach carcinoma and B-cell mucosa-associated lymphoid tissue lymphoma (Suerbaum and Michetti, 2002; Kusters et al., 2006; Cover and Blaser, 2009). For successful colonization in the stomach, H. pylori has developed a acid-adaptive mechanism, providing it with the ability to survive in the human stomach characterized by a large pH gradient across the organ (Wen et al., 2003; Kusters et al., 2006; Pflock et al., 2006). While a number of cell-intrinsic virulence factors, such as cagA and vacA, have been identified to be involved in virulence and pathogenicity of H. pylori (detailed in reviews: (da Costa et al., 2015; Mentis et al., 2015)). However, little research has focused on the field of chaperones involved in the biogenesis of virulence factors in H. pylori. Sequencing of the H. pylori 26695 genome has identified 1587 open reading frames (ORFs) (Tomb et al., 1997). Compared with ∼4290 ORFs in E. coli, the H. pylori genome is of relatively small size. Intriguingly, of those ORFs, only approximately 60% (∼950 ORFs) were assigned functions. In addition, a considerable number of ORFs were assigned putative functions (Davidsen et al., 2010). Therefore, it is of paramount importance to understand the biological function of these uncharacterized proteins to obtain a more detailed understanding of the pathogenic mechanisms of H. pylori. Earlier studies on pathogenic bacteria showed that expression and function of chaperones are correlated with exposure to various types of stress, including antibiotics, pH fluctuation and oxidative stress (Wolska et al., 2000; Modrzewska et al., 2002; Yamada et al., 2010; Tran et al., 2011). Here, we studied the H. pylori ORF named HP0795 annotated with a hypothetical chaperone function. Despite the availability of its sequence information, little research has been conducted to identify and characterize the HP0795 protein. The aim of this study was to understand the biological function of HP0795. Using genetic and molecular approaches, we demonstrated that HP0795 (a homolog of E. coli TF) plays a role as a molecular chaperone, possessing PPIase activity. 2. Methods and materials 2.1. Bacterial strains and growth conditions H. pylori 26695 was cultivated on Campylobacter agar (CM0935, OXOID) plates supplemented with 5% sheep blood, cefsulodin, vancomycin, trimethoprim and amphotericin B (SR0147E, OXOID) under microaerophilic environment (5% O2, 10% CO2 and 85% N2 ) at 37 ◦ C. For H. pylori acid-exposure experiments, H. pylori 26695 harvested in Campylobacter agar plate for 2 days according to culture condition mentioned above. Afterwards H. pylori were resuspended in brucella broth (BD) containing 10% fetal bovine serum (GibcoBRL) supplemented with by addition of 200 mM HCl until a pH of 3.0 and 5.0, shaking in 200 rpm for 2 h. Acid-exposure and nonexposure H. pylori were immediately collected by centrifuge in 4000 rpm, frozen in liquid nitrogen and were subsequently used for isolation of H. pylori RNA. Wild-type E. coli BW25113 and E. coli mutants were cultured either at 37 ◦ C or 30 ◦ C, with shaking at 220 rpm in Luria-Bertani (LB) medium supplemented with the appropriate antibiotics. 2.2. Bioinformatic analysis The ClusTALO program in Uniprot website (www.uniprot.org/ align) was used to perform comparisons of identity and similar positions between homology sequences of proteins. The secondary structural prediction and formatted multiple sequence alignment

Table 1 Primers used in this study. Primers for HP0795 expression HP0795exF:

5 -catatgcatgaatcttgaagtgaaaaagattga-3

HP0795exR:

5 -ggatccttaacccgcttgaattttttgagc-3

Primers for RT-PCR Hp16sRNAF: 5 -gctctttacgcccagtgattc-3 Hp16sRNAR: 5 -gcgtggaggatgaaggtttt-3 HP0795F: 5 -aagggttgaggggcagttgttt-3 HP0795R: 5 -gcttttctttggctttttcttgac-3 Primers used to construct strains T0795FOR 5 -taagagttgaccgagcactgtgattttttgaggtaacaagatgaatcttgaagtgaaaaagattga-3 T0795REV 5 -ggcctttgtgcgaatttagcgcgttatgctgcgtaaattaacccgcttgaattttttgagc-3 Gtig1 5 -acaccgtctttgcctctcct-3 Gtig2 5 -atctcgttcgccgctgtat-3 K-KJA 5 -cagactcacaaccacatgatgaccgaatatatagtggagacgtttagtgtaggctggagctgcttcg3 K-KJB 5 -caccctatttttacccaggcctgcccacgggcaggcttttggggaggcatatgaatatcctccttag-3 GKJ1 5 -agtcaaccgcagtgagtga-3 GKJ4 5 -cactttacaggtgctcgcat-3 Primers used to yeast two-hybrid assays HP0795BKF 5 -catatgatgaatcttgaagtgaaaaagattga-3 HP0795BKR

5 -ggatccttaacccgcttgaattttttgagc-3

HP0921ADF

5 -catatgatgaaaatttttatcaatggatttggccg-3

HP0921ADR

5 -gaattcttaataatgatacataaactgcgccatatcca-3

F: forward primer; R: reversed primer. Underlined letters indicate nucleotides added at the 5 end to create a restriction site. AD and BK indicate cloning gene into pGAD or pGBKvector.

were performed using the PSIPRED (bioinf.cs.ucl.ac.uk/pripred) and BoxSHade Server 3.2 (http://www.ch.embnet.org/software/BOX form.html). The protein subcelluar location was predicted in TargetP 1.1 server (Emanuelsson et al., 2007). The 3-D structure model of HP0795 as a putative protein in H. pylori was performed in SWISSMODEL Repository (Kiefer et al., 2009) and drawn using PyMOL software (www.pymol.org). 2.3. Gene cloning, expression and purification The HP0795 fragment (Gene ID: 899053) in H. pylori 26695 was amplified by PCR using gene-specific primers pair HP0795exF and HP0795exR (Table 1) containing Nde I and BamH I sites of pET28b vector (Novagen) to generate an N-terminal His tag fusion protein. The E. coli BL21 cells carrying the resulting plasmids were grown in LB media containing kanamycin at 37 ◦ C until an OD600 of 0.7. Expression of HP0795 was induced with 1 mM isopropyl-ßd-thiogalactopyranoside (IPTG) followed by culturing for 12 h at 18 ◦ C. Cells were centrifuged (4000g, 4 ◦ C, 15 min), resuspended in buffer A (20 mM sodium phosphate, 50 mM NaCl, pH 7.8) and passed through a French press. Brocken cells were centrifuged at 15,000g (4 ◦ C, 20 min). The HP0795 proteins were collected at buffer B (20 mM sodium phosphate, 50 mM NaCl, 250 mM imidazole, pH 7.8) using immobilized metal affinity chromatography. HP0795 proteins were further dialyzed against phosphate buffer (20 mM sodium phosphate, 50 mM NaCl, pH 7.8) to remove excess imidazole. Purified HP0795 proteins were analyzed using SDS-PAGE on a 10% polyacrylamide gel and visualized after Coomassie blue staining. Concentration of HP0795 was determined using a bicinchoninic acid (BCA) protein assay. 2.4. Crosslinking and electrophoresis HP0795 at different concentrations was crosslinked using 6 mM disuccinimidylsuberate (DSS, Pierce) dissolved in DMSO at 25 ◦ C in 20 mM sodium phosphate buffer, pH 7.8. Following incubation for 2 h, the crosslinking reaction was stopped by adding 150 mM Tris–HCl, pH 7.0. The crosslinked products were analyzed by 10% SDS-PAGE and visualized by Coomassie blue staining. The crosslinked and uncrosslinked HP0795 was quantified using ImageJ software

D. Fan et al. / Microbiological Research 193 (2016) 11–19

(Schneider et al., 2012). In order to obtain the fraction of crosslinked HP0795 at each given HP0795 concentration, fcrosslinked , the Kd was determined on the basis of the quantification results on the assumption that in solution, HP0795 monomers and dimers are present in an equilibrium, and Kd = M2 /D, where Kd is equilibrium dissociation constant for HP0795 monomer-dimer, M and D represent monomer and dimer concentrations, respectively. The Kd was calculated and fitted through the equation 



fcrosslinked =

1−

−Kd +

Kd2 +8×c×Kd 4×c



× r (Liu et al., 2005), where

c and r are the total concentration of HP0795 and the efficiency of the crosslinking reaction, respectively. 2.5. HP0795-complemented strain construction The E. coli mutant strains Z416-0795 and Z416-0795- were constructed as previously described (Datsenko and Wanner, 2000; Zhou et al., 2010). Briefly, the primer pair T0795FOR and T0795REV (Table 1) whose 5 region was homologous to the flanking regions of E. coli tig gene and 3 region was homologous to the flanking regions of H. pylori HP0795 were used to amplify a HP0795 gene from the H. pylori 26695 genomic DNA. To replace its cat-sacB, the E. coli mutant strain Z416 harboring the vector pKD46 was transformed using the HP0795 gene PCR products by electroporation. We screened for sucrose-resistant strains using LB plates containing 10% sucrose, and then characterized positive clones by PCR using the primer pairs Gtig1 and Gtig2 (Table 1) targeting the upstream and downstream regions of original E. coli tig, respectively. Correct sequences were confirmed by gene sequencing, and positive E. coli clones were labeled Z416-0795. A kanamycin resistance gene (kan) was amplified from the plasmid pKD4 using the primer pair K-KJA and K-KJB (Table 1) whose 5 region was homologous to the flanking regions of E. coli dnaK/dnaJ gene. The E. coli Z416-0795 harboring vector pKD46 was transformed using the kan products by electroporation to replace its dnaK/dnaJ gene. The kanamycin-resistant clones were named Z4160795- were further characterized by PCR using primer pair GKJ1 and GKJ4 (Table 1), and confirmed by sequencing.

13

1250 ␮l buffer B (10 mM sodium phosphate, 1 mM EDTA, pH 6.5) was added and cells were disrupted by sonication (5 s on/off, 5 min at 42 W) on ice. Remaining intact cells were removed by centrifuging at 2000g for 15 min at 4 ◦ C. Crude membrane and aggregated proteins was isolated by the second centrifugation at 15,000g for 20 min at 4 ◦ C, then frozen at −80 ◦ C, thawed and resuspended in 1 ml buffer B. Subsequently, samples were sonicated again and centrifuged at 15,000g. Next, two sonication steps were performed, followed by a third centrifugation step at 15,000g. Pellets were then resuspended in 1 ml buffer B, sonicated, mixed with 250 ␮l 10% Nonidet-P40 and centrifuged at 15,000g. 2.8. Measurement of peptidyl prolyl cis-trans isomerase (PPIase) activity The PPIase activity of HP0795 was measured using the chymotrypsin-coupled assay as described previously (Fischer et al., 1984). In this assay, succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Sigma) functioned as the substrate. Briefly, tetrapeptide substrate was dissolved in DMSO for a final concentration of 2 mM and pre-equilibrated in 1 ml of 35 mM HEPES buffer (pH 7.8) for 1 min. The reaction was started by adding 20 ␮l HP0795 protein (0–4 ␮M). After 0.5 min, the 10 ␮l ␣chymotrypsin (Sigma, 20 mg/ml) was added into reaction system. The absorbance at 370 nm was monitored. The catalytic efficiency (kcat /KM ) was derived from a plot of measured rate constant of isomerization as a function of HP0795 concentration. All experiments were performed using a UV-spectrophotometer (UV-3900 HITACHI) at a constant temperature of 10 ◦ C. 2.9. Yeast two-hybrid assays Protein-protein interactions between HP0795 and HP0921 were detected using Matchmaker Gold Yeast Two-Hybrid System (Clontech). Bait and prey plasmid construction, yeast transformation and cultivation were performed following the manufacturer’s instructions. Primers used in the yeast two-hybrid assays are listed in Table 1. 2.10. Quantitative real-time PCR

2.6. Bacterial viability as a function of temperature The wild-type E. coli BW25113, HP0795-complemented E. coli strains Z416-0795 and Z416-0795-, together with additional mutant E. coli strains were cultivated at 30 ◦ C for 12 h with or without corresponding antibiotics as listed in Table 2. All cultures were diluted with LB buffer to obtain identical OD600 readings, and were then serially diluted. 5 ␮l of each culture were spotted onto one plate per temperature, and then incubated either at 18 ◦ C for 96 h, or 28 ◦ C and 37 ◦ C for 24 h. 2.7. Isolation of aggregated proteins Aggregated proteins were isolated from E. coli as previously described (Tomoyasu et al., 2001). The wild-type E. coli BW25113, HP0795-complemented E. coli strains Z416-0795 and Z416-0795, and some E. coli mutant strains excluding Z629, were cultivated at 37 ◦ C for 12 h. Importantly, Z629 were cultivated at 30 ◦ C for 8 h following supplementation with kanamycin and chloramphenicol, before being heat-shock treated at 37 ◦ C for 4 h. After calculating the cell density on the basis of OD600, cell concentration adjusted, and then an equal amount of bacteria was then harvested. The cell pellets of every sample from approximate 50 ml cultures were collected by centrifuging 10 min at 6000g, resuspended in 250 ␮l buffer A (10 mM sodium phosphate, 1 mM EDTA, 20% sucrose, 2 mg/ml lysozyme, pH 6.5) and incubated on ice for 30 min. The

To determine the transcriptional expression of HP0795 following exposure of bacterial strains to low pH conditions, the total RNA was extracted from acid-exposed and control H. pylori, which was then reverse-transcripted into cDNA using QuantiTect® Reverse Transcription kit (QIAGEN, Germany). Quantitative realtime (RT-PCR) amplification was performed using the BIO-RAD CFX96TM Real-time System, with one cycle at 95 ◦ C for 10 s and 40 cycles at 95 ◦ C for 5 s and 60 ◦ C for 30 s. Each 25 ␮l reaction mixture contained 12.5 ␮l SYBR Premix Ex TaqTM (Takara). Data were normalized to 16sRNA expression for each pH treatment, with 3 biological replicates performed. The relative gene expression was calculated using the 2−(Ct) method. Primers used for PCR amplification are listed in Table 1. 3. Results and discussion 3.1. Bioinformatic analysis of pylori HP0795 In order to obtain more precise information on sequence conservation and localization of HP0795, we performed homology and subcellular location analysis for HP0795 and its homologs in three gastrointestinal bacteria. As shown in Fig. 1, the HP0795 gene (Gene ID: 899053) in H. pylori 26695 genome contains 1353 bp, which encodes a 451-aa-long protein with a predicted molecular weight of 51 kDa (UniProt ID: P56420). Sequence alignment of HP0795

14

D. Fan et al. / Microbiological Research 193 (2016) 11–19

Table 2 Strains and plasmids used in this study. Strains

Description

Source or reference

H. pylori 26695 E. coli BW25113 Z416 Z125 Z629 Z416-0795 Z416-0795-

Parental strain F-, DE(araD-araB)567, lacZ4787(del):rrnB-3, LAM-, rph-1, DE(rhaD-rhaB)568, hsdR514 E. coli BW25113 tig:cat-sacB E. coli BW25113dnaKJ:kan E. coli BW25113 tig:cat, dnaKJ:kan E. coli BW25113 tig:HP0795 E. coli BW25113 tig:HP0795, dnaKJ:kan

Tomb et al. (1997) Datsenko and Wanner (2000) Zhou et al. (2010) Zhou et al. (2010) Zhou et al. (2010) This study This study

with its homologs in other strains of enteric pathogenic bacteria revealed that the HP0795 sequence is conserved to similar extent for each pair at the amino acid level: to E. coli TF P0A850 (25.983% identity and 172 similar positions), Vibrio cholera Q9KQS5 (25.764% identity and 171 similar positions) and Salmonella enteric subsp. enteric serovar Enteritidis str. EC20120916A0A0E1CW51 (26.638% identity and 166 similar positions). Using Target.P software prediction, we showed that HP0795 lacks a signal peptide, suggesting that HP0795 is localized in the cytosol. In order to investigate the structure of HP0795 in further detail, we performed secondary structure prediction combined with 3D homology-modeling using the SWISS-MODEL server. As shown in Fig. 1, HP0795 consists of three domains, namely domain I, II and III. Domain I (1–118 aa) contains a ribosome-associated motif (G43 F44 R45 X46 G47 X48 X49 P50 ) located in a flexible loop. This domain consists mainly of ␣-helical barrels mixed with 4 ß-strands. Domain II (167–252 aa) consists of a four-stranded ß-sheet and a short ␣-helix inserted between two of the ␤-sheets, forming an architecture highly similar to that of the peptidyl prolyl cis-trans isomerase (PPIase) fold architecture. Domain III (119–166 aa and 253–452 aa) mostly consists of ␣-helices. It also contains a L-loop, which, together with the smaller part of one ␣-helix (residues 119–166) connects Domain I with domain II. Domain I and domain II are spa-

tially separated by Domain III, which is located in the center of the HP0795 molecule. Using the DNAStar software, we determined the isoelectric point of HP0795, which was predicted to be 5.29. This value is slightly more basic than that of E. coli TF (pI = 4.83), which is in agreement with the fact that HP0795 contains a higher number of strongly basic amino acids (71 Arg and Lys in HP0795 versus 61 in E. coli TF) in HP0795. This finding suggests that under acidic conditions (as found for instance in the digestive stomach), HP0795 displays higher solubility than E. coli TF, thus, resulting in lower degree of aggregation of the HP0795 protein under such extreme conditions. This in turn, might allow for efficient functioning of this putative chaperone during substrate biosynthesis. Together, these results provide strong evidence that HP0795 from H. pylori is a highly conserved TF-like chaperone with its own unique structural characteristics and is an appropriate model to study biological function of TF in H. pylori. 3.2. HP0795 forms dimers in solution The correct oligomeric state of a protein under physiological conditions is essential for its proper biological functioning (Griffin and Gerrard, 2012). In order to investigate the oligomeric state

Fig. 1. Protein sequence alignment of HP0795 with its homologous. Sequence alignment was made in CLUSTAL Omega and formatted using BoxSHade Server 3.2. The UniProt accession numbers of HP0795 homologous from different bacteria are as follows: Helicobacter pylori, P56420; Escherichia coli, P0A850; Vibrio cholera, Q9KQS5; Salmonella enteric, A0A0E1CW51. The predicted secondary structural elements of Helicobacter pylori HP0795 are shown on the lines below the sequence alignment. Yellow arrows present ß-strand, magenta cylinder present ␣-helix and black straight lines present coli-coli. Residues strictly conserved have a black background and residues conserved between groups have a gray background. The ribosome-associated motif is showed in red box and marked as green amino acid structure in the below scheme of predicted overall structure of HP0795. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

D. Fan et al. / Microbiological Research 193 (2016) 11–19

15

ing a different functional type of psychrophilic chaperones (Piette et al., 2010). In summary, our cross-linking approach clearly indicates that HP0795 is able to form dimers under physiological conditions, similar to its E. coli homolog, suggesting that this putative chaperone HP0795 fulfils its function in the dimeric form. 3.3. HP0795 partially rescues coli TF deletion

Fig. 2. Dimerization of HP0795. (A) Different concentration HP0795 was cross linked by 6 mM DSS and separated by SDS-PAGE. M indicates the lane where the molecular weight markers were loaded. The symbol – indicates the lane where the DSS was not added. The symbol + indicates the lane where the DSS was added. (B) Influences of concentration of HP0795 on the relative cross linked amount were analyzed using ImageJ software. Date was fitted according to function in methods and materials.

of HP0795 in solution, we performed DSS-crosslinking experiments with HP0795 at different concentration. As shown in Fig. 2A, in the absence of DSS, a 50 kDa band was observed, suggesting that under denaturing SDS conditions, HP0795 is present in its monomeric form. Following the addition of DSS, a single band of approximately 120 kDa was detected, suggesting that following cross-linking conditions, the dimeric form of HP0795 has been preserved. With increasing concentrations of HP0795, the HP0795-dimer band became more clearly visible, suggesting that the equilibrium between the two states of HP0795 shifted towards its dimeric form. As shown in Fig. 2B, analysis of the fitting curve showed that there is a non-linear dependence between HP0795 concentration and dimer fraction, and that the Kd for the equilibrium between the two forms of HP0795 is 4.3 ␮M, suggesting that HP0795 is present in both monomeric and dimeric form under cellular conditions. Several earlier studies using E. coli TF showed that its activated form interacts with ribosomes and translating polypeptides in a dynamic reaction cycle (Kaiser et al., 2006). More specifically, free E. coli TF molecules were shown to rapidly cycle between their monomeric and dimeric form in solution, with varying selfdissociation constants Kd of either 18 ␮M or 1.8 ␮M, depending on the analytic techniques used (Patzelt et al., 2002; Maier et al., 2003; Liu et al., 2005). These earlier findings indicated that an equilibrium exists between the E. coli TF monomer and dimer, and also demonstrated that its dimeric form is present in vivo. However, TF of the extremophile Pseudoalteromonas haloplanktis TAC125 was shown to exist exclusively as a stable monomer chaperone, thus represent-

As H. pylori is not a model organism suitable for standard genetic manipulation, we used a number of well-characterized single and triple chaperone-deleted mutant E. coli strains, from which genes tig or tig/dnaK/dnaJ had been deleted (Zhou et al., 2010), to investigate the biological function of H. pylori HP0795. To this end, HP0795 was cloned into the tig loci of the E. coli strain Z416, to construct the complementary strain Z416-0795. Using Z416-0795, we constructed the mutant strain Z416-0795-, in which dnaK/J (genes whose proteins functionally overlap with TF) were deleted. All mutant strains with corresponding genetic background used in this study are listed in Table 2. As previous studies showed, single or triple chaperone-deleted strains exhibit an aberrant cell phenotype, synthetic lethality or cytosolic protein aggregation, especially at temperatures above 30 ◦ C (Deuerling et al., 1999; Mogk et al., 1999; Teter et al., 1999; Genevaux et al., 2004). To test whether HP0795 can complement TF function, cultures of wild-type BW25113, Z416-0795 and Z416-0795-, together with Z125, Z416 and Z619 were first serially diluted and spotted on LB agar plates at normal culture temperature (37 ◦ C) or lower temperature(28 ◦ C and 18 ◦ C) to assess potential differences in cell phenotype. As shown in Fig. 3, the Z629 mutant strain exhibited a highly temperature-sensitive phenotype. Among all strains, the colony numbers of this mutant was lowest at all temperatures, with very few colonies visible at 37 ◦ C. At 28 ◦ C and 18 ◦ C, the HP0795-complemented strain Z416-0795 exhibited similar growth characteristics as wild-type BW25113, with even higher proliferation rates at 37 ◦ C. At 37 ◦ C, the HP0795-complemented strain Z416-0795 displayed a higher colony number than the single chaperone-deleted strains Z125 and Z416, and growth was better than that observed for the triple-chaperone-deleted strain Z629 at all temperatures. Together, these results show that complementation of H. pylori HP0795 suppresses growth defects derived from deletion of chaperone E. coli TF, indicating that H. pylori HP0795 share similar function with E. coli TF. The increased growth rate observed for Z416-0795 relative to Z416 at 37 ◦ C indicated that HP0795 complements E. coli TF deletion and is able to execute chaperone function of E. coli TF in vivo, especially at 37 ◦ C. The weaker growth phenotype occurred in Z416-0795- compared with Z416-0795 at all temperatures, indicating that deletion of DnaK resulted in more severe growth defects and rendered bacteria more sensitive to temperature fluctuation. Compared with Z416-0795-, higher growth defects were observed for Z125 (both of which are based on the same dnaKJ background) at 37 ◦ C, however, not at 28 ◦ C. Together, these observations strongly indicate that the HP0795 possesses higher thermostability than its E. coli homolog TF. 3.4. HP0795 prevents protein aggregation in vivo The combined deletion of TF/DnaKJ chaperones was previously shown to exacerbate the problem of cellular protein aggregation (Deuerling et al., 1999, 2003; Genevaux et al., 2004). In order to investigate whether HP0795 possesses the ability to prevent aggregation in vivo, we compared protein aggregation between HP0795-free mutants and HP0795-complemented mutant strains (Fig. 4). To this end, the whole cell extracts were prepared for

16

D. Fan et al. / Microbiological Research 193 (2016) 11–19

Fig. 3. HP0795 is beneficial to E. coli survival via complemented chaperone function with E. coli TF. Overnight cultures (24 h and 96 h) of wild-type BW25113, HP0795complemented strains and its various mutant derivatives were serially diluted and spotted on LB agar plates at the indicated temperatures.

The highest accumulation of protein aggregates was found in Z629 in dnaKJ/tig background. Following complementation of HP0795 in Z629, protein aggregation was efficiently suppressed in Z416-0795-. The level of protein aggregates decreased in Z416-0795 relative to Z416, which suggest that HP0795 efficiently prevents protein aggregation, presumably by HP0795 functioning as chaperone of E. coli TF. The complementation of HP0795 was further validated by the appearance of similar protein aggregation in Z416-0795- and Z125 in the same dnaKJ background. Together, the improved growth phenotype of HP0795complemented strains and the decrease in protein aggregates seen in HP0795-complemented strains suggest that HP0795 has a positive effect on bacterial growth. This effect might be caused by the fact that in the absence of its homologous E. coli TF, HP0795 prevents polypeptides from aggregation in vivo. This is in agreement with previous reports, as preventing protein aggregation is one of the well-known chaperone functions (Hoffmann et al., 2010). Furthermore, over-production of TF was previously shown to increase the quantity of aggregation-prone proteins, while repressing the formation of inclusion bodies (Nishihara et al., 2000; Li et al., 2001). Here, we showed that non-overexpression of complemented HP0795 under the control of the promoter of E. coli tig. Therefore, this complementary mode of HP0795 effectively inhibits accumulation of aggregated-prone proteins. 3.5. HP0795 possesses peptidyl prolyl cis-trans isomerase activity

Fig. 4. The expression of HP0795 in chaperone-deleted E. coli strains relieved protein aggregation. Coomassie-stained gel depicting with whole-cell extracts (A) and aggregation proteins (B) isolated from wild-type and mutant strains. The numbers indicate names of wild-type and mutant strains: 1, BW25113; 2, Z416-0795; 3, Z125; 4, Z629; 5, Z416-0795-; 6, Z416. The symbol + indicates appearance of TF or DnaK/J in strains, − indicates deletion of TF or DnaK/J, = indicates complementation of HP0795 in strains. From Top to bottom, mass scale from to ∼209 to 5 kDa in each gel.

each strain to serve as controls indicating total protein expression in strains (Fig. 4A), and protein aggregation was measured using denaturing gel electrophoresis (Fig. 4B).

Using bioinformatic analysis, we established that residues 167–252 of HP0795 form the PPIase domain of HP0795. In order to investigate whether HP0795 possesses PPIase activity, a protease-coupled activity assay combined with proline-containing tetrapeptide was used to measure HP0795 catalytic efficiency. At low temperatures, such as those employed in our assay, the isomerization of prolyl bonds in tetrapeptides from cis to trans is relatively slow. As shown in Fig. 5A, addition of HP0795 accelerated the isomerization of tetrapeptide substrates from cis to trans. With increasing HP0795 concentrations, the isomerization reaction was accelerated. Monoexponential functions were fit to the progress curves in Fig. 5A. Following the fitting of monoexponential functions in Fig. 5A, we observed that the first-order rate constant catalyzed isomerization of HP0795 increases in a linear fashion with an increase of HP0795 concentration (Fig. 5B). Using the slope obtained in Fig. 5B, we calculated the catalytic activity of PPIase in HP0795 as kcat /KM value 3.9 × 105 ± 0.1 M−1 s−1 . This result confirmed that H. pylori HP0795 possesses PPIase activity, as predicted from the analysis of the primary sequence of HP0795.

D. Fan et al. / Microbiological Research 193 (2016) 11–19

17

Fig. 6. The interaction between HP0795 and HP0921 in yeast two-hybrid system. SD (Leu-, Trp-) was used for selecting the bait and prey constructs; SD (Leu-, Trp-, His-, Ade-, AbA+, X-␣-Gal + ) was used for selecting the interaction between HP0795 and HP0921. AbA, Aureobasidin A; PC, positive control; NC, negative control.

strates (Liu et al., 2010). Together, the presence of PPIase activity suggests that HP0795 is a type of TF chaperone in H. pylori. PPIase is often correlated with virulence in pathogenic bacteria (Alonzo et al., 2009; Obi et al., 2011; Unal and Steinert, 2014). For instance, virulence of TF homologues with PPIase activity has been observed in pathogens Streptococcus suis and Streptococcus mutans (Wen et al., 2005; Wu et al., 2011). Considering that H. pylori survive in the stomach as a pathogen, the PPIase activity HP0795 may contribute to the virulence of H. pylori. 3.6. HP0795 interacts with HP0921

Fig. 5. PPIase activity of HP0795. (A) Isomerization of tetrapeptides substrate was monitored by an increase of the absorption at 370 nm in presence of (from bottom to top) 0, 0.8, 1.4, 2.0, 2.6, 3.2, 4.0 ␮M of HP0795. (B) Radio of the observed rate constants as a function of the HP0795 concentration. From the slope a kcat /KM value of 3.9 × 105 ± 0.01 M−1 s−1 for HP0795 was determined.

As shown previously, the peptidyl prolyl cis-trans isomerase activities of TF homologous exhibits a string dependence on the nature of the Xaa residue of the Xaa-Pro bond in tetrapeptides (Stoller et al., 1995; Jakob et al., 2009). Previous research indicated that the kcat /KM value of E. coli TF is either 0.71 × 105 or 1.6 × 105 M−1 s−1 (Stoller et al., 1995; Tradler et al., 1997), both of which are lower than the kcat /KM value of H. pylori HP0795. Compared with the two assays mentioned above, identical tetra-peptides substrates, the same UV monitoring method in protease-coupled assay and the same experimental temperature were employed in PPIase activity analysis of HP0795. Given that kcat /KM value is a composite value that indicates the efficiency of an enzyme at low substrate concentrations, the higher kcat /KM value for HP0795 suggested that HP0795 was significantly more effective than E. coli TF at catalyzing cis-trans isomerization of tetrapeptide substrates. Prolyl isomerization is strongly temperature-dependent (Schmid, 2005; Godin-Roulling et al., 2015; Schmidpeter and Schmid, 2015). Considering that both H. pylori and E. coli belong to the group of gastrointestinal bacteria surviving at similar physiological temperatures, it appears fitting that kcat /KM values for HP0795 and E. coli TF are of the same order of magnitude in catalyzing the same tetrapeptide substrates. It is one of the characteristics of the E. coli chaperone TF that it catalyzes the peptidyl prolyl cis-trans isomerization reaction, a rate-limiting step in protein folding (Scholz et al., 1997; Kramer et al., 2004a). In addition, the PPIase domain of E. coli TF also acts as an auxiliary chaperone site to assist the folding of protein sub-

E. coli TF is involved in the folding and assembly of many proteins and protein complexes. For example, while the depletion of TF increased the abundance of endogenous d-glyceraldehyde-3phosphate dehydrogenase (GAPDH) in insoluble cellular fraction (Martinez-Hackert and Hendrickson, 2009; Calloni et al., 2012). Earlier reports suggested that TF promoted the folding and assembly of homomultimeric GAPDH in vitro by multiple binding-release cycle (Huang et al., 2000; Liu et al., 2010; Piette et al., 2010). Here, in order to find the direct evidence in vivo for the interaction between HP0795, the counterpart of E. coli TF in H. pylori, and H. pylori GAPDH, we performed yeast two-hybrid assays. Both HP0921 and HP1346 encode GAPDH in the H. pylori 26695 genome. Therefore, the prey vector containing HP0921 or HP1346 and bait vector containing HP0795 were co-transformed into Y2HGold yeast strain. As shown in Fig. 6, under the most highly stringent growth conditions (SD (Leu-, Trp-, His-, Ade-, AbA+, X-␣-Gal+)), the interaction between HP0795 and HP0921 was identified in vitro as blue colonies. Our results suggested that HP0921 is a potential endogenous interaction partner of HP0795. Y2H analysis is a convenient method to allow the direct recognition of protein interaction between HP0795 and HP0921 pairs in yeast cell. However, it is well known that false positive interactions probably occur in Y2H analysis. In addition, coverage in detecting protein interactions by Y2H analysis is lower than by purifying of protein complex coupled to mass spectra (MS) (von Mering et al., 2002). Therefore, to verify the interaction of HP0795 and HP0921, and to detect more interaction partners of HP0795 in H. pylori, pull-down followed by MS will be required. 3.7. Acid fluctuation did not induce transcriptional change of HP0795 H. pylori is well adapted to the low pH environment of the stomach. In the process of colonizing the stomach, H. pylori encounter considerable pH fluctuations within the range of pH 1.0–pH 5.0 (Sachs et al., 2003; Scott et al., 2007). It was previously shown that gene expression of several H. pylori chaperone genes, such as HP1332, HP0109, HP0010 and HP0110 changed markedly upon acid exposure, even at different growth phase (Ang et al., 2001; Merrell et al., 2003; Thompson et al., 2003). Therefore, we tested

18

D. Fan et al. / Microbiological Research 193 (2016) 11–19

the grant from the National Natural Science Foundation of China (31270118). We gratefully thank Dr. Torsten Juelich for insightful discussions and review. References

Fig. 7. The expression level of HP0795 upon acid induction were analyzed by quantitative real-time PCR. Error bars indicated standard errors.

whether expression of HP0795 was affected by low pH in the process of H. pylori colonization. Using quantitatively real-time PCR, we analyzed transcription of HP0795 after H. pylori were exposed to an environment of pH 3.0, 5.0 and 7.0. As shown in Fig. 7, expression of HP0795 was not induced upon lowering pH, showing negligible effects on transcriptional expression of HP0795, although transcription level of HP0795 increased to approximately 1.4 fold, at pH 5.0 compared to those at pH 7.0. On the basis of these results, we propose that HP0795, as a stable chaperone gene in H. pylori, its expression is unlikely to be induced by an increase of in the stomach of H. pylori hosts. Considering that HP0921 was identified as an endogenous interaction partner for HP0975 in vivo, further investigations on the potential role of HP0795 in maintaining stability of HP0921 under acid-stress conditions will be required in the future. 4. Conclusions To our knowledge, this is the first study reporting the heterologous expression and characterization of a HP0795 gene from H. pylori in the host E. coli. We demonstrated that HP0795 in H. pylori displays chaperone activity for preventing cytosolic proteins from aggregation similar to its E. coli homolog trigger factor. In addition, HP0795 possesses PPIase activity that catalyzes peptidyl prolyl cistrans isomerization of tetra-peptides, similar to the activity found for other TF homologs from bacteria. Together, our findings should contribute to a better understanding of the functional importance of chaperone trigger factor homologs in pathogenic bacteria. Here, we established that HP0795 with chaperone function showed stable expression in acid stress. Given that H. pylori survives in extreme environments such as the human stomach, this study should serve as a base for further exploring the physiological role of chaperones in H. pylori under acidic environmental conditions. Conflict of interest The authors declare no potential conflict of interest. Acknowledgments This work was supported by a fund for China Mega-Project for Infectious Disease (2011ZX10004-001), the grant from the National Technology R&D Program in the 12th Five-Year Plan of China (2012BAI06B02), the grant from the State Key Laboratory of Infectious Disease Prevention and Control (SKLID) (2014SKLID102) and

Alonzo, F., Port, G.C., Cao, M., Freitag, N.E., 2009. The posttranslocation chaperone PrsA2 contributes to multiple facets of Listeria monocytogenes pathogenesis. Infect. Immun. 77 (7), 2612–2623. Ang, S., Lee, C.Z., Peck, K., Sindici, M., Matrubutham, U., Gleeson, M.A., Wang, J.T., 2001. Acid-induced gene expression in Helicobacter pylori: study in genomic scale by microarray. Infect. Immun. 69 (3), 1679–1686. Calloni, G., Chen, T., Schermann, S.M., Chang, H.C., Genevaux, P., Agostini, F., Tartaglia, G.G., Hayer-Hartl, M., Hartl, F.U., 2012. DnaK functions as a central hub in the E. coli chaperone network. Cell Rep. 1 (3), 251–264. Cover, T.L., Blaser, M.J., 2009. Helicobacter pylori in health and disease. Gastroenterology 136 (6), 1863–1873. da Costa, D.M., Pereira Edos, S., Rabenhorst, S.H., 2015. What exists beyond cagA and vacA? Helicobacter pylori genes in gastric diseases. World J. Gastroenterol. 21 (37), 10563–10572. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97 (12), 6640–6645. Davidsen, T., Beck, E., Ganapathy, A., Montgomery, R., Zafar, N., Yang, Q., Madupu, R., Goetz, P., Galinsky, K., White, O., Sutton, G., 2010. The comprehensive microbial resource. Nucleic Acids Res. 38 (Database issue), D340–D345. Deuerling, E., Schulze-Specking, A., Tomoyasu, T., Mogk, A., Bukau, B., 1999. Trigger factor and DnaK cooperate in folding of newly synthesized proteins. Nature 400 (6745), 693–696. Deuerling, E., Patzelt, H., Vorderwulbecke, S., Rauch, T., Kramer, G., Schaffitzel, E., Mogk, A., Schulze-Specking, A., Langen, H., Bukau, B., 2003. Trigger Factor and DnaK possess overlapping substrate pools and binding specificities. Mol. Microbiol. 47 (5), 1317–1328. Emanuelsson, O., Brunak, S., von Heijne, G., Nielsen, H., 2007. Locating proteins in the cell using TargetP, SignalP and related tools. Nat. Protoc. 2 (4), 953–971. Fischer, G., Bang, H., Mech, C., 1984. Determination of enzymatic catalysis for the cis-trans-isomerization of peptide binding in proline-containing peptides. Biomed. Biochim. Acta 43 (10), 1101–1111. Genevaux, P., Keppel, F., Schwager, F., Langendijk-Genevaux, P.S., Hartl, F.U., Georgopoulos, C., 2004. In vivo analysis of the overlapping functions of DnaK and trigger factor. EMBO Rep. 5 (2), 195–200. Godin-Roulling, A., Schmidpeter, P.A., Schmid, F.X., Feller, G., 2015. Functional adaptations of the bacterial chaperone trigger factor to extreme environmental temperatures. Environ. Microbiol. 17 (7), 2407–2420. Griffin, M.D., Gerrard, J.A., 2012. The relationship between oligomeric state and protein function. In: Matthews, J.M. (Ed.), Protein Dimerization and Oligomerization in Biology. Springer, New York, NY, pp. 74–90. Hartl, F.U., Hayer-Hartl, M., 2009. Converging concepts of protein folding in vitro and in vivo. Nat. Struct. Mol. Biol. 16 (6), 574–581. Hoffmann, A., Bukau, B., Kramer, G., 2010. Structure and function of the molecular chaperone Trigger Factor. Biochim. Biophys. Acta 1803 (6), 650–661. Huang, G.C., Li, Z.Y., Zhou, J.M., Fischer, G., 2000. Assisted folding of D-glyceraldehyde-3-phosphate dehydrogenase by trigger factor. Protein Sci. 9 (6), 1254–1261. Jakob, R.P., Zoldak, G., Aumuller, T., Schmid, F.X., 2009. Chaperone domains convert prolyl isomerases into generic catalysts of protein folding. Proc. Natl. Acad. Sci. U. S. A. 106 (48), 20282–20287. Kaiser, C.M., Chang, H.C., Agashe, V.R., Lakshmipathy, S.K., Etchells, S.A., Hayer-Hartl, M., Hartl, F.U., Barral, J.M., 2006. Real-time observation of trigger factor function on translating ribosomes. Nature 444 (7118), 455–460. Kiefer, F., Arnold, K., Kunzli, M., Bordoli, L., Schwede, T., 2009. The SWISS-MODEL repository and associated resources. Nucleic Acids Res. 37 (Database issue), D387–D392. Kramer, G., Patzelt, H., Rauch, T., Kurz, T.A., Vorderwulbecke, S., Bukau, B., Deuerling, E., 2004a. Trigger factor peptidyl-prolyl cis/trans isomerase activity is not essential for the folding of cytosolic proteins in Escherichia coli. J. Biol. Chem. 279 (14), 14165–14170. Kramer, G., Rutkowska, A., Wegrzyn, R.D., Patzelt, H., Kurz, T.A., Merz, F., Rauch, T., Vorderwulbecke, S., Deuerling, E., Bukau, B., 2004b. Functional dissection of Escherichia coli trigger factor: unraveling the function of individual domains. J. Bacteriol. 186 (12), 3777–3784. Kusters, J.G., van Vliet, A.H., Kuipers, E.J., 2006. Pathogenesis of Helicobacter pylori infection. Clin. Microbiol. Rev. 19 (3), 449–490. Li, Z.Y., Liu, C.P., Zhu, L.Q., Jing, G.Z., Zhou, J.M., 2001. The chaperone activity of trigger factor is distinct from its isomerase activity during co-expression with adenylate kinase in Escherichia coli. FEBS Lett. 506 (2), 108–112. Liu, C.P., Li, Z.Y., Huang, G.C., Perrett, S., Zhou, J.M., 2005. Two distinct intermediates of trigger factor are populated during guanidine denaturation. Biochimie 87 (11), 1023–1031. Liu, C.P., Zhou, Q.M., Fan, D.J., Zhou, J.M., 2010. PPIase domain of trigger factor acts as auxiliary chaperone site to assist the folding of protein substrates bound to the crevice of trigger factor. Int. J. Biochem. Cell Biol. 42 (6), 890–901. Maier, R., Eckert, B., Scholz, C., Lilie, H., Schmid, F.X., 2003. Interaction of trigger factor with the ribosome. J. Mol. Biol. 326 (2), 585–592.

D. Fan et al. / Microbiological Research 193 (2016) 11–19 Martinez-Hackert, E., Hendrickson, W.A., 2009. Promiscuous substrate recognition in folding and assembly activities of the trigger factor chaperone. Cell 138 (5), 923–934. Mentis, A., Lehours, P., Megraud, F., 2015. Epidemiology and diagnosis of Helicobacter pylori infection. Helicobacter 20 (Suppl. 1), 1–7. Merrell, D.S., Goodrich, M.L., Otto, G., Tompkins, L.S., Falkow, S., 2003. pH-regulated gene expression of the gastric pathogen Helicobacter pylori. Infect. Immun. 71 (6), 3529–3539. Merz, F., Hoffmann, A., Rutkowska, A., Zachmann-Brand, B., Bukau, B., Deuerling, E., 2006. The C-terminal domain of Escherichia coli trigger factor represents the central module of its chaperone activity. J. Biol. Chem. 281 (42), 31963–31971. Merz, F., Boehringer, D., Schaffitzel, C., Preissler, S., Hoffmann, A., Maier, T., Rutkowska, A., Lozza, J., Ban, N., Bukau, B., Deuerling, E., 2008. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome. EMBO J. 27 (11), 1622–1632. Modrzewska, M., Karpinski, P., Grudniak, A., Wolska, K.I., 2002. Effect of null mutations in dnaK and dnaJ genes on conjugational DNA transfer, proteolysis and novobiocin susceptibility of Escherichia coli. Acta Microbiol. Pol. 51 (3), 217–224. Mogk, A., Tomoyasu, T., Goloubinoff, P., Rudiger, S., Roder, D., Langen, H., Bukau, B., 1999. Identification of thermolabile Escherichia coli proteins: prevention and reversion of aggregation by DnaK and ClpB. EMBO J. 18 (24), 6934–6949. Nishihara, K., Kanemori, M., Yanagi, H., Yura, T., 2000. Overexpression of trigger factor prevents aggregation of recombinant proteins in Escherichia coli. Appl. Environ. Microbiol. 66 (3), 884–889. Obi, I.R., Nordfelth, R., Francis, M.S., 2011. Varying dependency of periplasmic peptidylprolyl cis-trans isomerases in promoting Yersinia pseudotuberculosis stress tolerance and pathogenicity. Biochem. J. 439 (2), 321–332. Patzelt, H., Kramer, G., Rauch, T., Schonfeld, H.J., Bukau, B., Deuerling, E., 2002. Three-state equilibrium of Escherichia coli trigger factor. Biol. Chem. 383 (10), 1611–1619. Pflock, M., Kennard, S., Finsterer, N., Beier, D., 2006. Acid-responsive gene regulation in the human pathogen Helicobacter pylori. J. Biotechnol. 126 (1), 52–60. Piette, F., D’Amico, S., Struvay, C., Mazzucchelli, G., Renaut, J., Tutino, M.L., Danchin, A., Leprince, P., Feller, G., 2010. Proteomics of life at low temperatures: trigger factor is the primary chaperone in the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125. Mol. Microbiol. 76 (1), 120–132. Sachs, G., Weeks, D.L., Melchers, K., Scott, D.R., 2003. The gastric biology of Helicobacter pylori. Annu. Rev. Physiol. 65, 349–369. Schmid, F., 2005. Prolyl isomerization in protein folding. In: Protein Folding Handbook., pp. 916–945. Schmidpeter, P.A., Schmid, F.X., 2015. Prolyl isomerization and its catalysis in protein folding and protein function. J. Mol. Biol. 427 (7), 1609–1631. Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9 (7), 671–675. Scholz, C., Stoller, G., Zarnt, T., Fischer, G., Schmid, F.X., 1997. Cooperation of enzymatic and chaperone functions of trigger factor in the catalysis of protein folding. EMBO J. 16 (1), 54–58. Scott, D.R., Marcus, E.A., Wen, Y., Oh, J., Sachs, G., 2007. Gene expression in vivo shows that Helicobacter pylori colonizes an acidic niche on the gastric surface. Proc. Natl. Acad. Sci. U. S. A. 104 (17), 7235–7240. Stoller, G., Rucknagel, K.P., Nierhaus, K.H., Schmid, F.X., Fischer, G., Rahfeld, J.U., 1995. A ribosome-associated peptidyl-prolyl cis/trans isomerase identified as the trigger factor. EMBO J. 14 (20), 4939–4948.

19

Suerbaum, S., Michetti, P., 2002. Helicobacter pylori infection. N. Engl. J. Med. 347 (15), 1175–1186. Teter, S.A., Houry, W.A., Ang, D., Tradler, T., Rockabrand, D., Fischer, G., Blum, P., Georgopoulos, C., Hartl, F.U., 1999. Polypeptide flux through bacterial Hsp70: DnaK cooperates with trigger factor in chaperoning nascent chains. Cell 97 (6), 755–765. Thompson, L.J., Merrell, D.S., Neilan, B.A., Mitchell, H., Lee, A., Falkow, S., 2003. Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression. Infect. Immun. 71 (5), 2643–2655. Tomb, J.F., White, O., Kerlavage, A.R., Clayton, R.A., Sutton, G.G., Fleischmann, R.D., Ketchum, K.A., Klenk, H.P., Gill, S., Dougherty, B.A., Nelson, K., Quackenbush, J., Zhou, L., Kirkness, E.F., Peterson, S., Loftus, B., Richardson, D., Dodson, R., Khalak, H.G., Glodek, A., McKenney, K., Fitzegerald, L.M., Lee, N., Adams, M.D., Hickey, E.K., Berg, D.E., Gocayne, J.D., Utterback, T.R., Peterson, J.D., Kelley, J.M., Cotton, M.D., Weidman, J.M., Fujii, C., Bowman, C., Watthey, L., Wallin, E., Hayes, W.S., Borodovsky, M., Karp, P.D., Smith, H.O., Fraser, C.M., Venter, J.C., 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388 (6642), 539–547. Tomoyasu, T., Mogk, A., Langen, H., Goloubinoff, P., Bukau, B., 2001. Genetic dissection of the roles of chaperones and proteases in protein folding and degradation in the Escherichia coli cytosol. Mol. Microbiol. 40 (2), 397–413. Tradler, T., Stoller, G., Rucknagel, K.P., Schierhorn, A., Rahfeld, J.U., Fischer, G., 1997. Comparative mutational analysis of peptidyl prolyl cis/trans isomerases: active sites of Escherichia coli trigger factor and human FKBP12. FEBS Lett. 407 (2), 184–190. Tran, T.D., Kwon, H.Y., Kim, E.H., Kim, K.W., Briles, D.E., Pyo, S., Rhee, D.K., 2011. Decrease in penicillin susceptibility due to heat shock protein ClpL in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 55 (6), 2714–2728. Unal, C.M., Steinert, M., 2014. Microbial peptidyl-prolyl cis/trans isomerases (PPIases): virulence factors and potential alternative drug targets. Microbiol. Mol. Biol. Rev. 78 (3), 544–571. Wen, Y., Marcus, E.A., Matrubutham, U., Gleeson, M.A., Scott, D.R., Sachs, G., 2003. Acid-adaptive genes of Helicobacter pylori. Infect. Immun. 71 (10), 5921–5939. Wen, Z.T., Suntharaligham, P., Cvitkovitch, D.G., Burne, R.A., 2005. Trigger factor in Streptococcus mutans is involved in stress tolerance, competence development, and biofilm formation. Infect. Immun. 73 (1), 219–225. Wolska, K.I., Bugajska, E., Jurkiewicz, D., Kuc, M., Jozwik, A., 2000. Antibiotic susceptibility of Escherichia coli dnaK and dnaJ mutants. Microb. Drug Resist. 6 (2), 119–126. Wu, T., Zhao, Z., Zhang, L., Ma, H., Lu, K., Ren, W., Liu, Z., Chang, H., Bei, W., Qiu, Y., Chen, H., 2011. Trigger factor of Streptococcus suis is involved in stress tolerance and virulence. Microb. Pathog. 51 (1-2), 69–76. Yamada, J., Yamasaki, S., Hirakawa, H., Hayashi-Nishino, M., Yamaguchi, A., Nishino, K., 2010. Impact of the RNA chaperone Hfq on multidrug resistance in Escherichia coli. J. Antimicrob. Chemother. 65 (5), 853–858. Zhou, Q.M., Fan, D.J., Xie, J.B., Liu, C.P., Zhou, J.M., 2010. A method for generating precise gene deletions and insertions in Escherichia coli. World J. Microbiol. Biotechnol. 26 (7), 1323–1329. von Mering, C., Krause, R., Snel, B., Cornell, M., Oliver, S.G., Fields, S., Bork, P., 2002. Comparative assessment of large-scale data sets of protein-protein interactions. Nature 417 (6887), 399–403.