- Email: [email protected]
Functional characterization of the promoter of the vitellogenin gene, AsVg1, of the malaria vector, Anopheles stephensi
ARTICLE IN PRESS Insect Biochemistry and Molecular Biology Insect Biochemistry and Molecular Biology 36 (2006) 694–700 www.elsevier.com/locate/ibmb
Functional characterization of the promoter of the vitellogenin gene, AsVg1, of the malaria vector, Anopheles stephensi Xavier Nirmalaa,1, Osvaldo Marinottia, Juan Miguel Sandovala, Sophea Phina, Surendra Gakharb, Nijole Jasinskienea, Anthony A. Jamesa,c, a
Department of Molecular Biology and Biochemistry, 3205 McGaugh Hall, University of California, Irvine, CA 92697 3900, USA b Department of Biosciences, Maharshi Dayanand University, Rohtak, India c Department of Microbiology and Molecular Genetics, University of California, Irvine, CA 92697, USA Received 17 January 2006; received in revised form 15 May 2006; accepted 18 May 2006
Abstract Some genetic strategies for controlling transmission of mosquito-borne diseases call for the introgression of antipathogen effector genes into vector populations. Endogenous mosquito promoter and other cis-acting DNA sequences are needed to direct the expression of the effector molecules to maximize their efficacy. Vitellogenin (Vg)-encoding gene control sequences are candidates for driving tissue-, stage- and sex-specific expression of exogenous genes. One of the Anopheles stephensi Vg genes, AsVg1, was cloned and a full-length cDNA, as well as 850 base pairs adjacent to the 50 -end, were sequenced and characterized. Expression of AsVg1 is restricted to the fat body tissues of blood-fed females, and the amino acid sequence of the conceptual translation product is 485% identical to those of other anopheline Vgs. These characteristics support the conclusion that AsVg1 is a Vg-encoding gene. Functional analyses of the AsVg1 putative cis-regulatory sequences were performed using transgenic mosquitoes. The results showed that DNA fragments encompassing the 850 base pairs immediately adjacent to the 50 -end of the gene and the 30 -end untranslated region are sufficient to direct sex-, stageand tissue-specific expression of a reporter gene. These data indicate that the AsVg1 promoter is a good candidate for controlling the expression of anti-pathogen effector molecules in this malaria vector mosquito. r 2006 Elsevier Ltd. All rights reserved. Keywords: Mosquito transformation; Genetic control; Malaria vector; Tissue-specific expression
1. Introduction Vitellogenin (Vg), the major yolk protein precursor in mosquitoes, is synthesized abundantly and specifically in the fat body tissues of females following a blood meal (Kokoza et al., 2001; Ahmed et al., 2001). Mosquito as well as other insect Vg genes and proteins have been studied extensively resulting in a considerable understanding of their physiology, gene regulation, cis-acting promoter elements and transcription factors. In addition, Vg gene Corresponding author. Departments of Molecular Biology and Biochemistry and Microbiology and Molecular Genetics, 3205 McGaugh Hall, University of California, Irvine CA 92697 3900, USA. Tel.: +1 949 824 5930; fax: +1 949 824 2814. E-mail address: [email protected] (A.A. James). 1 Present address: USDA-ARS, 1700 SW 23rd Drive, Gainesville, FL 32608, USA.
0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.05.011
control DNA sequences have served as important tools for developing genetic-based technologies to solve problems in the field of public health. For example, a long-term plan put forward to research the potential of genetically engineered mosquitoes for controlling pathogen transmission by means of population replacement calls for transgenic insects unable to harbor or transmit pathogens to humans (Collins and James, 1996). The development of such mosquitoes depends on endogenous mosquito regulatory elements to direct optimal tissue-, stage- and sexspecific expression of anti-parasite effector molecules. Following this approach, Kokoza et al. (2000, 2001) and Shin et al. (2003) used a promoter DNA fragment from the Aedes aegypti Vg gene to drive expression of anti-microbial effector proteins in transgenic adult females. Over-expression in the fat body and secretion into the hemolymph of cecropin inhibited partially oocyte growth of the avian
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
malaria parasite, Plasmodium gallinaceum (Shin et al., 2003). While these and other advances in mosquito transgenesis show the feasibility of generating parasiteresistant vectors (Nirmala and James, 2003; Christophides, 2005; James, 2005), the characterization of homologous promoters that provide precise control of transgene expression continues to be a requirement. Anopheles stephensi is a major vector of malaria in many regions of Asia and the Middle-East, including India, Saudi Arabia, Afghanistan, Pakistan and Iran (Bashwari et al., 2001; Rowland et al., 2002; Klinkenberg et al., 2004; Vatandoost, 2005), and is one of the foreseen target species for population replacement strategies. Although An. stephensi is a significant malaria vector, the use of homologous gene regulatory elements to achieve expression of transgenes only now is being explored (Yoshida and Watanabe, 2006). Vg of An. stephensi, similar to those of other mosquitoes, are synthesized-specifically in the fat body tissues of adult females after a blood meal (Redfern, 1982; Jahan and Hurd, 1998), however the genes encoding these proteins have never been analyzed. Considering the possible utility of An. stephensi Vg gene regulatory DNA for the development of mosquito transgenesis-related technologies, we cloned and sequenced one An. stephensi Vg-encoding gene and showed the successful application of its cis-acting sequences to drive sex- and tissue-specific expression of a reporter gene in the homologous species. 2. Experimental procedures 2.1. Mosquito maintenance An. stephensi larvae (gift of M. Jacobs-Lorena, Johns Hopkins University) were fed on finely ground fish food (Tetramin) mixed 1:1 with yeast powder. Adults were maintained at 18 or 25 1C, 75–85% relative humidity and 18/6 h light/dark cycles, and were fed ad libitum on raisins and water. Adult females were fed on anesthetized mice when a blood meal was required. 2.2. Library screening and isolation of genomic clones A genomic library of An. stephensi in the lBlue Star vector (Novagen) was screened using standard protocols (Sambrook et al., 1989) with a 32P-labeled DNA probe (LP1) 1 kilobase pairs (kb) in length corresponding to a portion of the second exon of Anopheles gambiae Vg1T1 (Genbank accession number AF281078). The probe was generated by RT-PCR (One Step RT-PCR kit, Qiagen) using blood-fed female An. gambiae total RNA as template, and the forward primer AgVg1for (50 ctaccatccatcttgcgctgtgtcg 30 ) and reverse primer AgVg1rev (50 ggtgaccgacttgttgctcatgtcc30 ), complementary to An. gambiae Vg1T1. Positive phages containing inserts 43 kb in length were used for DNA isolation using standard protocols (Sambrook et al., 1989), and sequenced
695
using T3 and T7 oligonucleotide primers and respective complementary sequences in the phage arms. Additional sequencing was performed by gene-walking techniques using gene-specific primers designed from the An. stephensi sequence. 2.3. Isolation of a Vg-encoding cDNA Total RNA was isolated from adult female mosquitoes 24 h post blood meal (PBM) using the Trizol reagent (Gibco-BRL). Subsequently, one-step RT-PCR and Rapid Amplification of cDNA ends (RACE, Invitrogen) were performed using An. stephensi vitellogenin gene 1(AsVg1) gene-specific primers based on the genomic sequence. Amplified DNA fragments were cloned into the TOPO PCR 4 vector (Invitrogen) and sequenced. 2.4. Plasmid construction and embryo microinjections A transgene containing the AsVg1 50 -end and 30 -end putative cis regulatory regions flanking the cyan fluorescent protein (CFP) reporter gene open reading frame (ORF) was constructed in the shuttle vector, pSLFA 1180 (Horn and Wimmer, 2000). Phage DNA was used for restriction digestions to obtain the 850 base pair (bp) 50 - and 300 bp 30 -end putative regulatory sequence of AsVg1. The CFP ORF was amplified from the plasmid pBacECFP (Horn and Wimmer, 2000) using primers CFPXbaI-For (50 acttctagaatggtgagcaagggcga30 ) and CFPBamHI-Rev (50 acggatccttacttgtacagctcgtc30 ) to introduce the restriction sites XbaI and BamHI in the 50 - and 30 -end regions of the CFP ORF, respectively. The cassette was moved subsequently to the AscI restriction site of the piggyBac transformation vector, pBacDsRed (Horn and Wimmer, 2000) to produce the plasmid, pBacDsREDVgCFPVg. Microinjections of An. stephensi embryos were performed as described by Ito et al. (2002). Mating of surviving injected animals (G0) was achieved using male and female pools. Male pools consisted of 3–5 G0 males out-crossed to 45–100 uninjected females. Female pools consisted of 5–10 G0 females out-crossed to 5–7 uninjected males. G1 larvae were screened under a fluorescent microscope (Nikon) and the DsRed-positive individuals were maintained for propagation of the lines and further analysis. Expression of the AsVg1-CFP transgene was monitored with both green and blue filters. 2.5. Southern blot analyses Genomic DNA was extracted from 5 to 7 day-old adult mosquitoes. DNA from 10 mosquitoes was digested with EcoRI, resolved on a 0.8% agarose gel and blotted on Zeta-probe GT Genomic Tested Blotting Membranes (BioRad) using standard protocols (Sambrook et al., 1989). The probe consisted of the sequence encoding the CFP ORF amplified from the plasmid pBacDsREDVgCFPVg using primers CFPXbaI-For and CFPBamHI-Rev. The
ARTICLE IN PRESS 696
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
probe was prepared by 32P-labeling using the Random primer labeling kit (Amersham-Pharmacia). Membrane hybridization was conducted in Church’s hybridization buffer (Church and Gilbert, 1984) at 65 1C overnight. After hybridization, the membrane was washed once at room temperature for 15 min with 0.1 SSC/0.1% SDS; and twice with 0.1 SSC/0.1% SDS at 65 1C for 15 min. Kodak Biomax MR film was exposed to membranes with an intensifying screen for 24 h at 70 1C.
5’UTR
3.1. Isolation and identification of the AsVg1 gene An AsVg gene was isolated by screening a phage genomic library with a heterologous probe from An. gambiae. A phage, 2A2F, was sequenced partially and showed to contain a Vg gene, designated AsVg1, including a fragment 850 bp in length containing its putative 50 -end cis-regulatory region. The number of Vg genes in the genome of An. stephensi was estimated by performing Southern blots on genomic DNA digested with different enzymes and probed with segments of DNA from the AsVg1 coding region. Hybridization patterns observed are consistent with the conclusion that there are three copies of Vg-encoding genes in An. stephensi (Nirmala, X., unpublished data). A cDNA of 6 kb in length was constructed by the amplification, cloning and sequencing of a series of RT-PCR, 30 - and 50 -end RACE products (Fig. 1). Sequence alignment of the cDNA with the phage-derived genomic DNA mapped the transcription initiation site at 56 nucleotides (nt) at the 50 -end of the putative translation initiation codon, and the 30 -end untranslated region (UTR) was determined to be 92 bp in length. Evidence supporting the isolation of a Vg-encoding gene is provided by analyzing the deduced primary structure of the AsVg1-encoded protein (Fig. 1). The precursor protein
92
* Apo AsVg1b
1635 Apo AsVg1a
(B) *EHRGN RNRR - An. stephensi ERRGN RNRR - An. gambiae DARGN RNRR - An. albimanus (C)
3. Results
3’UTR
6194
407
2.6. RT-PCR Total RNA was isolated from 5 to 7 day-old non bloodfed males and blood-fed females kept at 18 1C at multiple time points following a blood meal, and from dissected tissues. All RNA preparations were treated with DNAse prior to use. One-step RT-PCR was performed using genespecific primers, AsVg1for (50 caacatcatgtccaagtcggaggtga30 ) and AsVg1rev (50 cttgaagctttcgtgctcttcctccg30 ), which amplify a 450 bp product. For expression analysis in transgenic lines, one-step RT-PCR was performed on total RNA using CFP gene-specific primers that amplify a 750 bp product. As an internal control, the transcript of the putative An. stephensi ribosomal protein S26 gene (CB367652, Abraham et al., 2004) was amplified using primers Asrib26S For (50 aatccttcccgaaggacatgaaccg30 ) and Asrib26S Rev (50 tacgaaacaaatcccatcctaatcgaagc30 ) to yield a 196 bp product.
ORF
56 (A)
EKRGN RYRR - Ae. Aegypti
Fig. 1. Schematic representations of the Anopheles stephensi Vitellogenin 1 (AsVg1) expression products. (A) Full-length cDNA. Shaded boxes represent the 50 - and 3-end untranslated regions (UTR) flanking the open reading frame (ORF). The numbers indicate the length in base pairs of the respective regions of cDNA. (B) The An. stephensi vitellogenin precursor is a protein composed of 2058 amino acids that is cleaved to release a signal peptide of 16 amino acids (filled box) and two Vg subunits, ApoAsVg1a (1635 amino acids) and ApoAsVg1b (407 amino acids). The shaded boxes indicate the relative positions of the polyserine repeat regions. The asterisk (*) indicates the relative location of the putative cleavage site of the provitellogenin. (C) Amino acid sequences, RXXR, representing the putative cleavage site, are found in the An. stephensi and other mosquito vitellogenins.
is predicted to be 2058 amino acids (aa) in length and contains a typical secretory signal peptide of 16 aa at its amino terminal end, and poly-serine regions characteristic of vertebrate and several insect Vgs (Sappington and Raikhel, 1998). Three poly-serine tracts are found in An. stephensi Vg, two in the amino-terminal (246–273aa and 311–344aa) and one in the carboxy-terminal ends (1272–1294aa), with a distribution similar to those observed in Ae. aegypti (Romans et al., 1995) and An. gambiae (VgT1, accession number AAF82131). Comparisons of the predicted primary amino acid sequences of Vg proteins of anopheline mosquitoes reveal high similarity with more than 85% identity (An. stephensi Vg1 DQ442990, An. gambiae Vg1 AAF82131, Anopheles albimanus Vg-C AAV31933) (data not shown). The region of the AsVg1 cDNA encoding its carboxy-terminal polyserine sequence showed sequence heterogeneity with nucleotide indels (9 and 45 nt) that did not disrupt the reading frame. Based on SDS-PAGE protein analysis, An. stephensi Vg is composed of two subunit types, with Mr of 175 and 71 kDa (Redfern, 1982). Most insect Vgs are synthesized as a preprovitellogenin that following removal of the secretory signal peptide is processed by an intramolecular cleavage at a specific site adjacent to the amino acid motif, RXXR (Sappington and Raikhel, 1998; Chen et al., 1994). The putative Vg precursor cleavage site in anophelines, as well as in A. aegypti, consists of a predicted b turn and a characteristic RXXR motif. This sequence is present in the deduced An. stephensi protein. Expression profile analysis of Vg-encoding genes requires the development of probes that are specific to each
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
gene. The high degree of identity among the genes makes this difficult, and therefore we are not able to distinguish AsVg1 transcripts from those of the other Vg-encoding genes. However, analysis of total AsVg mRNA as determined by RT-PCR indicates that transcripts accumulate abundantly in the fat body tissues of vitellogenic females (Fig. 2, Panel C) (faint signals in midgut tissues result from contaminating fat body during dissection). Vg transcripts are not detectable in larvae, adult males and non-blood-fed females (Fig. 2, Panel D). These data along with the sequence analyses support strongly the conclusion that AsVg1 is an An. stephensi Vg-encoding gene. 3.2. Functional analysis of the AsVg1 cis-regulatory sequences A functional analysis of the AsVg1 cis-regulatory regions was performed by constructing a transformation vector containing two copies of a transgene cassette (AsVg1-CFP) consisting of 850 bp of the AsVg1 gene sequence immedi-
697
ately adjacent to the 50 -end of the transcription start followed by the CFP ORF, and a 300 bp 30 -end region of AsVg1 (Fig. 2, Panel A). Following microinjection of this construct into early embryos, surviving adults were crossed in pools to non-transgenic, recipient-strain mosquitoes of the opposite sex. Two independent transgenic lines, P1 and P2, were established from male pools based on DsRed fluorescence in the eye and nervous system of G1 larvae. Integration of the transgene into the genome of these lines was determined by Southern blot analysis using CFP as probe (Fig. 2, Panel B). Digestion of genomic DNA with EcoRI results in two possible fragments that could hybridize with the probe. One fragment contains the CFP ORF proximal to the right arm of the piggyBac element and is of variable length depending on the location of the next adjacent EcoRI restriction site in the genome. In addition, a common 1.8 kb EcoRI fragment is liberated by the promoter-reporter cassette adjacent to the left arm of piggyBac. Multiple and distinct high molecular weight hybridizing DNA fragments are consistent with four
Fig. 2. Analyses of AsVg-mediated transcription in transgenic and non-transgenic mosquitoes. (A) Schematic representation of the transformation construct. The marker gene, DsRED, under the control of the 3xP3 promoter has the SV40 Poly A signal sequence (SV40). Two copies of the AsVg1-CFP transgene are arranged in tandem. 50 Vg1 and 30 represent respective promoter and untranslated regions of AsVg1. CFP is the cyan fluorescent proteinencoding reporter gene open reading frame. pBac R and pBac L are piggyBac right and left inverted repeat regions and associated DNA, respectively. The size in base pairs of the respective DNA fragments is represented by numbers underneath. Restriction digestion of the construct with EcoRI releases a 1.8 kb fragment (top of the figure), which is used as diagnostic fragment for Southern blot analyses. (B) Southern blot analysis of the transgenic lines showing integration of CFP in the genome of transgenic mosquitoes. P1 and P2 are two independent transgenic lines and the lengths of molecular weight markers in kilobase-pairs (kb) are shown on the left. (C) Tissue-specific expression of the AsVg1-CFP transgenes and the An. stephensi vitellogeninencoding genes. Total RNA isolated from tissues dissected from females at 24 h post blood meal (O, ovaries; G, midgut; F, fat body), were used as template to amplify CFP, AsVg and ribosomal protein S26 transcripts by RT-PCR. P1 and P2 indicate samples extracted from P1 and P2 transgenic lines. (D) Stage- and sex-specific expression of the AsVg1-CFP transgenes and the An. stephensi vitellogenin-encoding genes. Total RNA isolated from larvae (L), males (M), non-blood-fed females (NBF) and blood-fed females (BFF) at 24 h post blood meal was used to amplify Vitellogenin (AsVg) and cyan fluorescent protein (CFP) transcripts by RT-PCR. The An. stephensi S26 ribosomal protein transcript (rpS26) was amplified as a control for RNA integrity and loading in each sample. (E) Accumulation of vitellogenin (AsVg) and cyan fluorescent protein (CFP) transcripts in wild type and transgenic BFF. Total RNA samples isolated from adult An. stephensi NBF and BFF maintained at 18 1C at 6, 12, 24, 48 and 72 h post blood meal were used as template to amplify CFP and AsVg transcripts by RT-PCR. The An. stephensi S26 ribosomal protein transcript was amplified as a control for RNA integrity and loading in each sample (not shown). NT indicates non-transgenic, recipient-strain female mosquitoes, and P1 and P2 indicate samples extracted from P1 and P2 transgenic lines.
ARTICLE IN PRESS 698
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
independent insertions of the AsVg1-CFP transgene in P1 and at least five in the P2 line. As expected, both DNA samples generate a strong signal at 1.8 kb consistent with multiple copies per genome of the common fragment. 3.3. AsVg1 50 regulatory regions direct sex-, stage-, and tissue-specific expression of CFP Expression of the CFP ORF was analyzed by RT-PCR to correlate the presence of its corresponding mRNA in transgenic P1 and P2 mosquitoes. The accumulation of CFP mRNA follows a pattern similar to that observed for the transcripts of AsVg endogenous genes in blood-fed females (Fig. 2, Panels C-E). Strong expression of CFP and AsVg was observed in the fat body tissues of blood fed females and not in ovaries or midguts. CFP mRNA is not observed in An. stephensi males or larvae. Peak mRNA accumulation for both transcription products is observed between 24 and 48 h PBM. Reporter gene expression also was determined by observing the fluorescence of CFP in the different sexes, tissues and stages of development (Fig. 3). The results
obtained with P1 and P2 lines were identical and therefore the figures presented show the P1 mosquitoes. CFP fluorescence was observed only in adults and not in larvae, consistent with the transcription data presented in Fig. 2. CFP also was observed exclusively in adult females but not in males indicating that the AsVg1 genomic sequences included in the construct contain the regulatory elements necessary to maintain sex-specific expression. Finally, reporter protein fluorescence was observed only in the fat body of blood-fed females and not other tissues. 4. Discussion Well-defined DNA sequences capable of controlling transgene expression are required to test hypotheses of population replacement (Collins and James, 1996). In this report we describe the cloning of an An. stephensi Vg gene and functional analyses of its cis-regulatory sequence using transgenic mosquitoes. The identity of the isolated gene as an An. stephensi Vg is supported by the high similarity of its deduced translation product with other anopheline Vg and its expression profile. The accumulation of AsVg
Fig. 3. Marker and reporter gene expression in transgenic An. stephensi mosquitoes. (A) Experimental (non-blood-fed transgenic female [NBFTF] and transgenic blood-fed female [BFTF]) and control (blood-fed, wild-type female [BFWTF] and transgenic male [TM]) were observed for blue reporter (top panels) and red marker (bottom panels) fluorescence utilizing the appropriate filters. The blue fluorescence is consistent with expression of CFP in transgenic blood-fed females but not in non-blood-fed females or in adult males. Red fluorescence serves as an indicator of transgenic animals. (B) A transgenic blood-fed female was dissected and CFP fluorescence (CFP) was observed only in the fat body cells of the mosquitoes. The right panel (EGFP) was monitored with the GFP filter in order to facilitate the visualization of the tissues. Abbreviations: A, abdomen; FB, fat body tissues; MG, midgut tissue; MT, Malpighian tubules; O, ovaries; T, thorax.
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
transcripts during mosquito development is consistent with the onset of Vg protein synthesis (Redfern, 1882), and supports the conclusion that the primary mechanism that regulates the synthesis of An. stephensi Vg is transcriptional regulation of the gene. The 850 nucleotides immediately adjacent to the 50 - end and the 30 UTR of AsVg1 are sufficient to direct sex-, stageand tissue-specific expression of a reporter gene. A 2.1-kb Vg gene promoter was competent to provide blood mealinduced expression of transgenes in female Ae. aegypti, however, low level expression also was seen in transgenic males (Kokoza et al., 2000). It is likely that regulatory elements required for a complete repression of the Vg gene expression in males were not present in the 2.1-kb 50 -end of the gene used in that work. Additional work in Ae. aegypti determined that regulatory elements such as GATA motifs are distributed from 111 to 1902 bp to the 50 -end of the VgA1 gene, and repressor proteins presumably are displaced from the motif for activator binding. Other regulatory elements in addition to the 2.1-kb sequence used likely are located farther to the 50 -end (Raikhel et al., 2002). Therefore, the comparison of the results observed in Ae. aegypti with An. stephensi are consistent with the interpretation that the cis-regulatory sequences in this anopheline are localized in a more compact DNA sequence. Transmission blocking of malaria parasites from the mosquito vectors to vertebrate hosts using genetically modified mosquitoes is being pursued actively (Ito et al., 2002), although transmission blocking of the human pathogen, Plasmodium falciparum by a transformed mosquito is yet to be reported. The choice of Vg gene regulatory elements to drive the expression of effector molecules is based primarily on the strong induction of transcription following a blood meal and restricted expression in the fat body. The peak accumulation of mRNA corresponds approximately to the time at which the human parasites are ookinetes invading the midgut. A fat body-expressed effector molecule that could traverse the basal membrane of the midgut epithelium could inactivate the penetrating ookinete or disrupt the developing oocyst. However, the most accessible target would be the sporozoites in the hemolymph. Although the initial temporal expression of Vg genes at 24–48 h PBM does not overlap the appearance of sporozoites in the hemolymph, which occurs much later (8–16 days depending on species and temperature) after an infective blood meal (Ghosh et al., 2002), studies have shown that some anophelines, including An. stephensi, take multiple blood meals normally within each gonotrophic cycle (Briegel and Horler, 1993; Nirmala et al., 2005). Furthermore, malaria-infected mosquitoes are more likely to seek out new blood meals than their non-infected counterparts (Ferguson and Read, 2004). This repetitive feeding could induce sufficient transcription from a Vg promoter-driven transgene resulting in an effector molecule being present in the hemolymph long enough to disrupt sporozoites. These data support the
699
proposal that genomic fragments containing Vg gene promoter elements are candidates for controlling the expression of anti-parasite effector molecules in malaria vectors, including An. stephensi, because of their ability to regulate transgene expression in a sex-, stage- and tissuespecific manner. Acknowledgements We thank Harald Biessmann for assistance in constructing the genomic library and Lynn Olson for help in preparing the manuscript. This work was supported by grants from the National Institutes of Health (AI29746) to AAJ. References Abraham, E.G., Islam, S., Srinivasan, P., Ghosh, A.K., Valenzuela, J.G., Ribeiro, J.M.C., Kafatos, F.C., Dimopoulos, G., Jacobs-Lorena, M., 2004. Analysis of the Plasmodium and Anopheles transcriptional repertoire during ookinete development and midgut invasion. J. Biol. Chem. 279, 5573–5580. Ahmed, A.M., Maingon, R., Romans, P., Hurd, H., 2001. Effects of malaria infection on vitellogenesis in Anopheles gambiae during two gonotrophic cycles. Insect Mol. Biol. 10, 347–356. Bashwari, L.A., Mandil, A.M., Bahnassy, A.A., Al-Shamsi, M.A., Bukhari, H.A., 2001. Epidemiological profile of malaria in a university hospital in the eastern region of Saudi Arabia. Saudi Med. J. 22, 133–138. Briegel, H., Horler, E., 1993. Multiple blood meals as a reproductive strategy in Anopheles (Diptera: Culicidae). J. Med. Entomol. 30, 975–985. Chen, J.S., Cho, W.L., Raikhel, A.S., 1994. Analysis of mosquito vitellogenin cDNA. Similarity with vertebrate phosvitins and arthropod serum proteins. J. Mol. Biol. 237, 641–647. Christophides, G.K., 2005. Transgenic mosquitoes and malaria transmission. Cell. Microbiol. 7, 325–333. Church, G.M., Gilbert, W., 1984. Genomic sequencing. Proc. Nat. Acad. Sci. USA 81, 1991–1995. Collins, F.H., James, A.A., 1996. Genetic modification of mosquitoes. Sci. Med. 3, 52–61. Ferguson, H.M., Read, A.F., 2004. Mosquito appetite for blood is stimulated by Plasmodium chabaudi infections in themselves and their vertebrate hosts. Malaria J. 3, 12. Ghosh, A.K., Moreira, L.A., Jacobs-Lorena, M., 2002. Plasmodium–mosquito interactions, phage display libraries and transgenic mosquitoes impaired for malaria transmission. Insect Biochem. Mol. Biol. 32, 1325–1331. Horn, C., Wimmer, E.A., 2000. A versatile vector set for animal transgenesis. Develop. Genes Evol. 210, 630–637. Ito, J., Ghosh, A., Moreira, L.A., Wimmer, E.A., Jacobs-Lorena, M., 2002. Transgenic anopheline mosquitoes impaired in transmission of a malaria parasite. Nature 417, 452–455. Jahan, N., Hurd, H., 1998. Effect of Plasmodium yoelii nigeriensis (Haemosporidia: Plasmodiidae) on Anopheles stephensi (Diptera: Culicidae) vitellogenesis. J. Med. Entomol. 35, 956–961. James, A.A., 2005. Gene drive systems in mosquitoes: rules of the road. Trends Parasitol. 21, 64–67. Klinkenberg, E.M., Konradsen, F., Herrel, N., Mukhtar, M., van der Hoek, W., Amerasinghe, F.P., 2004. Malaria vectors in the changing environment of the southern Punjab, Pakistan. Trans. R. Am. Soc. Tropic. Med. Hyg. 98, 442–449. Kokoza, V.A., Martin, D., Mienaltowski, M.J., Ahmed, A., Morton, C.M., Raikhel, A.S., 2001. Transcriptional regulation of the mosquito vitellogenin gene via a blood meal-triggered cascade. Gene 274, 47–65.
ARTICLE IN PRESS 700
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
Kokoza, V., Ahmed, A., Cho, W.L., Jasinskiene, N., James, A.A., Raikhel, A., 2000. Engineering blood meal-activated systemic immunity in the yellow fever mosquito, Aedes aegypti. Proc. Nat. Acad. Sci. USA 97, 9144–9149. Nirmala, X., James, AA., 2003. Engineering Plasmodium-refractory phenotypes in mosquitoes. Trends Parasitol. 19, 384–387. Nirmala, X., Marinotti, O., James, A.A., 2005. The accumulation of specific mRNAs following multiple blood meals in Anopheles gambiae. Insect Mol. Biol. 14, 95–103. Raikhel, A.S., Kokoza, V.A., Zhu, J., Martin, D., Wang, S.F., Li, C., Sun, G., Ahmed, A., Dittmer, N., Attardo, G., 2002. Molecular biology of mosquito vitellogenesis: from basic studies to genetic engineering of antipathogen immunity. Insect Biochem. Mol. Biol. 32, 1275–1286. Redfern, C.P.F., 1982. 20-Hydroxy-ecdysone and ovarian development in Anopheles stephensi. J. Insect Physiol. 28, 97–103. Romans, P., Tu, Z., Ke, Z., Hagedorn, H.H., 1995. Analysis of a vitellogenin gene of the mosquito, Aedes aegypti, and comparisons to vitellogenins from other organisms. Insect Biochem. Mol. Biol., 939–958.
Rowland, M., Mohammed, N., Rehman, H., Hewitt, S., Mendis, C., Ahmad, M., Kamal, M., Wirtz, R., 2002. Anopheline vectors and malaria transmission in eastern Afghanistan. Trans. R. Soc. Tropic. Med. Hyg. 96, 620–626. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28, 277–300. Shin, S.W., Kokoza, V.A., Raikhel, A.S., 2003. Transgenesis and reverse genetics of mosquito innate immunity. J. Exp. Biol. 206, 3835–3843. Vatandoost, H., Mashayekhi, M., Abaie, M.R., Aflatoonian, M.R., Hanafi-Bojd, A.A., Sharifi, I., 2005. Monitoring of insecticides resistance in main malaria vectors in a malarious area of Kahnooj district, Kerman province, southeastern Iran. J. Vector-Borne Dis. 42, 100–108. Yoshida, S., Watanabe, H., 2006. Robust salivary gland-specific transgene expression in Anopheline mosquito. Insect Mol. Biol., in press.
Functional characterization of the promoter of the vitellogenin gene, AsVg1, of the malaria vector, Anopheles stephensi Xavier Nirmalaa,1, Osvaldo Marinottia, Juan Miguel Sandovala, Sophea Phina, Surendra Gakharb, Nijole Jasinskienea, Anthony A. Jamesa,c, a
Department of Molecular Biology and Biochemistry, 3205 McGaugh Hall, University of California, Irvine, CA 92697 3900, USA b Department of Biosciences, Maharshi Dayanand University, Rohtak, India c Department of Microbiology and Molecular Genetics, University of California, Irvine, CA 92697, USA Received 17 January 2006; received in revised form 15 May 2006; accepted 18 May 2006
Abstract Some genetic strategies for controlling transmission of mosquito-borne diseases call for the introgression of antipathogen effector genes into vector populations. Endogenous mosquito promoter and other cis-acting DNA sequences are needed to direct the expression of the effector molecules to maximize their efficacy. Vitellogenin (Vg)-encoding gene control sequences are candidates for driving tissue-, stage- and sex-specific expression of exogenous genes. One of the Anopheles stephensi Vg genes, AsVg1, was cloned and a full-length cDNA, as well as 850 base pairs adjacent to the 50 -end, were sequenced and characterized. Expression of AsVg1 is restricted to the fat body tissues of blood-fed females, and the amino acid sequence of the conceptual translation product is 485% identical to those of other anopheline Vgs. These characteristics support the conclusion that AsVg1 is a Vg-encoding gene. Functional analyses of the AsVg1 putative cis-regulatory sequences were performed using transgenic mosquitoes. The results showed that DNA fragments encompassing the 850 base pairs immediately adjacent to the 50 -end of the gene and the 30 -end untranslated region are sufficient to direct sex-, stageand tissue-specific expression of a reporter gene. These data indicate that the AsVg1 promoter is a good candidate for controlling the expression of anti-pathogen effector molecules in this malaria vector mosquito. r 2006 Elsevier Ltd. All rights reserved. Keywords: Mosquito transformation; Genetic control; Malaria vector; Tissue-specific expression
1. Introduction Vitellogenin (Vg), the major yolk protein precursor in mosquitoes, is synthesized abundantly and specifically in the fat body tissues of females following a blood meal (Kokoza et al., 2001; Ahmed et al., 2001). Mosquito as well as other insect Vg genes and proteins have been studied extensively resulting in a considerable understanding of their physiology, gene regulation, cis-acting promoter elements and transcription factors. In addition, Vg gene Corresponding author. Departments of Molecular Biology and Biochemistry and Microbiology and Molecular Genetics, 3205 McGaugh Hall, University of California, Irvine CA 92697 3900, USA. Tel.: +1 949 824 5930; fax: +1 949 824 2814. E-mail address: [email protected] (A.A. James). 1 Present address: USDA-ARS, 1700 SW 23rd Drive, Gainesville, FL 32608, USA.
0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.05.011
control DNA sequences have served as important tools for developing genetic-based technologies to solve problems in the field of public health. For example, a long-term plan put forward to research the potential of genetically engineered mosquitoes for controlling pathogen transmission by means of population replacement calls for transgenic insects unable to harbor or transmit pathogens to humans (Collins and James, 1996). The development of such mosquitoes depends on endogenous mosquito regulatory elements to direct optimal tissue-, stage- and sexspecific expression of anti-parasite effector molecules. Following this approach, Kokoza et al. (2000, 2001) and Shin et al. (2003) used a promoter DNA fragment from the Aedes aegypti Vg gene to drive expression of anti-microbial effector proteins in transgenic adult females. Over-expression in the fat body and secretion into the hemolymph of cecropin inhibited partially oocyte growth of the avian
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
malaria parasite, Plasmodium gallinaceum (Shin et al., 2003). While these and other advances in mosquito transgenesis show the feasibility of generating parasiteresistant vectors (Nirmala and James, 2003; Christophides, 2005; James, 2005), the characterization of homologous promoters that provide precise control of transgene expression continues to be a requirement. Anopheles stephensi is a major vector of malaria in many regions of Asia and the Middle-East, including India, Saudi Arabia, Afghanistan, Pakistan and Iran (Bashwari et al., 2001; Rowland et al., 2002; Klinkenberg et al., 2004; Vatandoost, 2005), and is one of the foreseen target species for population replacement strategies. Although An. stephensi is a significant malaria vector, the use of homologous gene regulatory elements to achieve expression of transgenes only now is being explored (Yoshida and Watanabe, 2006). Vg of An. stephensi, similar to those of other mosquitoes, are synthesized-specifically in the fat body tissues of adult females after a blood meal (Redfern, 1982; Jahan and Hurd, 1998), however the genes encoding these proteins have never been analyzed. Considering the possible utility of An. stephensi Vg gene regulatory DNA for the development of mosquito transgenesis-related technologies, we cloned and sequenced one An. stephensi Vg-encoding gene and showed the successful application of its cis-acting sequences to drive sex- and tissue-specific expression of a reporter gene in the homologous species. 2. Experimental procedures 2.1. Mosquito maintenance An. stephensi larvae (gift of M. Jacobs-Lorena, Johns Hopkins University) were fed on finely ground fish food (Tetramin) mixed 1:1 with yeast powder. Adults were maintained at 18 or 25 1C, 75–85% relative humidity and 18/6 h light/dark cycles, and were fed ad libitum on raisins and water. Adult females were fed on anesthetized mice when a blood meal was required. 2.2. Library screening and isolation of genomic clones A genomic library of An. stephensi in the lBlue Star vector (Novagen) was screened using standard protocols (Sambrook et al., 1989) with a 32P-labeled DNA probe (LP1) 1 kilobase pairs (kb) in length corresponding to a portion of the second exon of Anopheles gambiae Vg1T1 (Genbank accession number AF281078). The probe was generated by RT-PCR (One Step RT-PCR kit, Qiagen) using blood-fed female An. gambiae total RNA as template, and the forward primer AgVg1for (50 ctaccatccatcttgcgctgtgtcg 30 ) and reverse primer AgVg1rev (50 ggtgaccgacttgttgctcatgtcc30 ), complementary to An. gambiae Vg1T1. Positive phages containing inserts 43 kb in length were used for DNA isolation using standard protocols (Sambrook et al., 1989), and sequenced
695
using T3 and T7 oligonucleotide primers and respective complementary sequences in the phage arms. Additional sequencing was performed by gene-walking techniques using gene-specific primers designed from the An. stephensi sequence. 2.3. Isolation of a Vg-encoding cDNA Total RNA was isolated from adult female mosquitoes 24 h post blood meal (PBM) using the Trizol reagent (Gibco-BRL). Subsequently, one-step RT-PCR and Rapid Amplification of cDNA ends (RACE, Invitrogen) were performed using An. stephensi vitellogenin gene 1(AsVg1) gene-specific primers based on the genomic sequence. Amplified DNA fragments were cloned into the TOPO PCR 4 vector (Invitrogen) and sequenced. 2.4. Plasmid construction and embryo microinjections A transgene containing the AsVg1 50 -end and 30 -end putative cis regulatory regions flanking the cyan fluorescent protein (CFP) reporter gene open reading frame (ORF) was constructed in the shuttle vector, pSLFA 1180 (Horn and Wimmer, 2000). Phage DNA was used for restriction digestions to obtain the 850 base pair (bp) 50 - and 300 bp 30 -end putative regulatory sequence of AsVg1. The CFP ORF was amplified from the plasmid pBacECFP (Horn and Wimmer, 2000) using primers CFPXbaI-For (50 acttctagaatggtgagcaagggcga30 ) and CFPBamHI-Rev (50 acggatccttacttgtacagctcgtc30 ) to introduce the restriction sites XbaI and BamHI in the 50 - and 30 -end regions of the CFP ORF, respectively. The cassette was moved subsequently to the AscI restriction site of the piggyBac transformation vector, pBacDsRed (Horn and Wimmer, 2000) to produce the plasmid, pBacDsREDVgCFPVg. Microinjections of An. stephensi embryos were performed as described by Ito et al. (2002). Mating of surviving injected animals (G0) was achieved using male and female pools. Male pools consisted of 3–5 G0 males out-crossed to 45–100 uninjected females. Female pools consisted of 5–10 G0 females out-crossed to 5–7 uninjected males. G1 larvae were screened under a fluorescent microscope (Nikon) and the DsRed-positive individuals were maintained for propagation of the lines and further analysis. Expression of the AsVg1-CFP transgene was monitored with both green and blue filters. 2.5. Southern blot analyses Genomic DNA was extracted from 5 to 7 day-old adult mosquitoes. DNA from 10 mosquitoes was digested with EcoRI, resolved on a 0.8% agarose gel and blotted on Zeta-probe GT Genomic Tested Blotting Membranes (BioRad) using standard protocols (Sambrook et al., 1989). The probe consisted of the sequence encoding the CFP ORF amplified from the plasmid pBacDsREDVgCFPVg using primers CFPXbaI-For and CFPBamHI-Rev. The
ARTICLE IN PRESS 696
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
probe was prepared by 32P-labeling using the Random primer labeling kit (Amersham-Pharmacia). Membrane hybridization was conducted in Church’s hybridization buffer (Church and Gilbert, 1984) at 65 1C overnight. After hybridization, the membrane was washed once at room temperature for 15 min with 0.1 SSC/0.1% SDS; and twice with 0.1 SSC/0.1% SDS at 65 1C for 15 min. Kodak Biomax MR film was exposed to membranes with an intensifying screen for 24 h at 70 1C.
5’UTR
3.1. Isolation and identification of the AsVg1 gene An AsVg gene was isolated by screening a phage genomic library with a heterologous probe from An. gambiae. A phage, 2A2F, was sequenced partially and showed to contain a Vg gene, designated AsVg1, including a fragment 850 bp in length containing its putative 50 -end cis-regulatory region. The number of Vg genes in the genome of An. stephensi was estimated by performing Southern blots on genomic DNA digested with different enzymes and probed with segments of DNA from the AsVg1 coding region. Hybridization patterns observed are consistent with the conclusion that there are three copies of Vg-encoding genes in An. stephensi (Nirmala, X., unpublished data). A cDNA of 6 kb in length was constructed by the amplification, cloning and sequencing of a series of RT-PCR, 30 - and 50 -end RACE products (Fig. 1). Sequence alignment of the cDNA with the phage-derived genomic DNA mapped the transcription initiation site at 56 nucleotides (nt) at the 50 -end of the putative translation initiation codon, and the 30 -end untranslated region (UTR) was determined to be 92 bp in length. Evidence supporting the isolation of a Vg-encoding gene is provided by analyzing the deduced primary structure of the AsVg1-encoded protein (Fig. 1). The precursor protein
92
* Apo AsVg1b
1635 Apo AsVg1a
(B) *EHRGN RNRR - An. stephensi ERRGN RNRR - An. gambiae DARGN RNRR - An. albimanus (C)
3. Results
3’UTR
6194
407
2.6. RT-PCR Total RNA was isolated from 5 to 7 day-old non bloodfed males and blood-fed females kept at 18 1C at multiple time points following a blood meal, and from dissected tissues. All RNA preparations were treated with DNAse prior to use. One-step RT-PCR was performed using genespecific primers, AsVg1for (50 caacatcatgtccaagtcggaggtga30 ) and AsVg1rev (50 cttgaagctttcgtgctcttcctccg30 ), which amplify a 450 bp product. For expression analysis in transgenic lines, one-step RT-PCR was performed on total RNA using CFP gene-specific primers that amplify a 750 bp product. As an internal control, the transcript of the putative An. stephensi ribosomal protein S26 gene (CB367652, Abraham et al., 2004) was amplified using primers Asrib26S For (50 aatccttcccgaaggacatgaaccg30 ) and Asrib26S Rev (50 tacgaaacaaatcccatcctaatcgaagc30 ) to yield a 196 bp product.
ORF
56 (A)
EKRGN RYRR - Ae. Aegypti
Fig. 1. Schematic representations of the Anopheles stephensi Vitellogenin 1 (AsVg1) expression products. (A) Full-length cDNA. Shaded boxes represent the 50 - and 3-end untranslated regions (UTR) flanking the open reading frame (ORF). The numbers indicate the length in base pairs of the respective regions of cDNA. (B) The An. stephensi vitellogenin precursor is a protein composed of 2058 amino acids that is cleaved to release a signal peptide of 16 amino acids (filled box) and two Vg subunits, ApoAsVg1a (1635 amino acids) and ApoAsVg1b (407 amino acids). The shaded boxes indicate the relative positions of the polyserine repeat regions. The asterisk (*) indicates the relative location of the putative cleavage site of the provitellogenin. (C) Amino acid sequences, RXXR, representing the putative cleavage site, are found in the An. stephensi and other mosquito vitellogenins.
is predicted to be 2058 amino acids (aa) in length and contains a typical secretory signal peptide of 16 aa at its amino terminal end, and poly-serine regions characteristic of vertebrate and several insect Vgs (Sappington and Raikhel, 1998). Three poly-serine tracts are found in An. stephensi Vg, two in the amino-terminal (246–273aa and 311–344aa) and one in the carboxy-terminal ends (1272–1294aa), with a distribution similar to those observed in Ae. aegypti (Romans et al., 1995) and An. gambiae (VgT1, accession number AAF82131). Comparisons of the predicted primary amino acid sequences of Vg proteins of anopheline mosquitoes reveal high similarity with more than 85% identity (An. stephensi Vg1 DQ442990, An. gambiae Vg1 AAF82131, Anopheles albimanus Vg-C AAV31933) (data not shown). The region of the AsVg1 cDNA encoding its carboxy-terminal polyserine sequence showed sequence heterogeneity with nucleotide indels (9 and 45 nt) that did not disrupt the reading frame. Based on SDS-PAGE protein analysis, An. stephensi Vg is composed of two subunit types, with Mr of 175 and 71 kDa (Redfern, 1982). Most insect Vgs are synthesized as a preprovitellogenin that following removal of the secretory signal peptide is processed by an intramolecular cleavage at a specific site adjacent to the amino acid motif, RXXR (Sappington and Raikhel, 1998; Chen et al., 1994). The putative Vg precursor cleavage site in anophelines, as well as in A. aegypti, consists of a predicted b turn and a characteristic RXXR motif. This sequence is present in the deduced An. stephensi protein. Expression profile analysis of Vg-encoding genes requires the development of probes that are specific to each
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
gene. The high degree of identity among the genes makes this difficult, and therefore we are not able to distinguish AsVg1 transcripts from those of the other Vg-encoding genes. However, analysis of total AsVg mRNA as determined by RT-PCR indicates that transcripts accumulate abundantly in the fat body tissues of vitellogenic females (Fig. 2, Panel C) (faint signals in midgut tissues result from contaminating fat body during dissection). Vg transcripts are not detectable in larvae, adult males and non-blood-fed females (Fig. 2, Panel D). These data along with the sequence analyses support strongly the conclusion that AsVg1 is an An. stephensi Vg-encoding gene. 3.2. Functional analysis of the AsVg1 cis-regulatory sequences A functional analysis of the AsVg1 cis-regulatory regions was performed by constructing a transformation vector containing two copies of a transgene cassette (AsVg1-CFP) consisting of 850 bp of the AsVg1 gene sequence immedi-
697
ately adjacent to the 50 -end of the transcription start followed by the CFP ORF, and a 300 bp 30 -end region of AsVg1 (Fig. 2, Panel A). Following microinjection of this construct into early embryos, surviving adults were crossed in pools to non-transgenic, recipient-strain mosquitoes of the opposite sex. Two independent transgenic lines, P1 and P2, were established from male pools based on DsRed fluorescence in the eye and nervous system of G1 larvae. Integration of the transgene into the genome of these lines was determined by Southern blot analysis using CFP as probe (Fig. 2, Panel B). Digestion of genomic DNA with EcoRI results in two possible fragments that could hybridize with the probe. One fragment contains the CFP ORF proximal to the right arm of the piggyBac element and is of variable length depending on the location of the next adjacent EcoRI restriction site in the genome. In addition, a common 1.8 kb EcoRI fragment is liberated by the promoter-reporter cassette adjacent to the left arm of piggyBac. Multiple and distinct high molecular weight hybridizing DNA fragments are consistent with four
Fig. 2. Analyses of AsVg-mediated transcription in transgenic and non-transgenic mosquitoes. (A) Schematic representation of the transformation construct. The marker gene, DsRED, under the control of the 3xP3 promoter has the SV40 Poly A signal sequence (SV40). Two copies of the AsVg1-CFP transgene are arranged in tandem. 50 Vg1 and 30 represent respective promoter and untranslated regions of AsVg1. CFP is the cyan fluorescent proteinencoding reporter gene open reading frame. pBac R and pBac L are piggyBac right and left inverted repeat regions and associated DNA, respectively. The size in base pairs of the respective DNA fragments is represented by numbers underneath. Restriction digestion of the construct with EcoRI releases a 1.8 kb fragment (top of the figure), which is used as diagnostic fragment for Southern blot analyses. (B) Southern blot analysis of the transgenic lines showing integration of CFP in the genome of transgenic mosquitoes. P1 and P2 are two independent transgenic lines and the lengths of molecular weight markers in kilobase-pairs (kb) are shown on the left. (C) Tissue-specific expression of the AsVg1-CFP transgenes and the An. stephensi vitellogeninencoding genes. Total RNA isolated from tissues dissected from females at 24 h post blood meal (O, ovaries; G, midgut; F, fat body), were used as template to amplify CFP, AsVg and ribosomal protein S26 transcripts by RT-PCR. P1 and P2 indicate samples extracted from P1 and P2 transgenic lines. (D) Stage- and sex-specific expression of the AsVg1-CFP transgenes and the An. stephensi vitellogenin-encoding genes. Total RNA isolated from larvae (L), males (M), non-blood-fed females (NBF) and blood-fed females (BFF) at 24 h post blood meal was used to amplify Vitellogenin (AsVg) and cyan fluorescent protein (CFP) transcripts by RT-PCR. The An. stephensi S26 ribosomal protein transcript (rpS26) was amplified as a control for RNA integrity and loading in each sample. (E) Accumulation of vitellogenin (AsVg) and cyan fluorescent protein (CFP) transcripts in wild type and transgenic BFF. Total RNA samples isolated from adult An. stephensi NBF and BFF maintained at 18 1C at 6, 12, 24, 48 and 72 h post blood meal were used as template to amplify CFP and AsVg transcripts by RT-PCR. The An. stephensi S26 ribosomal protein transcript was amplified as a control for RNA integrity and loading in each sample (not shown). NT indicates non-transgenic, recipient-strain female mosquitoes, and P1 and P2 indicate samples extracted from P1 and P2 transgenic lines.
ARTICLE IN PRESS 698
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
independent insertions of the AsVg1-CFP transgene in P1 and at least five in the P2 line. As expected, both DNA samples generate a strong signal at 1.8 kb consistent with multiple copies per genome of the common fragment. 3.3. AsVg1 50 regulatory regions direct sex-, stage-, and tissue-specific expression of CFP Expression of the CFP ORF was analyzed by RT-PCR to correlate the presence of its corresponding mRNA in transgenic P1 and P2 mosquitoes. The accumulation of CFP mRNA follows a pattern similar to that observed for the transcripts of AsVg endogenous genes in blood-fed females (Fig. 2, Panels C-E). Strong expression of CFP and AsVg was observed in the fat body tissues of blood fed females and not in ovaries or midguts. CFP mRNA is not observed in An. stephensi males or larvae. Peak mRNA accumulation for both transcription products is observed between 24 and 48 h PBM. Reporter gene expression also was determined by observing the fluorescence of CFP in the different sexes, tissues and stages of development (Fig. 3). The results
obtained with P1 and P2 lines were identical and therefore the figures presented show the P1 mosquitoes. CFP fluorescence was observed only in adults and not in larvae, consistent with the transcription data presented in Fig. 2. CFP also was observed exclusively in adult females but not in males indicating that the AsVg1 genomic sequences included in the construct contain the regulatory elements necessary to maintain sex-specific expression. Finally, reporter protein fluorescence was observed only in the fat body of blood-fed females and not other tissues. 4. Discussion Well-defined DNA sequences capable of controlling transgene expression are required to test hypotheses of population replacement (Collins and James, 1996). In this report we describe the cloning of an An. stephensi Vg gene and functional analyses of its cis-regulatory sequence using transgenic mosquitoes. The identity of the isolated gene as an An. stephensi Vg is supported by the high similarity of its deduced translation product with other anopheline Vg and its expression profile. The accumulation of AsVg
Fig. 3. Marker and reporter gene expression in transgenic An. stephensi mosquitoes. (A) Experimental (non-blood-fed transgenic female [NBFTF] and transgenic blood-fed female [BFTF]) and control (blood-fed, wild-type female [BFWTF] and transgenic male [TM]) were observed for blue reporter (top panels) and red marker (bottom panels) fluorescence utilizing the appropriate filters. The blue fluorescence is consistent with expression of CFP in transgenic blood-fed females but not in non-blood-fed females or in adult males. Red fluorescence serves as an indicator of transgenic animals. (B) A transgenic blood-fed female was dissected and CFP fluorescence (CFP) was observed only in the fat body cells of the mosquitoes. The right panel (EGFP) was monitored with the GFP filter in order to facilitate the visualization of the tissues. Abbreviations: A, abdomen; FB, fat body tissues; MG, midgut tissue; MT, Malpighian tubules; O, ovaries; T, thorax.
ARTICLE IN PRESS X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
transcripts during mosquito development is consistent with the onset of Vg protein synthesis (Redfern, 1882), and supports the conclusion that the primary mechanism that regulates the synthesis of An. stephensi Vg is transcriptional regulation of the gene. The 850 nucleotides immediately adjacent to the 50 - end and the 30 UTR of AsVg1 are sufficient to direct sex-, stageand tissue-specific expression of a reporter gene. A 2.1-kb Vg gene promoter was competent to provide blood mealinduced expression of transgenes in female Ae. aegypti, however, low level expression also was seen in transgenic males (Kokoza et al., 2000). It is likely that regulatory elements required for a complete repression of the Vg gene expression in males were not present in the 2.1-kb 50 -end of the gene used in that work. Additional work in Ae. aegypti determined that regulatory elements such as GATA motifs are distributed from 111 to 1902 bp to the 50 -end of the VgA1 gene, and repressor proteins presumably are displaced from the motif for activator binding. Other regulatory elements in addition to the 2.1-kb sequence used likely are located farther to the 50 -end (Raikhel et al., 2002). Therefore, the comparison of the results observed in Ae. aegypti with An. stephensi are consistent with the interpretation that the cis-regulatory sequences in this anopheline are localized in a more compact DNA sequence. Transmission blocking of malaria parasites from the mosquito vectors to vertebrate hosts using genetically modified mosquitoes is being pursued actively (Ito et al., 2002), although transmission blocking of the human pathogen, Plasmodium falciparum by a transformed mosquito is yet to be reported. The choice of Vg gene regulatory elements to drive the expression of effector molecules is based primarily on the strong induction of transcription following a blood meal and restricted expression in the fat body. The peak accumulation of mRNA corresponds approximately to the time at which the human parasites are ookinetes invading the midgut. A fat body-expressed effector molecule that could traverse the basal membrane of the midgut epithelium could inactivate the penetrating ookinete or disrupt the developing oocyst. However, the most accessible target would be the sporozoites in the hemolymph. Although the initial temporal expression of Vg genes at 24–48 h PBM does not overlap the appearance of sporozoites in the hemolymph, which occurs much later (8–16 days depending on species and temperature) after an infective blood meal (Ghosh et al., 2002), studies have shown that some anophelines, including An. stephensi, take multiple blood meals normally within each gonotrophic cycle (Briegel and Horler, 1993; Nirmala et al., 2005). Furthermore, malaria-infected mosquitoes are more likely to seek out new blood meals than their non-infected counterparts (Ferguson and Read, 2004). This repetitive feeding could induce sufficient transcription from a Vg promoter-driven transgene resulting in an effector molecule being present in the hemolymph long enough to disrupt sporozoites. These data support the
699
proposal that genomic fragments containing Vg gene promoter elements are candidates for controlling the expression of anti-parasite effector molecules in malaria vectors, including An. stephensi, because of their ability to regulate transgene expression in a sex-, stage- and tissuespecific manner. Acknowledgements We thank Harald Biessmann for assistance in constructing the genomic library and Lynn Olson for help in preparing the manuscript. This work was supported by grants from the National Institutes of Health (AI29746) to AAJ. References Abraham, E.G., Islam, S., Srinivasan, P., Ghosh, A.K., Valenzuela, J.G., Ribeiro, J.M.C., Kafatos, F.C., Dimopoulos, G., Jacobs-Lorena, M., 2004. Analysis of the Plasmodium and Anopheles transcriptional repertoire during ookinete development and midgut invasion. J. Biol. Chem. 279, 5573–5580. Ahmed, A.M., Maingon, R., Romans, P., Hurd, H., 2001. Effects of malaria infection on vitellogenesis in Anopheles gambiae during two gonotrophic cycles. Insect Mol. Biol. 10, 347–356. Bashwari, L.A., Mandil, A.M., Bahnassy, A.A., Al-Shamsi, M.A., Bukhari, H.A., 2001. Epidemiological profile of malaria in a university hospital in the eastern region of Saudi Arabia. Saudi Med. J. 22, 133–138. Briegel, H., Horler, E., 1993. Multiple blood meals as a reproductive strategy in Anopheles (Diptera: Culicidae). J. Med. Entomol. 30, 975–985. Chen, J.S., Cho, W.L., Raikhel, A.S., 1994. Analysis of mosquito vitellogenin cDNA. Similarity with vertebrate phosvitins and arthropod serum proteins. J. Mol. Biol. 237, 641–647. Christophides, G.K., 2005. Transgenic mosquitoes and malaria transmission. Cell. Microbiol. 7, 325–333. Church, G.M., Gilbert, W., 1984. Genomic sequencing. Proc. Nat. Acad. Sci. USA 81, 1991–1995. Collins, F.H., James, A.A., 1996. Genetic modification of mosquitoes. Sci. Med. 3, 52–61. Ferguson, H.M., Read, A.F., 2004. Mosquito appetite for blood is stimulated by Plasmodium chabaudi infections in themselves and their vertebrate hosts. Malaria J. 3, 12. Ghosh, A.K., Moreira, L.A., Jacobs-Lorena, M., 2002. Plasmodium–mosquito interactions, phage display libraries and transgenic mosquitoes impaired for malaria transmission. Insect Biochem. Mol. Biol. 32, 1325–1331. Horn, C., Wimmer, E.A., 2000. A versatile vector set for animal transgenesis. Develop. Genes Evol. 210, 630–637. Ito, J., Ghosh, A., Moreira, L.A., Wimmer, E.A., Jacobs-Lorena, M., 2002. Transgenic anopheline mosquitoes impaired in transmission of a malaria parasite. Nature 417, 452–455. Jahan, N., Hurd, H., 1998. Effect of Plasmodium yoelii nigeriensis (Haemosporidia: Plasmodiidae) on Anopheles stephensi (Diptera: Culicidae) vitellogenesis. J. Med. Entomol. 35, 956–961. James, A.A., 2005. Gene drive systems in mosquitoes: rules of the road. Trends Parasitol. 21, 64–67. Klinkenberg, E.M., Konradsen, F., Herrel, N., Mukhtar, M., van der Hoek, W., Amerasinghe, F.P., 2004. Malaria vectors in the changing environment of the southern Punjab, Pakistan. Trans. R. Am. Soc. Tropic. Med. Hyg. 98, 442–449. Kokoza, V.A., Martin, D., Mienaltowski, M.J., Ahmed, A., Morton, C.M., Raikhel, A.S., 2001. Transcriptional regulation of the mosquito vitellogenin gene via a blood meal-triggered cascade. Gene 274, 47–65.
ARTICLE IN PRESS 700
X. Nirmala et al. / Insect Biochemistry and Molecular Biology 36 (2006) 694–700
Kokoza, V., Ahmed, A., Cho, W.L., Jasinskiene, N., James, A.A., Raikhel, A., 2000. Engineering blood meal-activated systemic immunity in the yellow fever mosquito, Aedes aegypti. Proc. Nat. Acad. Sci. USA 97, 9144–9149. Nirmala, X., James, AA., 2003. Engineering Plasmodium-refractory phenotypes in mosquitoes. Trends Parasitol. 19, 384–387. Nirmala, X., Marinotti, O., James, A.A., 2005. The accumulation of specific mRNAs following multiple blood meals in Anopheles gambiae. Insect Mol. Biol. 14, 95–103. Raikhel, A.S., Kokoza, V.A., Zhu, J., Martin, D., Wang, S.F., Li, C., Sun, G., Ahmed, A., Dittmer, N., Attardo, G., 2002. Molecular biology of mosquito vitellogenesis: from basic studies to genetic engineering of antipathogen immunity. Insect Biochem. Mol. Biol. 32, 1275–1286. Redfern, C.P.F., 1982. 20-Hydroxy-ecdysone and ovarian development in Anopheles stephensi. J. Insect Physiol. 28, 97–103. Romans, P., Tu, Z., Ke, Z., Hagedorn, H.H., 1995. Analysis of a vitellogenin gene of the mosquito, Aedes aegypti, and comparisons to vitellogenins from other organisms. Insect Biochem. Mol. Biol., 939–958.
Rowland, M., Mohammed, N., Rehman, H., Hewitt, S., Mendis, C., Ahmad, M., Kamal, M., Wirtz, R., 2002. Anopheline vectors and malaria transmission in eastern Afghanistan. Trans. R. Soc. Tropic. Med. Hyg. 96, 620–626. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sappington, T.W., Raikhel, A.S., 1998. Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem. Mol. Biol. 28, 277–300. Shin, S.W., Kokoza, V.A., Raikhel, A.S., 2003. Transgenesis and reverse genetics of mosquito innate immunity. J. Exp. Biol. 206, 3835–3843. Vatandoost, H., Mashayekhi, M., Abaie, M.R., Aflatoonian, M.R., Hanafi-Bojd, A.A., Sharifi, I., 2005. Monitoring of insecticides resistance in main malaria vectors in a malarious area of Kahnooj district, Kerman province, southeastern Iran. J. Vector-Borne Dis. 42, 100–108. Yoshida, S., Watanabe, H., 2006. Robust salivary gland-specific transgene expression in Anopheline mosquito. Insect Mol. Biol., in press.