Functional consequences of a Na+ channel mutation causing hyperkalemic periodic paralysis

Neuron,

Vol. 10, 667-678,

April,

1993, Copyright

0 1993 by Cell Press

Functional Consequences of a Na+ Channel Mutation Causing Hyperkalemic Periodic Paralysis Theodore R. Cummins,* Jiuying Zhou,+ Frederick J. Sigworth,*+ Chinwe Ukomadu,+ Megan Stephan,+ Louis J. PMek,*§ and William S. Agnew11 *Interdepartmental Neuroscience Program +Department of Cellular and Molecular Physiology Yale University School of Medicine New Haven, Connecticut 06510 *Department of Neurology SDepartment of Human Genetics University of Utah Health Sciences Center Salt Lake City, Utah 84132 ItDepartment of Physiology Johns Hopkins University School of Medicine Baltimore, Maryland 21205

Summary Hyperkalemic periodic paralysis (HYPP), one of several inheritable myotonic diseases, results from genetic defects in the human skeletal muscle Na+ channel. In some pedigrees, HYPP is correlated with a single base pair substitution resulting in a Met replacing Thr7M in the fifth transmembrane segment of the second domain. This region is totally conserved between the human and rat channels. We have introduced the human mutation into the corresponding region of the rat muscle Na+ channel cDNA and expressed it in human embryonic kidney 293 cells. Patch-clamp recordings show that this mutation shifts the voltage dependence of activation by 10-l 5 mV in the negative direction. The shift results in a persistent Na+ current that activates near -70 mV; this phenomenon could underlie the abnormal muscle activity ob served in patients with HYPP. Introduction Hyperkalemic periodic paralysis (HYPP) is an inherited muscle disorder. This relatively rare myotonic muscle disease is characterized by periods of muscle weakness, often following increases in serum K+ levels (e.g., following exercise or oral K+ ingestion; Streib, 1987). Studiesof biopsied musclefibersdemonstrated that elevated extracellular K+ reduces force generation in HYPP fibers but not normal fibers (LehmannHorn et al., 1983, 1987,199l). These studies showed that the muscle paralysis is due to increased depolarization caused by a noninactivating, tetrodotoxin (TTX)-sensitive current that is present at potentials less negative than -80 mV. This current does not seem to be sensitive to extracellular K+, but is activated by the depolarization that results from elevated extracellular K+(Lehmann-Hornetal.,1987).ThestudybyLehmannHorn and coworkers also provided evidence that decreased extracellular pH could restore the ability of HYPP muscle fibers to generate force in the presence

of elevated extracellular K+. Single-channel Na+ currents have recently been recorded from cultured HYPP myotubes (Cannon et al., 1991) and showed an increased probability that the Na+ channel will enter a noninactivating mode when extracellular K+ is elevated; no change in the voltage dependence of channel gating was noted. Genetic linkage analysis has shown tight linkage between the HYPP gene and the human skeletal muscle Na+channel locus on chromosome 17 (Fontaine et al., 1990; PtP?ek et al., 1991a). Recently, two groups have identified independent mutations in the human skeletal muscle Na+channel that appear to be responsible for hyperkalemic disease (Ptieek et al., 1991b; Rojas et al., 1991). Single base pair substitutions in highly conserved regions of the Na+ channel were identified in each study. This might underlie the clinical heterogeneity that exists among different HYPP families (Streib, 1987). One of the defects, M1592V, is located in the sixth transmembrane segment of domain 4 (Rojas et al., 1991). The cultured cells studied by Cannon et al. (1991) were obtained from a patient with this mutation. The second defect (l704M) is in the fifth transmembrane segment of domain 2 (Pticek et al., 1991b), and it is not known howthis mutation alters Na+ channel properties. It is difficult to study the functional consequences of these defects on Na+ channels in situ for several reasons: experiments that can be conducted on human muscle tissue are limited by tissue availability, and the properties of the channel in tissue from patients with HYPP may be secondarily altered as a result of pathophysiological changes in the muscle. On the other hand, Na+ channels in frog oocytes from cloned cDNAs exhibit anomalous behavior that may be difficult to differentiate from defects caused by the mutation. However, functional channels with essentially normal behavior have been expressed in cultured mammalian cells transfected with the channel a subunit cDNA (Ukomadu et al., 1992). Therefore, we have studied the T704M defect by introducing the corresponding mutation (T698M) into the rat skeletal muscle Nat channel, expressing this channel in human embryonic kidney (HEK293) cells, and studying the kinetics and voltage dependence of this mutant channel using voltage-clamp techniques. Results Channel Expression HEK293 cells were transfected with either the wildtype or T698M mutant ~1 skeletal muscle Na+ channel as previously described (Ukomadu et al., 1992). Western immunoblots of transfected cells showed that roughly comparable amounts of a 230 kd protein were expressed in both wild-type and mutant transfections

Neuron 660

HVPP 34

wt

12

Figure

1. Expression

Levels

Western immunoblot of wild-type (lanes 1 and 2) and mutant (lanes 3and 4) transfected HER293 cells. Crude membrane preparations were made 24 (lanes 1 and 3) and 48 (lanes 2 and 4) hr posttransfection. Cells transfected with T698M expressed roughly the same or slightly more immunoreactive material, compared with wild-type transfected cells.

(Figure 1). Whole-cell patch-clamp recordings showed that cells transfected with the wild-type channel expressed 1-16 nA (mean = 4.7 nA, n = 43, average cell capacitance = 21.1 pF) of fast inactivating inward current, whereas cells transfected with the T698M channel expressed 0.3-6 nA (mean = 0.9 nA, n = 34, average cell capacitance = 24.6 pF) of fast inactivating inward current (Figure 2). In cells expressing either channel, this current was sensitive to lTX and the muscle-specific toxin fr-conotoxin (Cruz et al., 1985). Because HEK293 cells also express endogenous, fast inactivating, voltage dependent Na+ currents (Figure 2), transfected cells with peak Na+ currentsof lessthan 300 pA were not included in the data set. Endogenous current, sensitive to TTX but not l.r-conotoxin, was seen in 28 out of 62 nontransfected cells, with peak

A HYPP

Wild Type

Endogenous J

Test Potential (mV)

1.0 0.3 0.8 0.7 0.6

-

0.5

WILD

0.4 0.3 02

Test Potential (mV) Figure

2. T698M

Mutant

and Wild-Type

Whole-Cell

Currents

(A) Family of current traces from representative HER293 cells transfected with either RI-RBG4 or T698M-RBG4. Traces recorded from a nontransfected cell are also shown. The currents were elicited by test potentials from -65 to -5 in 10 mV steps. Cells were held at -lOOmV,and thepulseduration was20ms.Thecapacitanceofthecellswas27.2 pFfWildType),20.2pF(HYPP),and21.5pF(Endogenous). The series resistance values were 3.4 MD, 3.8 MD, and 6.4 MD, respectively. (8) Peak current-voltage relationship for the cells in (A) (wild type, closed circles; T698M mutant, open squares; endogenous, closed diamonds). (C) Activation curve for T698M (open squares; n = 11) and wild-type (closed circles; n = 8) currents. Data are from cells expressing 1-2 nA of peak current. The activation curves were obtained using the G ~~ = l/fV - V,,,), where CN. is the fraction of conductance, I is the peak current measured, V is the test potential, and V rey is the reversal potential. The voltage dependence of activation for the T698M mutant channels is seen to be shifted by 15 mV in the negative direction (see Table 1).

HYPP Defect 669

Table

Shifts

1. Properties

Na’ Channel

of Nat

Activation

Currents

in HEK293

Cells Activation

Peak Current Wild Type Control l-2 nA pH, 6.8

(22) (8) (3)

HYPP T698M Control (27) l-2 nA (11) 10 mM K’ (6) pH, 6.5 (4) pH, 6.0 (5) Endogenous Control Numbers

(28) in parentheses

(nA)

Steady-State

k (mV/e-fold)

Inactivation --~-

k (mV/e-fold)

VE 0-N)

VK (mV)

2.6 f 1.5 1.4 k 0.5 5.2 t 1.0

6.8 f 7.6 f 6.0 f

0.9 0.7 0.7

-16.2 -12.3 -21.4

f 3.1 f 4.6 f 4.8

7.4 * 1.4 7.0 + 2.0 6.4 t 0.5

-66.8 -63.8 -59.2

* 2.9 f 1.8 * 3.7

0.9 1.5 1.5 0.7 0.7

7.3 7.3 7.0 7.5 6.1

* * f f f

0.9 1.1 0.7 0.6 1.7

-27.5 -27.0 -29.9 -25.8 -29.3

f f * f +

8.6 7.7 7.1 9.6 8.3

-67.9 -66.3 -69.4 -65.4 -59.7

f f * f f

10.9 f

2.4

-61.5

* 8.0

f * f f f

0.05 f indicate

0.6 0.3 0.7 0.3 0.3

0.07 number

of cells.

pH, and

-8.8 pH,

amplitudes of O-300 pA (mean = 51 pA, n = 28, average cell capacitance = 17.8 pF). It is not known which gene gives rise to the endogenous channels. Whole-cell Properties Voktge Dependence of Activation The current-voltage dependence of the currents was examined by applying a series of depolarizing test potentials from a holding potential of -100 mV. The Na+ current in cells expressing wild-type channels activated near -40 mV and peaked near 0 mV, whereas the Na’ current in cells expressing the mutant Na+ channel activated at more negative potentials, near -60 mV, and peaked near -10 mV (Figure 2B). Figure 2C shows the peak conductance (activation) curves for T698M and wild-type Na+ currents in HEK293 cells. The data points were fitted with a Boltzman function (Table 1). The midpoint for Na+ current activation was-27.5mVforcellsexpressingT698M Na+channels and -16.2 mV for cells expressing wild-type Na+channels. The difference was highly reproducible; the shift was seen not only in the entire data population, but also in examining individual sets of experiments in which wild-type and mutant Na+ currents were studied in cells transfected at the same time and examined the same afternoon. A 10 mV shift is not large, and therefore we have addressed whether it could have arisen artifactually. One possibilityisthat itwasduetoelectrodedrift,and this can be tested by examining the reversal potential. The reversal potential for the Na+ current was 67 f 13 mV (n = 27) for cells expressing the mutant T698M channel and 68 + 7 mV (n = 22) for cells expressing the wild-type channel. In both groups, the reversal potential was not statistically different from the Nernst potential for Na+ in these experiments (65.8 mV; intracellular Na+ concentration of 10 mM; extracellular Na+ concentration of 120 mM). A second possible source of error is the presence of endogenous

are intracellular

3.7 4.6 5.0 5.6 4.8

f 0.9 and

10.3 extracellular

f f f + f

1.6 1.4 0.6 2.9 0.6

f 2.8 pH,

4.9 5.4 5.6 2.2 2.4

respectively.

currents. However, endogenous Na+ currents cannot account for the observed shift in the activation curve because they activated at a more positive potential, near -35 mV, and peaked at 0 mV (Figure 26; Table 1). If anything, these currents would appear to cause a shift in theopposite direction in the poorly expressing T698M transfected cells. A third possible sourceof an artifact is series resistance errors. The average series resistance was near 8 MQ for cells expressing either wild-type or T698M channels, and at least 80% series resistance compensation was always employed. Still, because cells expressing wild-type channels typically expressed 5-fold more current than cells expressing mutantchannels,this isaconcern.TheerrorwouId be greater for the group expressing wild-type channels, however, and the effect of the error would be an apparent shift of the wild-type activation curve in the negative direction. Thus, this error would also cause an underestimation of theshift. Nonetheless, wecompared data from cells expressing peak wild-type and mutant currents falling in the range of l-2 nA in an effort to equalize any error. The difference between T698M and wild-type currents was still observed, and as expected, the magnitude of the shift was slightly greater (Table 1). Thus, it is clear that T698M transfected cells express a Na+ current that activates at more negative potentials than those in wild-type transfected cells. inactivation Kinetics The kinetics of fast inactivation were also examined. Macroscopic currents produced by wild-type channels inactivate with two exponential components in frog oocytes (Zhou et al., 1991) and in mammalian expression systems (Ukomadu et al., 1992). In frog oocytes, it has been shown that wild-type channels can switch between two principal gating modes, with depolarizations eliciting either a single, rapid event (mode 1) or a long burst of openings and closings (mode 2) (Zhou et al., 1991; Moorman et al., 1990).

Neuron 670

-a0

Test Potential

0

20

40

__ 460 -,a0 -110 * 170

(mV)

TEST

-70 -60 -m -10 10 anPOTENTIAL

(mV)

R

B

TEST POTENTIAL

(mV)

n

Figure

3. Comparison

of T698M

and Wild-Type

Fast Inactivation

(A) Inactivation decay kinetics as a function of voltage. Time constants were obtained from whole-cell T698M (n = 7) and wild-type (n = 7) currents. The inactivation phase was fitted with the sum of two exponentials. The time constants of the slow decay component (open symbols) are indicated forT698M (open squares) and wild-type currents (open circles). Closed symbols represent the fast time constants for T698M (closed squares) and wild-type (closed circles) currents. Data are expressed as mean f standard deviation. (6) Voltage dependence of the ratio of Irlav/lur,. Open squares represent data from cells expressing T698M; closed circles represent data from cells expressing wild-type channels. The magnitude of the two components was estimated by extrapolating the exponential fits of the decaying phase back to t = 0 for each test potential.

Although wild-type channels expressed in HEK293 cells exhibit both fast and slow inactivation components, the fast component accounts for the majority of the current (98% at 0 mV) (Ukomadu et al., 1992). The T698M mutant also exhibited predominantly the fast inactivating component at most voltages. The fast time constant of inactivation showed a similar voltage dependence forT698M mutant and wild-type currents (Figure 3A). Similar results were also seen when comparing the time constant of the slow component, although the variation was greater among the cells (Figure 3A). The ratio of the magnitude of the slow and fast components (Figure 3B) shows that between -40 and -20 mV, the T698M mutant expressed a higher fraction of the slow component than did thewild-type channel.

-0.

-

ad

0

“““““““““‘( Q 80

Figure 4. Steady-State Wild-Type Currents

HYPP

WlLD

120
Properties

of T698M

400

and

(A) The steady-state inactivation curves for T698M (open squares; n = 11) and wild-type (closed circles; n = 8) channels are shown to the left. Cells were held at prepulse potentials over the range of -160 to -10 mV for 500 ms prior to a test pulse to -10 mV for IO ms. Current is plotted as a fraction of peak current. For comparison, the activation curves for T698M and wild-type currents are also shown. Note that although the voltage dependence of activation is different, the voltage dependence of steady-state inactivation is nearly identical between T698M and wild-type currents. Data are expressed as mean f standard deviation. (B) Data from (A) plotted on a semi-log scale to show the overlap region of the activation and steady-state inactivation curves in greater detail. (C) Recovery from inactivation kinetics. Cells were held at -100 mV, stepped to 0 mV for IO ms to inactivate channels, then brought back to -100 mV for increasing durations prior to the test potential of 0 mV. The time course of recovery was nearly identical for T698M (open squares; n = 10) and wild-type (closed circles; n = 11) currents. Data are expressed as mean * standard deviation.

HYPP Defect

Shifts

Nat Channel

Activation

671

A

B

50pA I-50 msec

so pA 50 msec

-1.5 """'j""'Z'J.Q., -1 00 -90 -60

-70

-60

-50

-40

-30

-20

-10

Test Potential (mV) Figure

5. Voltage

Dependence

of Steady-State

0

-4 -70

", -60

" -50

c -40

-30

-20

-10

0

10

20

Test Potential (mV)

Currents

(A and B) Representative tracings from 1698M (A) and wild-type (B) channels. Cells were depolarized from -100 mV to -80, -60, -40, and -20 mV for 250 ms. Membrane currents were filtered at 100 Hz. (C) Steady-state current measured at 100-200 ms. Cells were held at -100 mV and stepped to test voltages from -100 to -10 mV for 250 ms. The average current measured from 100-200 ms was normalized to the maximum peak current for each cell and is plotted against the test voltage. Data are shown for T698M (open squares; n = 12) and wild-type (closed circles; n = 10) currents. Zero current is indicated with the dashed line. (D) Steady-state current measured at 20-23 ms. Cells were held at -100 mV and stepped to voltages ranging from -65 to -20 mV in 5 mV increments for 20 ms. The average current measured from 20-23 ms is plotted for cells expressing T698M (open squares; n = 14) and wild-type (closed circles; n = 18) currents.

Voltage Dependence of Inactivation The voltage dependence of steady-state inactivation was examined for both the mutant and wild-typechannels. Cells were held at prepulse potentials between -160 and -10 mV for 500 ms prior to stepping to the test potential (-10 mV) for 10 ms. No significant difference was observed when comparing the mutant to the wild type in terms of steady-state inactivation (Figure 4A; Table 1). Because of the shift in the activation curve for the mutant channel, there is a region of overlap with the inactivation curve that is much greater than that observed in the wild-type channel (Figure 48). This suggests that at potentials between -70 and -35 mV, the mutant channels should exhibit a larger steady-state Na+ current.

Recovery from Inactivation The time course for recovery from inactivation was measured (Figure 4C). Cells were prepulsed to 0 mV for 10 ms to elicit inactivation, then held at the recovery potential (-100 mV) for increasing durations before the test depolarization to 0 mV. Wild-type and T698M channels recovered with virtually identical time courses. Similar resultswerealsoobtainedwith recovery potentials of -80 and -120 mV. Steady-State Current We examined the prediction that the mutant channel should exhibit noninactivating currents in the region of overlap between the activation and steady-state inactivation curves. The steady-state current was estimated by averaging the current during the latter parts

Neuron 672

B I -

I

I-70

-60

-50

-40

-20

-20

-10

0

10

20

-70

-60

-50

-40

Test Potential (mV) Figure

6. Elevating

Extracellular

K+ or Decreasing

-so

-20

-10

0

10

20

Test Potential (mV) Intracellular

pH

Does

Not

Alter

T698M

Steady-State

(A) Effect of elevating external K’ on T698M steady-state currents. Data are shown for T698M external K+ concentrations of 3 mM (open squares; n = 14) and 10 mM (closed triangles; n identical between -70 and -30 mV, which is the region of primary physiological significance. error. (8) Effect of decreasing intracellular pH on T698M steady-state currents. Data are shown for with intracellular pH at 7.3 (open squares; n = 14) and 6.8 (closed diamonds; n = 4). Data are the mean.

of 23 ms or 200 ms test depolarizations to varying potentials. At 100-200 ms, a steady-state current activating near -70 mV was seen in cells expressing the T698M mutant. Incellsexpressingwild-typechannels, a steady-state current was also seen, but it did not activate until near -30 mV and was smaller than that seen in the T698M cells at all potentials (Figures 5A, 5B, and 5C). The steady-state current measured at 2023 ms was also greater for T698M currents than wildtype currents (Figure 5D). TTX (1 PM) blocked the sustained current by 82% (* 6%, n = 3) and 89% (* 3%, n = 2) and the peak current by88% (* 9%, n = 3) and 95% (* 4%, n = 2) in cells expressing T698M and wild-type channels, respectively. Because HEK293 cells express endogenous currents that are lTX sensitive, we also checked the relative sensitivity of the sustained and peak currents to w-conotoxin (500 nM). @Ionotoxin blocked the sustained current by 77% (* 12%, n = 5) and 82% (+ 13%, n = 6) and the peak current by 66% (* 16%, n = 5) and 79% (* 16%, n = 5) in cells expressing T698M and wild-type channels, respectively. Therefore, because the sustained currents were blocked bylTX and w-conotoxin to roughly the same extent as the peak currents and measurable steady-state currents were not seen in nontransfected cells or mock-transfected cells, we conclude that the sustained currents are carried bythe mutant and wildtype ~1 channels. Effect of Extracehiar K+ on HYPP Elevating serum K+ levels can elicit muscle weakness in patients with HYPP, and serum K+ levels of 6-9 mM are observed during periods when muscle weakness is induced by other means. Cannon et al. (1991) ob-

Currents

currents, measured at 20-23 = 6). The steady-state current Data are expressed as mean f

ms, with is nearly standard

T698M currents, measured at 20-23 ms, expressed as mean + standard error of

served that the M1592V mutant channels studied in cultured human myotubes were more Iikelyto exhibit noninactivating behavior in the presenceof increased extracellular K+. Therefore, we examined the effects of 10 mM extracellular K+ on T698M Na+ currents. Increasing extracellular K+ had no detectable effect on whole-cell currents. The voltage dependence of activation and that of inactivation were indistinguishable from those observed in 3 mM KC (Table 1). The kinetics of fast inactivation and the steady-statecurrent (Figure 6A) were also unaffected.

1.0 n n 0.9 * 0 0.8 A 0.7 s R 0.5 0 0 0.4 6 0.9

-130

-110

TEST Figure dence rents

-90

-70

-50

POTENTIAL

7. Effect of Intracellular of Steady-State Inactivation

-30

-10

10

0.3

E

02

2

0.1

5

0.0

m

30

(mV)

Acidity on the Voltage Depenand Activation for T698M Cur-

The patch pipette solution was adjusted to either pH 7.3 (open squares; n = 11) or pH 6.8 (closed squares; n = 5). The activation curve was obtained as described for Figure 2 and the steady-state inactivation as described for Figure 4. Data are expressed as mean + standard deviation.

HYPP Defect 673

Shifts

Na’ Channel

Activation

B

Wild Type

-

C

D 0.0

xl0

-23 A2

-0.2 -0.4

i

-0.6

t

.

,

-0.6

.

, /

-1.0

,

-1.2 -

*

-1.6

- 6

a

-1 .(I

15

L

10

0 4

.

-1.4

, 0

, /

-2.oLc/. a0

-40

-20

j

-20

v

-10

0

10

20

2 Figure

8. Currents

from

Patch

3 PA

Recordings

(A) Current traces in response to 30 ms test pulses to -10 mV. Each trace is the average of eight consecutive sweeps. From the peak current amplitude, we estimate that the patches contained at least IO (HYPP-T698M) and 25 (WQ channels, respectively. (6) Current traces in response to long test pulses to -50 mV from 3 different patches. Data were digitally filtered at 1 kHz for display. Late events were observed in both wild-type (traces 2 and 3) and T698M (trace 1) transfections. Peak currents at -10 mV were 16, 37, and 7.3 pA for the patches in traces 1, 2, and 3, respectively. (0 Single-channel current-voltage relationship measured from cell-attached patches. Open symbols are averages measured from individual traces for wild-type early (open circles) and late (open triangles) events and T698M early (open squares) and late (open diamonds) events. Early events are defined as activity within the first 10 ms of each test depolarization and late events as those that occurred after 100 ms. Measurements from nonstationary noise analysis for T698M (closed square) early events are also shown. (D) Nonstationary noise analysis of currents in a T698M cell-attached patch. Data were acquired at 5 kHz bandwidth from 200 depolarizations to -10 mV. The variance-mean relationship during the inactivating phase of the currents is plotted and fitted (smooth curve) as described by Sigworth (1980). From the fit, estimates were obtained for the singlechannel current i = 0.8 pA and the number of channels n = 9. The estimated peak open probability was 0.5.

Effect of Extracefhdar Acidity Decreasing extracellular pH has been reported to have a protective effect on force generation in HYPP muscle fibers (Lehmann-Horn et al., 1987). We studied the effect of decreasing extracellular pH to 6.5 on the whole-cell Na+ current properties of HEK293 cells expressing T698M. No discernable effect was found on any of the whole-cell current properties examined, including steady-state currents, voltage dependence of activation, voltage dependence of inactivation, and kinetics of fast inactivation (Table 1). Efkt of lntracefhdar Acidity During periods of exercise, when HYPP symptoms are often absent despite elevated serum K+ levels, it is likely that intracellular pH is decreased (Renaud, 1989; Pan et al., 1988). We examined the effect of decreasing

intracellular pH by recording with a patch electrode solution with a pH of 6.8. This 0.5 unit decrease in intracellular pH did not alter the voltage dependence of activation (Table 1). However, the voltage dependence of inactivation for the T698M mutant channels was shifted by 8 mV in the depolarizing direction (Table 1; Figure 7). A shift of about 5 mV was seen for wild-type channels. No effect on the kinetics of fast inactivation was discernable, but it is unlikely we could resolve a shift on the order of IO mV for this measure. The steady-state current, measured at 20-23 ms, was similar (Figure 6B). Single-Channel Properties Single-channel recordings in the cell-attached configuration were made on HEK293 cells transfected with either the wild-type or T698M mutant cDNA. As pre-

Neuron 674

viously reported (Ukomadu et al., 1992), patches from cells transfected with the wild-type channel typically contained 10 or more channels (Figure 8A). Patches from cells transfected with the mutant cDNA exhib ited far fewer openings in each test depolarization, indicating that fewer active channels were present (Figure 8A). Typically, only 1 out of 10 patches contained active channels, and this presented problems in the collection of singlechannel data on the T698M mutant. At -50 mV, the T698M channels were seen to open at a substantial rate after hundreds of milliseconds of depolarization (trace 1 in Figure 8B). Some wild-type patches also showed late openings, however (trace2)Theaveragecurrent computed from late channel activity in 3 TfB8M patches at -50 mV was 2.8% and that at -30 mVwas 2.9% of the peak current. However, in 4 wild-type patches, the average current was 2.2% of the peak current at -50 mV and 1.9% at -30 mV and was not significantly different. For the measurement of steady-state current, we take the whole-cell recordings to be more reliable because they reported averages over many more channels than the patch recordings. The amplitude of single-channel events was indistinguishable between T698M and wild-type channels and between early and late events (Figure 8C). Thus, the T698M mutation appeared not to affect channel conductance, and the result was also consistent with the idea that the early and late events arise from the same channel population. Noise analysis showed a single-channel peak open probability of about 0.5 for both T698M channels (Figure 8D) and wild-type channels (Ukomadu et al., 1992). Discussion We have expressed the T698M HYPP mutant ui Na+ channel in HEK293 cells and recorded Na+ currents. These currents were sensitive to p-conotoxin and TTX. The primary findings of this study are that the T698M mutation resulted in lower peak current densities, a more negative midpoint voltage of activation, and a larger proportion of steady-state current. We also noted that whereas the T698M channels were not sensitive to increases in extracellular K+, both T698M and wild-type currents were modulated by intracellular acidity. Cannon and Strittmatter (1993) have also examined the T698M mutation in HEK293t cells. Although they too observe an increased persistent current, their results differ from ours in some details that will be commented on below. Expression levels We noted that the peak current density in cells expressing the T698M channel was consistently 3- to 5-fold lower than that in cells expressing the wild-type channels, and Cannon and Strittmatter (1993) observed an -50% smaller peak current for HEK293t cells transfected with the T698M mutation than with

either the M1592V mutation or wild-type channel. However, whereas the peak current density is lower, we detected a similar level of protein in T698M transfected cells by Western immunoblots. There are several potential explanations for this discrepancy. First, a previous study has indicated that the majority of the wild-type channel protein (90%-95%) may remain trapped in the cells (Ukomadu et al., 1992) and perhaps even lower surface expression occurs with the mutant channel; it does seem unlikely, however, that a single amino acid change which results in a comparatively subtle alteration in channel gating would greatly affect surface expression. A second possibilitywould be that the single-channel conductance is reduced; a smaller single-channel conductance was reported for channels in HYPP muscle fibers (LehmannHorn et al., 1991). This does not seem to be the case: our measurements and measurements by Cannon and Strittmatter (1993) show that the T698M and wildtype channels have identical single-channel current amplitudes. A third possibility is that the peak open probability is lower for T698M channels. The result from noise analysis of T698M channels (Figure 8D) shows a peak open probability of about 0.5 at depolarizations to -10 mV. This is typical for Na+ channels at this voltage and cannot account for the reduced peak current. A fourth possibility is that the same number of channels is expressed in the membrane, but the average peak current is low because many of the channels either are not functional or spend time in a silent mode not available for activation (see Zhou et al., 1992). It is interesting to note that Auld et al. (1988) observed that a mutation in the second domain of the rat IIA Na+ channel (F86OL) produced roughly 5-fold lower currents than did the wild-type Rlla construct in oocytes injected with the same amount of RNA. Functional Consequences The T698M mutant is identical to the wild-type channel with respect to kinetics of fast inactivation, voltage dependenceof steady-state inactivation, and recovery from inactivation. However, the voltage dependence of activation is shifted IO-15 mV in the negative direction for the HYPP mutant compared with the wild-type channel. A negative shift in the activation curve should decrease the threshold for action potential generation and increase excitability. It is possible that under some conditions, this increase in excitability may contribute to the myotonia observed in individuals with the T698M mutation (Pti?ek et al., 1991b). The shift in the activation curve also results in a significant overlap between the steady-state activation and inactivation curves, predicting increased steady-state Na+ currents at voltages between -70 and -35 mV. The increased current can explain the enhanced depolarization seen in muscle fibers of patients with HYPP when extracellular K+ is elevated. Lehmann-Horn et al. (1987) have shown that 7-9 mM extracellular K+ is sufficient to depolarize normal hu-

HYPP Defect 675

Shifts Nat Channel

Activation

man muscle tissue from a typical resting potential near -80 mV to -63 mV; in contrast, the same treatment depolarized HYPP muscle fibers to -57 mV. At -63 mV, wild-type Na+ channels do not activate, but this is in the region of overlap for T698M channels. At -60 mV, we observed a noninactivating current representing -0.5% of the maximum peak Na+ current in cells expressing T698M channels. This current could yield a substantial membrane depolarization. Assuming a noninactivating current of only 0.25% at -63 mV and using a membrane resistance of 500 Sz cm2 and a maximum peak Na+ current of 4-7 mAlcm2 (Pappone, 1980), the steady-statecurrent would cause a depolarization of 5-9 mV or to roughly -56 mV. At these depolarized potentials, only -20% of the Na+ channels are not inactivated, and the muscle will be less able to generate frequent action potentials. These properties may thus contribute to the periodic paralysis seen in these patients. In our analysis, we have normalized the steady-state current to the maximum peak current in each cell, assuming that the latter is proportional to the total number of Na+ channels. The peak currents observed in the wild-type transfections were much higher than those in the T698M transfections (Table I), although the total amount of protein expressed was roughly equivalent (Figure 1). We favor the view that the reduced peak current with T698M results from fewer functional channels reaching the plasma membrane and therefore, that normalizing to peak current is ap propriate. However, an alternative view would be that the normal number of channels are expressed in the membrane, and whereas the average peak current is low, the steady-state current is not altered by the mutation. In this view, our result of a relatively large steady-state current at voltages more positive than -40 mV would be explained simply by our normalization to a low peak current value. Our data, showing that the single-channel conductance and the peak open probability are unchanged by the mutation, argue against this. Thus, for lack of a better assay, we feel that the maximum peak current is a measure that is reasonably proportional to the total number of available Na+ channels. In either case, the T698M channels exhibit a steady-state current between -70 mV and -35 mV that is not observed in the wild type (Figure 5C), and the studies by Lehmann-Horn et al. (1987) indicate that this voltage range is physiologically significant for HYPP. Cannon and Strittmatter (1993) have also observed larger persistent Na+ currents in HEK293t cells transfected with theT698M mutant than with thewildtype channels, but the relative amount of persistent current was greater than we measured (-8%). The reason for this discrepancy is not entirely clear. One possible explanation is that Ca2+ inhibits the steadystatecurrent: we used no Ca2+ buffers in our recording solution, whereas their solution included 5 mM EGTA. Preliminary experiments in our laboratorywith T698M

transfected cells indicate that Cap can indeed modulate the steady-state current: the steady-state current at-IOmVwasonly -2.5%ofthepeakcurrentwithout EGTA in the pipette (n = 14), but was more than 5% of the peak current with 5 mM EGTA and no added Ca2+ in the pipette (n = 7). The addition of EGTA to the recording pipette did not seem to affect the shift in the activation curve, and the amount of steady-state current between -70 mV and -40 mV did not seem to be altered. One important difference between our study and that of Cannon and Strittmatter (1993) is that they did not report a shift in the voltage dependence of activation. The data in Figure 5C of their paper, however, shows that T698M channels are activated to a greater extent than wild-type channels at -40 mV, which is consistent with the voltage shift that we observe. This shift may be particularly important in giving rise to the noninactivating Na+ currents observed at negative potentials (activating between -80 and -70 mV) in muscle tissue removed from patients with HYPP (Lehmann-Horn et al., 1987). Role of Extracellular K+ in HYPP We found that increased extracellular K+did not have any direct effect on either the whole-cell currents or the single-channel properties of the mutant studied here. Cannon et al. (1991) concluded that increased extracellular K+ was necessary to observe abnormal channel behavior in cultured human myotubes. It is now known that the patient from whom that tissue was obtained carries the M1592V mutation (Rojas et al., 1991). In contrast, the early activating, noninactivating Na+ current observed by Lehmann-Horn et al. (1987) in HYPP muscle wasobserved even with normal extracellular K+. It has been suggested that distinct hyperkalemic clinical syndromes can be distinguished (Streib, 1987). While both theM1592Vand the T704M mutations have been found in HYPP patients with myotonia, some patients with the T704M mutation appear to suffer from a more severe interattack weakness. Thus, whereas it is possible that elevated K+ might have a direct effect on the M1592V mutant in vivo, its effect on the T698M mutation appears to be indirect. Protective Effect of Acidity An intriguing featureof HYPP is that muscleweakness usually appears during periods of rest after exercise (Subramony and Wee, 1986), but not during exercise when extracellular K+ is also elevated. Extracellular acidity has been reported to exert a protective effect against muscle weakness in HYPP patients. LehmannHorn et al. (1987) found that lowering the extracellular pH to 6.5 antagonized or prevented the decrease in the force of muscle fiber contractions. Whereas lowered pH did not inhibit K+-induced depolarization in HYPP tissue, they observed that it did block the decrease in force generation. It was concluded that this

Neuron 676

T704M HSkMl RSkMl RI1 RIIa ShkrA

664 664 658 845 845 348

GISVLRSFRL GLSVLRSFRL GLSVLRSFRL GLSVLRSFRL GLSVLRSFRL iLrViRlvRv * * *

LRVFKLAKSW LRVFKLAKSW LRVFKLAKSW LRVFKLAKSW LRVFKLAKSW fRiFKLarhs * *1 *

I~=IEIIIE=Er=ill31~i-==-------s4 Figure

9. Comparison

of Amino

The locations of the T704MfT698M in S4 are indicated by asterisks, marked with i’s.

Acid

PTLNMLIKII PTLNMLIKII PTLNMLIKII PTLNMLIKII PTLNMLIKII kgLqiLqrt1 * 2 =--=====

GNSVGALGNL GNSVGALGNL GNSVGALGNL GNSVGALGNL GNSVGALGNL kaSmreLGlL 3 i

4 i

mLVLAIIVF1 TLVLAIIVFI TLVLAIIVFI TLVLAIIVFI TLVLAIIVFI iffLfIgVv1

FAWGMQLFG FAWGMQLFG FAWGMQLFG FAWGMQLFG FAWGMQLFG Fssavyfaea

+ 5 =========i=====?-

KSYKECVCKI KSYKECVCKI

733 733

KSYKFCVCKI

727

KSYKFCVCKI KSYKECVCKI gSensffks1

904 904 417

EzEcs=~~~ 55

Sequence

of the S4-S5 Regions

of Domain

‘2 from

Various

Na+ Channels

and the %A

K+ Channel

mutation, the cloning mutation in Rlla, and the Sh5 mutation are indicated with arrows. Basic residues and the leucines in the heptad repeat are numbered l-5. The mutations that alter ShB inactivation are

results from a shift in the steady-state inactivation curve in the depolarizing direction. We did not find any significant effect of decreasing extracellular pH (to 6.5) on the properties of the mutant Na+ channel. Cannon et al. (1991) also did not find any effect of decreasing extracellular pH. We speculate that the protective effect is instead due to lowered intracellular pH. This would be consistent with the results of Lehmann-Horn et al. (1987) insofar as changes in extracellular pH can shift intracellular pH (Birnberger and Klepzig, 1979; Aickin and Thomas, 1977). While the Lehmann-Horn et al. studies were conducted using microelectrodes, which do not subject the cells to significant intracellular dialysis, we have used large patch pipettes, which effectively clamp intracellular pH to that of the pipette solution. When we lowered the pH of the pipette solution to 6.8, the voltage dependence of activation was not altered, but the steady-state inactivation curve was shifted 5-10 mV in the depolarizing direction. The steadystate current was not inhibited, and in fact might have been slightly enhanced; however, the observed shift of the steady-state inactivation curve would cause the percentage of activable channels at -57 mV to be increased from 25% to 60% and thus mediate an increase in excitability. Recent studies have demonstrated that during periods of muscle activity (e.g., intense exercise), intracellular pH can drop by as much as 1 pH unit (Renaud, 1989; Pan et al., 1988). Other protective effects of low intracellular pH may not directly involve the Na+channel. Skeletal muscle is rich in ATP-sensitive K+ channels; these channels are sensitive not only to decreases in ATP levels, but also to intracellular pH (Davies, 1990). Activation of ATP-sensitive K+ channels during exercise by lowered ATP and intracellular pH would tend to prevent the anomalous depolarization by T698M channels. Mechanistic Implications The T698M mutation occurs in a region of the Na+ channel about which relatively little is known. Several studies have focused on the corresponding region of

K+ channels, and mutations in this region can alter channel activation, conductance, and inactivation. lsacoff et al. (1991) found that some mutations in the S4-S5 loop of the Shaker B (ShB) channel can alter inactivation and channel conductance. Several different studies have identified residues in the S4-S5 region that appear to be important in activation. The S5 segment of the Shaker channel contains the Sh5 mutation. This mutation, F389l in the ShB sequence (Figure 9), results in a positive shift (-20 mV) in the voltage dependence of activation (Zagotta and Aldrich, 1990). The alignment of the Shakerand Na+ channel sequences shown in Figure 9, based primarily on the position of charged residues in S4, puts the Shs mutation adjacent to the T698M mutation. McCormack et al. (1991) studied the role of a leucine heptad repeat found in the S4-S5 region of a Shaker K+ channel; this sequence is conserved in other voltageregulated channels, including the skeletal muscle Na+ channels (Figure 9). It was found that replacing either ofthefirsttwoleucines(L363and L370 in theS4regior-r) with avaline shifted thevoltagedependenceof activation for the Shaker channel in the positive direction; substituting a valine for either one of the two leucines in the S5 region (L384 and L391) shifted the voltage dependence in the negative direction. TheT698M mutation lies between the corresponding leucines in the S5 region of domain II in the skeletal muscle Na+channel (L700 and L707 [human]; L694 and L701 [rat PI]). Another Na+ channel mutation suggests that this region is conserved between Shaker channels and Na+ channels in structureand functi0n.A mutation (L86OF) identified during the cloning of the rat brain RIIA Na+ channel shifted the voltage dependence of activation 20-25 mV in the depolarizing direction (Auld et al., 1990). The change of leucine to phenylalanine in the S4 region of the second domain corresponds to the first leucine in the Shaker leucine heptad repeat, which, as mentioned above, also shifted activation for theshakerchannel inthepositivedirection.Although the mechanisms whereby these mutations affect gating properties are unresolved, our present findings

HYPP Defect 677

Shifts

Nat Channel

Activation

further underscore the functional importance of this region of the channel. The possibility must be kept in mind, however, that the HYPP mutations might display different characteristics in the native muscle tissue than they do in transfection systems or cultured cells. These experimental systems should nevertheless provide an avenue for exploring therapeutic strategies for the treatment of patients with the HYPP T698M mutation. Experimental

Procedures

Construction of the T698M Recombinant The 5922 bp EcoRl fragment containing the wild-type PI cDNA from pul-2 (Trimmer et al., 1989) was ligated into the mammalian expression vector pRBC4 (Ukomadu et al., 1992) at the unique EcoRl site, downstream from the cytomegalovirus immediate early promoter/enhancer. The region to be mutated in domain II was then removed using two unique flanking restriction sites, BssHll and Sphl, leaving an -9700 bp u vector fragment. The excised region was replaced by a pair of complementary oligonucleotides that, when annealed, formed appropriate fragments for ligation into the BssHll and Sphl sites: S’P-CGCGCFGCCTAACCTGATG~CGTCCTGGCTATCATCCTGlTCATCllCGCCGTGCTGGCCATC3’ and 3’-CACCCAlTGGACTACCACCACGACCGATAGTAGCACAAG TAGAAGCGGCACCACCC-P5 The sequence of the synthetic fragment corresponds to the human ul sequence in this region, with the sixth codon mutated from ACG (threonine) to ATG (methionine). The amino acid sequences of the rat and wild-type human PI Na+ channels are identical in this region, although the nucleotide sequences are not. The synthetic fragment also encodes a BstEll site that is found in the human but not the rat sequence. The oligonucleotides (0.1 mg/ml) were 5’ phosphorylated with 20 U of T4 polynucleotide kinase in 0.5 M Tris-HCI (pH 7.5), 0.1 M MgC12, 50 mM dithiothreitol for 1 hr at 37“C. Theywere annealed to each other by heating them in an equimolar mixture to 90°C for 10 min and allowing the mixture to cool slowly to room temperature (about 1.5 hr). The newly annealed fragment was added (at 0.01 mg/ml) directly to a ligation mixture containing the 9700 bp ul vector fragment (at 0.025 mglml), ligated, and transformed (Sambrook et al., 1989). Recombinant plasmids were screened for the presence of a new BstEll site. Transfection of HEK293 Cells Transfections were carried out using the Ca2+ phosphate precipitation technique (Graham and van der Eb, 1973). HEK293 cells were grown under standard tissue culture conditions in Dulbeccos’s modified Eagle’s medium supplemented with 10% fetal bovine serum. The Caz+ phosphate-DNA mixture was added to the cell culture medium and left for 15-20 hr, after which time the cells werewashed with fresh medium. Electrophysiologic experiments were usually performed 36-72 hr posttransfection. lmmunocytochemistry The procedures for Western immunoblots have been previously described (Ukomadu et al., 1992). Briefly, each lane was loaded with 20 ug of total membrane protein and the proteins were electrophoresed on a 4%-15% polyacrylmide-SDS gel. After electrophoretic transfer to nitrocellulose paper, the strips were incubated in primary monoclonal antibody fb-MC (which recognizes interdomain segment 2-3, amino acids855-958). Blots were washed, incubated with ‘?-protein A for 45 min, washed, and placed on Kodak XRP-1 diagnostic film for visualization using autoradiography. Whole-Cell Whole-cell temperature mize space

Recordings patch-clamp recordings were conducted at room (-22OC) using an AxoPatch IC amplifier. To miniand clamp problems, and because HEK293 cells can

be electrically coupled, only isolated cells with a soma size of IO-30 urn were selected for recording. Cells were not considered for analysis if the initial seal resistance was less than 5 Gn, or if they had high leakage currents (holding current x.1 nA at -80 mV), membrane blebs, or an access resistance greater than 12 Mbl. The average access resistance was 7.7 f 2.5 Mn (n = 56). Access resistance was monitored throughout the experiment, and data were not used if resistance changes occurred. Voltage errors were minimized using 80% series resistance compensation, and thecapacitanceartifactwascanceled usingthecircuitty of the patch-clamp amplifier (AxoPatch IQ. Linear leak subtraction, based on resistance estimates from four hyperpolarizing pulses applied before the depolarizing test potential, was used for all voltage-clamp recordings. Membrane currents were filtered at 5 kHz and sampled at 20 kHz. The pipette solution contained 130 mM CsCI, 2 mM MgCl,, 10 mM glucose, and 10 mM Nat-HEPES (pH 7.3). The standard bathing solution was 120 mM NaCI, 20 mM choline-Cl-, 3 mM KCI, 2 mM MgCl?, 1 mM CaC&, IO mM HEPES, and 10 mM glucose (pH 7.3). The osmolarity of all solutions was adjusted to 300 mosmol. Single-Channel Recordings Single-channel currents were measured from cell-attached patches. For these experiments, the cell membrane potential was zeroed by using a high K+ bathing solution (150 mM K’ aspartate, 5 mM KCI, 4 mM MgCI,, 2 mM CaCl?, 10 mM HEPES [pH 7.211, and the pipette solution contained a high Na+ solution (150 mM NaCI, 10 mM KCI, 4 mM MgC&, 2 mM CaCl?, 10 mM HEPES [pH 7.21). Acknowledgments This work was supported by NIH research grants NS 17928 to W. 5. A., HL 38156 to W. 5. A. and F. J. S., and Kll HDOO940-01 to L.J. P.,apredoctoralfellowshipfrom NIH Eye Institutetraining grant EYO-7115-02 to T. R. C., and a grant from the Muscular Dystrophy Association to W. 5. A. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement”in accordance with 18 USC Section 1734 solely to indicate this fact. Received

October

21,1992;

revised

January

14, 1993.

References Aickin, C. C., and Thomas, R. C. (1977). Micro-electrode ment of the intracellular pH and buffering power leus muscle fibres. J. Physiol. 267, 791-810.

measure of mouse so-

Auld, V. J., Goldin, A. L., Krafte, D. S., Marshall, J., Dunn, J. M., Catterall, W.A., Lester, H.A., Davidson, N., and Dunn, R. J. (1988). A rat brain Nat channel a subunit with novel gating properties. Neuron 7, 449-461. Auld, V. J., Goldin, A. L., Krafie, D. S., Catterall, W.A., Lester, H. A., and Davidson, N. (1990). A neutral amino acid change in segment II54 dramatically alters the gating properties of the voltage-dependent sodium channel. Proc. Natl. Acad. Sci. USA 87, 323-327. Birnberger, K. L., and Klepzig, lar potassium and intracellular 23-35. Cannon, channel induced

M. (1979). Influence pH on myotonia.

of extracelluJ. Neural. 22,

5. C., Brown, R. H., Jr., and Corey, D. P. (1991). A sodium defect in hyperkalemic periodic paralysis: potassiumfailure of inactivation. Neuron 6, 619-626.

Cannon, 5. C., and Strittmatter, 5. M. (1993). Functional expression of sodium channel mutations identified in families with periodic paralysis. Neuron 70, 317-326. Cruz, L. J., Gray, W. R., Olivera, B. M., Veikus, R. D., Kert, L., Yoshikami, D., and Moczydlowski, E. (1985). Conusgeographicus toxins that discriminate between neuronal and muscle sodium channels. J. Biol. Chem. 260, 9280-9288.

Neuron 678

Davies, skeletal

N. W. (1990). Modulation muscle by intracellular

of ATP-sensitive protons. Nature

Fontaine, B., Khurana, T. S., Hoffman, Haines, J. L., Trofatter, J. A., Hanson, M. H., Yasek, D. M., Romano, D., Gusella, (1990). Hyperkalemic periodic paralysis sodium channel a-subunit gene. Science

K+ channels in 343, 375-377.

E. P., Bruns, G. A. P., P., Rich, J., McFarlane, J. F., and Brown, R. H. and the adult muscle 250, 1000-1002.

Graham, F. L., and van der Eb, A. J. (1973). A new technique assay of infectivityof human adenovirus5 DNA. Virology52,456467.

for

Isacoff, E. Y., Jan, Y. N., and Jan, L. Y. (1991). Putative receptor for the cytoplasmic inactivation gate in the Shaker K+ channel. Nature 353, 86-90. Lehmann-Horn, F., Riidel, R., Ricker, K., Lorkovic, H., Dengler, R., and Hopf, H. C. (1983). Two cases of adynamia episodica hereditaria: in vitro investigation of muscle cell membrane and contraction parameters. Muscle Nerve 6, 113-121. Lehmann-Horn, F., Kiither, C., Ricker, and Riidel, R. (1987).Adynamiaepisodica nia: a non-inactivating sodium current lular pH. Muscle Nerve 70, 363-374.

K., Grafe, P., Ballanyi, K., hereditariawith myotoand the effect of extracel-

Lehmann-Horn, F., laiuo, P. A., Hatt, H., and Franke, C. (1991). Altered gating and conductance of Na’channels in hyperkalemic periodic paralysis. Pfliigers Arch. 478, 297-299. McCormack, K., Tanouye, M. A., Iverson, L. E., Lin, J., Rawaswami, M., McCormack,T., Campanelli, J. T., Mathew, M. K., and Rudy, B. (1991). A role for hydrophobic residues in the voltagedependent gating of Shaker K+ channels. Proc. Natl. Acad. Sci. USA 88,2931-2935. Moorman, J. R., Kirsch, G. E., VanDongen, A. M. J., Joho, R. H., and Brown, A. M. (1990). Fast and slowgating of sodium channels encoded by a single mRNA. Neuron 4,243-252. Pan, J. W., Hamm,J. R., Rothman, D. L., and Shulman, R. G. (1988). Intracellular pH in human skeletal muscle by 1~ NMR.Proc. Natl. Acad. Sci. USA 85,7836-7839. Pappone, denervated 377-410.

P. A. (1980). Voltage-clamp experiments mammalian skeletal muscle fibers.

in normal J. Physiol.

and 386,

PtdTek, L. J., Tyler, F., Trimmer, J. S., Agnew, W. S., Leppert, M. (1991a). Analysis in a large hyperkalemic periodic paralysis pedigree supports tight linkage to a sodium channel locus. Am. J. Hum. Cenet. 49, 378-382. PtaPek, L. J., George, A. L., Griggs, R. C., Tawil, R., Kallen, R. G., Barchi, R. L., Robertson, M., and Leppert, M. F. (1991 b). Identification of a mutation in the gene causing hyperkalemic periodic paralysis. Cell 67, 1021-1027. Renaud, J. M. (1989). The effect of lactate on intracellular pH and force recovery of fatigued sartorius muscles of the frog, Rana pipiens. J. Physiol. 476, 31-47. Rojas, C. V., Wang, J., Schwartz, L. S., Hoffman, E. P., Powell, B. R., Brown, R. H., Jr. (1991). A Met-to-Val mutation in the skeletal muscle Na* channel a-subunit in hyperkalaemic periodic paralysis. Nature 354, 387-389. Rudel, R., and Lehmann-Horn, cells from myotonia patients. Sambrook, J., Fritsch, Cloning: A Laboratory bor, New York: Cold

F. (1985). Membrane changes Physiol. Rev. 63, 310-356.

E. F., and Maniatis, T. (1989). Molecular Manual. Second Edition (Cold Spring HarSpring Harbor Laboratory).

Sigworth, F. J. (198O).Thevarianceof at the node of Ranvier. J. Physiol.

sodium current 307, 97-129.

Streib, E. W. (1987). AAEE minimonograph nosis of myotonic syndromes. Muscle Subramony, hyperkalemic

in

fluctuations

#27: differential Nerve 70,603-615.

S. H., and Wee, A. S. (1986). periodic paralysis. Neurology

Exercise and 36, 173-177.

diagrest in

Trimmer, J. S., Cooperman, S. S., Tomiko, S. A., Zhou, J., Crean, S. M., Boyle, M. B., Kallen, R.G., Sheng,Z., Barchi, R. L., Sigworth, F. J., Goodman, R. H., Agnew, W.S., and Mandel, G. (1989). Primary structure and functional expression of a mammalian skeletal muscle sodium channel. Neuron 3, 33-49.

Ukomadu, C.,Zhou, J., Sigworth, F. J.,andAgnew, W. S. (1992). ~1 Na+channels expressed transiently in human embryonic kidney cells: biochemical and biophysical properties. Neuron 8, 663676. Zagotta, W. N., and Aldrich, R. W. (1990). Alterations gating of single Shaker A-type potassium channels mutation. J. Neurosci. 70, 1799-1810.

in activation by the ShS

Zhou, J., Potts, J.F., Trimmer, J. S., Agnew, W. S., and Sigworth, F. J. (1991). Multiple gating modes and the effect of modulating factors on the PI sodium channel. Neuron 7, 775-785.