Functional diversification of kir7.1 in cichlids accelerated by gene duplication

Gene 399 (2007) 46 – 52 www.elsevier.com/locate/gene

Functional diversification of kir7.1 in cichlids accelerated by gene duplication Masakatsu Watanabe, Kazue Hiraide, Norihiro Okada ⁎ Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Japan Received 29 January 2007; received in revised form 23 April 2007; accepted 25 April 2007 Available online 1 May 2007 Received by Takashi Gojobori

Abstract Mutation in the inward rectifier potassium channel gene, kir7.1, was previously identified as being responsible for the broader stripe zebrafish skin pattern mutant, jaguar/obelix. An amino acid substitution in this channel causes a broader stripe pattern than that of wild type zebrafish. In this study we analyzed cichlid homologs of the zebrafish kir7.1 gene. We identified two kinds of homologous genes in cichlids and named them cikir7.1 and cikir7.2. Southern hybridization using cichlid genome revealed that cichlids from the African Great Lakes, South America and Madagascar have two copies of the gene. Cichlids from Sri Lanka, however, showed only one band in this experiment. Database analysis revealed that only one copy of the kir7.1 gene exists in the genomes of the teleosts zebrafish, tetraodon, takifugu, medaka and stickleback. The deduced amino acid sequence of cikir7.1 is highly conserved among African cichlids, whereas that of cikir7.2 has several amino acid substitutions even in conserved transmembrane domains. Gene expression analysis revealed that cikir7.1 is expressed specifically in brain and eye, and cikir7.2 in testis and ovary; zebrafish kir7.1, however, is expressed in brain, eye, skin, caudal fin, testis and ovary. These results suggest that gene duplication of the cichlid kir7.1 occurred in a common ancestor of the family Cichlidae, that the function of parental kir7.1 was then divided into two genes, cikir7.1 and cikir7.2, and that the evolutionary rate of cikir7.2 might have been accelerated, thereby effecting functional diversification in the cichlid lineage. Thus, the evolution of kir7.1 genes in cichlids provides a typical example of gene duplication—one gene is conserved while the other becomes specialized for a novel function. © 2007 Published by Elsevier B.V. Keywords: Teleosts; Gene expression; Potassium channel

1. Introduction Cichlids are freshwater fish which belong to family Cichlidae and are distributed in the tropical regions of Africa, Madagascar, Central and South America, India and Sri Lanka (Kornfield and Smith, 2000; Sparks, 2004). The three African Great Lakes, Tanganyika, Malawi and Victoria, harbor more than one thousand endemic cichlid species that have undergone Abbreviations: Da, dalton; BAC, bacterial artificial chromosome; cDNA, DNA complementary to RNA; ORF, open reading frame; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; RPE, retinal pigment epithelium. ⁎ Corresponding author. Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology 4259-B21, Nagatsuta-cho, Midori-ku, 226-8501, Yokohama, Japan. Tel.: +81 45 924 5742; fax: +81 45 924 5835. E-mail address: [email protected] (N. Okada). 0378-1119/$ - see front matter © 2007 Published by Elsevier B.V. doi:10.1016/j.gene.2007.04.024

rapid speciation and diversification. Cichlid features such as social interaction, trophic status, body shape, body color, and skin pattern have diverged ecologically and morphologically. Such diversity makes cichlids a model organism for evolutionary studies (Fryer and Iles, 1972; Greenwood, 1984; Takahashi et al., 2001; Turner et al., 2001; Terai et al., 2003b; Seehausen, 2006). Kocher (2004) categorized cichlid speciation events into three stages: (a) choice of habitat, (b) morphological diversification and change of trophic status, and (c) diversification of color pattern and of mate recognition. We have focused on color pattern as one of the most fascinating features of cichlid biology, being also one of the most important characters for cichlid species themselves. Indeed, Seehausen and Alphen (1998) demonstrated that when a male fish appeals to a female with his mating color, a female fish recognizes and chooses her partner with the male's color. On the

M. Watanabe et al. / Gene 399 (2007) 46–52

other hand, each of the many cichlid species in Lake Tanganyika has a species-specific body stripe pattern (Brichard, 1989). For example the genus Julidochromis includes several species that have various skin patterns such as straight stripe, wavy stripe, broad stripe, dot, and checker flag. Because Julidochromis male and female fish have the same color pattern, it is thought that their pattern may be used not for mate choice but for intraspecies recognition. In fact, the relationship between skin pattern and intra-species recognition was demonstrated in a laboratory tank using zebrafish: Awild type zebrafish (striped body pattern) grown with colorless zebrafish mutants preferred colorless fish (Engeszer et al., 2004). Thus, analyses of the molecular basis of pattern formation and pattern recognition may provide important insights into the molecular mechanisms of intra-species recognition and speciation of cichlids. Diversification of the cichlid visual system has been well studied at the molecular level. For example, the opsin genes have evolved differentially in cichlid species in adaptation to different environments (Terai et al., 2002, 2006; Carleton et al., 2005; Sugawara et al., 2005). On the other hand, the molecular mechanism of pattern formation of cichlids is largely unknown, and only a few genes for pattern formation have been analyzed until recently (Streelman et al., 2003; Terai et al., 2003a; Sugie et al., 2004). We recently identified the genes responsible for the zebrafish skin pattern mutants, leopard and jaguar/obelix (Watanabe et al., 2006; Iwashita et al., 2006), in which pigment cell localization, but not development, is altered. The gene responsible for leopard was identified as connexin41.8, and that responsible for jaguar/ obelix was kir7.1 (inward rectifier potassium ion channel, subfamily J, member13). Connexin is a component of gap junctions that allow direct intercellular transfer of ions, secondary messengers and small metabolites of up to ∼ 1500 Da (Saez et al., 2005). Kir7.1 is a member of the Kir family that includes seven subfamilies, Kir1 to Kir7. Kir channels exist as tetramers— either homomeric or heteromeric—and Kir subunits contain two transmembrane domains and a pore domain (H5 domain) that are responsible for ion selectivity. The functions of Kir channels include maintenance of resting membrane potential and absorption of K+ ions across epithelial cells. kir7.1 is expressed in several tissues such as brain, RPE, small intestine, kidney, thyroid, lung, stomach, spinal cord, and testis of human and rat (Krapivinsky et al., 1998; Partiseti et al., 1998; Nakamura et al., 1999). Here we isolated and analyzed cichlid homologs of zebrafish kir7.1 with the expectation that this gene, given its involvement in skin pattern formation, might contribute to the diversification of cichlids. 2. Materials and methods 2.1. Fish Fish except zebrafish were purchased from local pet shops in Japan. Zebrafish was same strain with those we used in the previous study (Iwashita et al., 2006). Cichlids were maintained in a 40-l tank at 28 °C in a 12-h light/12-h dark cycle. Zebrafish were maintained in a 1-l tank under the same conditions.

47

2.2. RNA isolation, cDNA synthesis, sequencing of cichlid homologs of zebrafish kir7.1 Total RNA was isolated from adult tissue of the cichlid, Haplochromis sp. “Matumbi hunter”, using the RNeasy mini kit (Qiagen), and first-strand cDNAs were synthesized with Superscript III (Invitrogen) and modified oligo(dT) primer BamTVTV (Watanabe et al., 2004). Primer sequences used in this study are listed in Table 1. The first-strand cDNA was treated with terminal deoxynucleotide transferase (TdT) (GE Healthcare) and 100 μM dATP to a produce 3′poly (A) tail. The modified cDNA was amplified for five cycles using a thermocycler with BamTVTV primer and ExTaq DNA polymerase (Takara Bio) under the following conditions: 45 s at 95 °C, 45 s at 50 °C, 5 min at 72 °C. The amplified cDNA fragment was purified by a PCR purification kit (Qiagen). Partial sequences of cichlid homologs of zebrafish kir7.1 were amplified by PCR with degenerate primers. Amplified fragments were cloned using the pGEM-T Vector System (Promega) for sequencing using a 3100 Genetic Analyzer (Applied Biosystems). We obtained two distinct fragments, and both deduced amino acid sequences were homologous to zebrafish Kir7.1. We then performed 5′ RACE and 3′ RACE to obtain full-length sequences using primer pairs, one of which was specific to partial sequences of cichlid kir7.1 and the other (BAMTVTV2; Table 1) of which was specific to a cassette sequence. We named these two genes cikir7.1 (cichlid kir7.1) and cikir7.2, respectively. The 3′ sequence of cikir7.1 was obtained by BAC walking instead of 3′ RACE. Full-length sequences of cikir7.1 and cikir7.2 were obtained by PCR using an upstream primer cikir7.1F01 and a downstream primer cikir7.1R01 for cikir7.1 and corresponding primers cikir7.2F01 and cikir7.2R01 for cikir7.2. Accession numbers of cikir7.1 and cikir7.2 are as follows (DDBJ accession numbers AB290810–AB290829).

Table 1 Primers for PCR Name

Sequence

BAMTVTV

ACTGACTCTTCGGATCCTTTT TTTTVTTTTTTTTVa ACTGACTCTTCGGATCCTTT GTGTAGCCCTGACTACAGTA AACAAATATATCTGCCTCCA CCATCTGATACCAACTGCTG AGAAAATTACTATCTCTTGA ACTTGCTGGCACACCTA GCTTGGCCTTCATGCTCCTC AGTGCCATAGCGTTGCTA CTGACCTTCACACTTGTAA CTACGTCGCCCTGGACTTCG TGGTACCTCCAGACAGCACG GGAGACGCAACTCACTATTGG AATAGGATCCCGTCACATCG GGAGAAGAGCTATGAGCTGC ACCTCCAGACAGCACTGTGT AGTGGAGACTGTCCCAGTGC ATGCTGTAGCAGGTTTGTGG GAGAGGTTCCGTTGCCCAGA TGCTGATCCACATCTGCTGG

BAMTVTV2 cikir7.1F01 cikir7.1R01 cikir7.2F01 cikir7.2R01 cikir7.1F02 cikir7.1R02 cikir7.2F02 cikir7.2R02 cibactF01 cibactR01 zfkir7.1F01 zfkir7.1R01 zfbactF01 zfbactR01 tetkirF01 tetkirR01 tetbactF01 tetbactR01 “V” means mixture of “A”, “C” and “G”.

a

48

M. Watanabe et al. / Gene 399 (2007) 46–52

2.3. Phylogenetic analysis The deduced amino acid sequences for cikir7.1 and cikir7.2 were compared to those of other teleosts to confirm whether they were actually cichlid homologs of the kir7.1 gene and to establish phylogenetic relationships among teleosts. The DDBJ accession

number for the zebrafish sequence is AB271018. Partial sequences of kir7.1 from tetraodon, takifugu, medaka and stickleback were obtained from the Genome Database of the Sanger Institute (http://www.ensembl.org/index.html). ID numbers of the partial sequences in the database were as follows, Tetraodon nigroviridis: GSTENG00012201001, Takifugu rubripes:

Fig. 1. A; Gene structures of ciKir7.1 and ciKir7.2. Boxes indicate exons, and lines indicate introns. Gray boxes indicate protein-coding regions. B; Amino acid sequence alignment of ciKir7.1 and ciKir7.2 and of Kir7.1 from other teleosts. M1 and M2 indicate predicted transmembrane domains, and H5 indicates the pore domain of the potassium channel. The red residues in the ciKIR7.2 sequence indicate amino acid changes specific to ciKIR7.2 in the conserved transmembrane domains. Dots indicate residues identical to that of ciKIR7.1. Asterisks indicate conserved sequences among Kir7.1 of teleosts. Dashes indicate gaps. ciKIR7.1; cichlid Kir7.1, ciKIR7.2; cichlid Kir7.2, stkKIR7.1; stickleback Kir7.1, medKIR7.1; medaka Kir7.1, takKIR7.1; takifugu Kir7.1, tetKIR7.1; tetraodon Kir7.1, zfKIR7.1; zebrafish KIir7.1.

M. Watanabe et al. / Gene 399 (2007) 46–52

49

primer cibactR01. The cDNA equivalents of 100 ng total RNA were used as templates for RT-PCR. Sequence-specific primers were designed to straddle an intron of the cikir7.1, cikir7.2 or β-actin genes. An initial denaturation step at 95 °C for 5 min was followed by 35 amplification cycles of 45 s at 95 °C, 45 s at 50 °C, and 30 s at 72 °C with a final extension period of 2 min at 72 °C. RT-PCR experiments for zebrafish and pufferfish tissues were performed using the same procedure with specific primer sets for each gene (Table 1). Fig. 2. Phylogenetic tree of Kir7.1. Numbers at each branch indicate the percentage of 10,000 bootstrap samples. Scale bars indicate the number of substitutions per site.

3. Results and discussion

NEWSINFRUG00000148007, Oryzias latipes: ENSORLG00000010229, Gasterosteus aculeatus: ENSGACG00000000413. Complete ORFs for these sequences were predicted by the BLAST program using the cichlid Kir7.1 sequence as a query against genome sequence data of each respective species. Multiple sequence alignments were performed using the ClustalX program, and neighbor-joining analyses were performed using MEGA 3 (Kumar et al., 2004). Bootstrap analysis consisted of 10,000 replicates, and bootstrap values over 70 were indicated. The pair-wise values of Dn (nonsynonymous substitutions per nonsynonymous sites) and of Ds (synonymous substitutions per synonymous sites) for these genes were also calculated using MEGA 3.

We identified two sequences that have homology with zebrafish kir7.1 in the cichlid, Haplochromis sp. “Matumbi hunter” from Lake Victoria. These homologs, cikir7.1 and cikir7.2, are 83.8% and 81.1% identical at the DNA sequence and deduced amino acid sequence levels, respectively. Fig. 1A shows the gene structures of ciKir7.1 and ciKir7.2. There is no similarity between intron sequences (data not shown). Fig. 1B shows an alignment of the corresponding amino acid sequences with teleost Kir7.1 sequences obtained from the Ensembl database. We detected amino acid substitutions specific to ciKir7.2, some of which were found in conserved transmembrane regions of this potassium channel. Some substitutions in the transmembrane domain or pore domain of zebrafish Kir7.1 cause critical defects in potassium channel function, resulting in a broader stripe pattern on zebrafish skin (Iwashita et al., 2006). Although it is unclear whether the amino acid changes detected in ciKir7.2 alter channel function, these substitutions might accelerate the evolutionary rate of cikir7.2 gene (see Section 3.3). Fig. 2 shows a phylogenetic tree of teleost homologs of kir7.1, which indicates that the gene duplication occurred at the cichlid lineage and that the relative evolutionary rate of cikir7.2 was higher than that of cikir7.1 due to accumulated mutations in cikir7.2.

2.4. Southern hybridization Genomic DNAs of Haplochromis sp. “Matumbi hunter”, Symphysodon discus, Etroplus maculatus, and Paratilapia polleni were isolated from frozen specimens using phenol/ chloroform. Each genomic DNA (2 μg) was digested with restriction enzymes BamHI, EcoRI, and Sau3AI, electrophoretically fractionated on a 1% agarose gel, and transferred to a Gene Screen Plus membrane (DuPont). Pre-hybridization, probe labeling, hybridization and detection were performed using the AlkPhos Direct Detection kit (GE Healthcare) according to the manufacturer's protocol. The membranes were hybridized overnight at 55 °C with a labeled DNA fragment representing exon 2 of cikir7.2 from Haplochromis sp. “Matumbi hunter”.

3.1. Isolation of cichlid homologs of the zebrafish kir7.1 gene

2.5. Expression analysis The RNeasy mini kit was used to isolate total RNA from the cichlid tissues brain, eye, liver, skin, caudal fin, testis and ovary, and first-strand cDNAs were synthesized with Superscript III (Invitrogen) and oligo d(T)18 primer. Tissue-specific expression of cikir7.1 and cikir7.2 was detected by PCR using primer sets specific to each gene. A partial sequence of cikir7.1 was amplified using upstream primer cikir7.1F02 and downstream primer cikir7.1R02, and that of cikir7.2 was amplified by upstream primer cikir7.2F02 and downstream primer cikir7.2R02. β-actin expression was also detected by RT-PCR using the upstream primer cibactF01 and the downstream

Fig. 3. Southern hybridization analysis of genomic DNA. A; Haplochromis sp. “Matumbi hunter”. B; Symphysodon discus. C; Etroplus maculatus. D; Paratilapia polleni. First lane from left: BamHI, second lane: EcoRI, third lane: Sau3AI. Positions of size markers are indicated to the left.

50

M. Watanabe et al. / Gene 399 (2007) 46–52

Table 2 African cichlid species

cichlid genomes will reveal the duplication point of kir7.1 in the cichlid lineage.

Species name

Abbreviation

Origin

Haplochromis sp. “Matumbi hunter” Aristochromis christyi Nimbochromis fuscotaeniatus Protomelas virgatus Cyphotilapia frontosa Julidochromis regani Neolamprologus brichardi Spathodus erythrodon Tropheus dubois Oreochromis niloticus

HM AC NF PV CF JR NB SE TD ON

Lake Victoria Lake Malawi

Lake Tanganyika

River in Africa

3.2. kir7.1 copy number in teleosts To examine the copy number of kir7.1 and to determine when the duplication of this gene occurred, we performed Southern hybridization and database searches. Two copies of the kir7.1 gene were detected in the genomes of cichlids from Africa, South American and Madagascar but not Sri Lanka (Fig. 3). On the other hand, we detected only one copy of the kir7.1 gene in the genome databases of zebrafish, tetraodon, fugu, medaka and stickleback. Although genome projects for medaka and stickleback have not been completed, most of these two genome sequences have indeed been determined. Thus, whereas the above-mentioned teleosts have only one copy of the kir7.1 gene, a kir7.1 gene duplication clearly occurred specifically in the cichlid lineage. This notion is consistent with the phylogenetic analysis (Fig. 2). On the other hand, it is unclear whether the duplication occurred in a common ancestor of cichlids or if distinct duplications occurred in the African-American and Madagascar lineages. If the duplication occurred in the common ancestor of cichlids, gene loss of cikir7.2 might have occurred in the Sri Lanka lineage because cichlids from Madagascar and from Sri Lanka form a sister clade (Sparks, 2004). Further genome analysis and comparison of the cikir7.2 locus among

3.3. Evolution of the cikir genes We next constructed a phylogenetic tree of ciKir7.1 and ciKir7.2 from African cichlid species as follows: Haplochromis sp. “Matumbi hunter” from Lake Victoria, Aristochromis christyi, Nimbochromis fuscotaeniatus and Protomelas virgatus from Lake Malawi, Cyphotilapia frontosa, Julidochromis regani, Neolamprologus brichardi, Spathodus erythrodon and Tropheus dubois from Lake Tanganyika, and the riverine cichlid Oreochromis niloticus (Table 2, Fig. 4). We calculated pair-wise values for Dn and Ds for the cikir7.1 and cikir7.2 genes and then calculated respective average Dn/Ds value. cikir7.2 has the higher average value (0.37) than cikir7.1 (0.00), suggesting that cikir7.2 underwent functional diversification. In general, gene duplication is one of the most important factors that contribute to the diversification of genomes and organisms (Ohno, 1970). Thus, when gene duplication occurs, mutations may accumulate in one of duplicated genes, leading to the gain of a new function, whereas a putative lower mutation rate in the other gene maintains the original function due to obvious functional constraints. In the case of the cikir genes, Figs. 1, 2 and 4 suggest that cikir7.1 has maintained the original function of kir7.1 and that cikir7.2 has evolved a new function. However, the gene expression analysis implies that the functional diversification of these genes occurred in the cichlid lineage (see below). 3.4. Expression of the cikir7.1 and cikir7.2 genes compared with those of other teleosts To examine the functional diversification of cikir7.1 and cikir7.2, we analyzed the gene expression profiles of these genes by RT-PCR with primer sets specific to each gene. cikir7.1 was

Fig. 4. Phylogenetic tree of ciKir7.1 and ciKir7.2 among African cichlids. The average value of Dn/Ds for each gene family is shown to the right of the tree. HM; Haplochromis sp. “Matumbi hunter”, AC; A. christyi, NF; N. fuscotaeniatus, PV; P. virgatus, CF; C. frontosa, JR; J. regani, NB; N. brichardi, SE; S. erythrodon, TD; T. duboisi, ON; O. niloticus. HM is from Lake Victoria. AC, NF and PVare from Lake Malawi. CF, JR, NB, SE and TD are from Lake Tanganyika. ON is a riverine cichlid.

M. Watanabe et al. / Gene 399 (2007) 46–52

Fig. 5. Expression of kir7.1 genes. RT-PCR was performed with RNA samples isolated from the indicated tissues of adult fish. M indicates the molecular size marker. Total RNAs were reverse-transcribed with oligo d(T)18 primer, and the resultant cDNAs were amplified by PCR using specific primers for kir7.1 and βactin (positive control). A; cichlid. B; zebrafish. C; pufferfish.

expressed in brain and eyes but not in the other tissues analyzed, and cikir7.2 was expressed only in testis and ovary (Fig. 5). Zebrafish kir7.1 is expressed in pigment cells, melanophore and xanthophore to facilitate and maintain the stripe pattern (Iwashita et al., 2006), but its tissue specificity of expression has not been reported. Thus, we examined the tissue-specific expression of zebrafish kir7.1 and compared it with those of the cichlid homologs. Zebrafish kir7.1 expression was detected in brain, eyes, skin, caudal fin, testis and ovary (Fig. 5B). These results imply that (a) kir7.1 function in cichlids is divided into two genes, cikir7.1 and cikir7.2, (b) cikir7.1 functions analogously to zebrafish kir7.1 in brain and eye, and cikir7.2 functions analogously to kir7.1 in testis and ovary, and (c) in contrast to zebrafish kir7.1, cikir7.1 apparently is not expressed in skin or caudal fin where pigment cells are distributed. We also analyzed the expression of the kir7.1 gene of pufferfish using tissue samples of Tetraodon biocellatus (Fig. 5). We refer to the kir7.1 of T. biocellatus as tet'kir7.1 in this experiment to discriminate it from that of T. nigroviridis.

51

Primers for tet'kir7.1 and β-actin were constructed based on the genome sequence of T. nigroviridis. The results indicate that tet'kir7.1 is expressed only in brain and eye of pufferfish but not in skin, fin or testis. Expression of tet'kir7.1 in ovary was not examined. Because the cikir7.1, cikir7.2 and tet'kir7.1 genes were not expressed in skin or caudal fin, these genes may not contribute to pattern formation of these fish or may have a lower contribution compared with zebrafish kir7.1. Compared with cikir7.1, zebrafish kir7.1 might play a more important role in brain and eye than in testis or ovary because the functional constraints on cikir7.1, which was expressed in brain and eye, are stronger than that of cikir7.2 in cichlids (see Section 3.3). In particular, kir7.1 is highly expressed in the RPE of mammals and controls K+ conductance across the plasma membrane. On the other hand, the necessity or importance of kir7.1 expression in testis is unclear even in mammals. One example concerning the function of Kir family genes in testis is known about Kir5.1. Kir5.1 contributes to mammalian reproduction, in which this channel might regulate the freeswimming properties of spermatozoa (Salvatore et al., 1999). Does Kir channel contribute to the variation of reproductive system? There is a possibility that the gene which is expressed specifically in gonads with higher evolutional rate contributes to the variation of reproductive system. Indeed cichlid species show various reproductive strategies, for example, monogamy or polygamy, mouthbrooding or substratebrooding, variation of egg size, and variation of testis size, which depend on the species. It is not obvious now whether Kir7.1 plays a similar role to Kir5.1 or how Kir7.1 contributes to the reproductive system where this gene is expressed. Further analysis and elucidation of Kir function in the testis will reveal why kir7.1 is differentially expressed among teleosts and how cikir7.2 contributes to cichlid diversity. Acknowledgement This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas “Molecular Mechanism of Speciation” from the Ministry of Education, Culture, Sports, Science and Technology of Japan to N.O. References Brichard, P., 1989. Pierre Brichard's Book of Cichlids and All the Other Fishes of Lake Tanganyika. TFH Publications, Inc., Neptune. Carleton, K.L., Parry, J.W., Bowmaker, J.K., Hunt, D.M., Seehausen, O., 2005. Colour vision and speciation in Lake Victoria cichlids of the genus Pundamilia. Mol. Ecol. 14, 4341–4353. Engeszer, R.E., Ryan, M.J., Parichy, D.M., 2004. Learned social preference in zebrafish. Curr. Biol. 14, 881–884. Fryer, G., Iles, T.D., 1972. The Cichlid Fishes of the Great Lakes of Africa. TFH Publications, Edinburgh. Greenwood, P.H., 1984. African Cichlids and Evolutionary Theories. University of Maine at Orono Press, Orono, ME. Iwashita, M., et al., 2006. Pigment pattern in jaguar/obelix zebrafish is caused by a Kir7.1 mutation: implications for the regulation of melanosome movement. PLoS Genet. 2, e197. Kocher, T.D., 2004. Adaptive evolution and explosive speciation: the cichlid fish model. Nat. Rev. Genet. 5, 288–298.

52

M. Watanabe et al. / Gene 399 (2007) 46–52

Kornfield, I., Smith, P.F., 2000. African cichlid fishes: model systems for evolutionary biology. Ann. Rev. Ecolog. Syst. 31, 163–196. Krapivinsky, G., Medina, I., Eng, L., Krapivinsky, L., Yang, Y., Clapham, D.E., 1998. A novel inward rectifier K+ channel with unique pore properties. Neuron 20, 995–1005. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150–163. Nakamura, N., Suzuki, Y., Sakuta, H., Ookata, K., Kawahara, K., Hirose, S., 1999. Inwardly rectifying K+ channel Kir7.1 is highly expressed in thyroid follicular cells, intestinal epithelial cells and choroid plexus epithelial cells: implication for a functional coupling with Na+, K+-ATPase. Biochem. J. 342 (Pt 2), 329–336. Ohno, S., 1970. Evolution by Gene Duplication. Springer-Verlag, Berlin. Partiseti, M., Collura, V., Agnel, M., Culouscou, J.M., Graham, D., 1998. Cloning and characterization of a novel human inwardly rectifying potassium channel predominantly expressed in small intestine. FEBS Lett. 434, 171–176. Saez, J.C., Retamal, M.A., Basilio, D., Bukauskas, F.F., Bennett, M.V., 2005. Connexin-based gap junction hemichannels: gating mechanisms. Biochim. Biophys. Acta 1711, 215–224. Salvatore, L., D'Adamo, M.C., Polishchuk, R., Salmona, M., Pessia, M., 1999. Localization and age-dependent expression of the inward rectifier K+ channel subunit Kir 5.1 in a mammalian reproductive system. FEBS Lett. 449, 146–152. Seehausen, O., 2006. African cichlid fish: a model system in adaptive radiation research. Proc. R. Soc. B 273, 1987–1998. Seehausen, O., Alphen, J.J.M.V., 1998. The effect of male coloration on female mate choice in closely related Lake Victoria cichlids (Haplochromis nyererei complex). Behav. Ecol. Sociobiol. 42, 1–8. Sparks, J.S., 2004. Molecular phylogeny and biogeography of the Malagasy and South Asian cichlids (Teleostei: Perciformes: Cichlidae). Mol. Phylogenet. Evol. 30, 599–614.

Streelman, J.T., Albertson, R.C., Kocher, T.D., 2003. Genome mapping of the orange blotch colour pattern in cichlid fishes. Mol. Ecol. 12, 2465–2471. Sugawara, T., et al., 2005. Parallelism of amino acid changes at the RH1 affecting spectral sensitivity among deep-water cichlids from Lakes Tanganyika and Malawi. Proc. Natl. Acad. Sci. U. S. A. 102, 5448–5453. Sugie, A., Terai, Y., Ota, R., Okada, N., 2004. The evolution of genes for pigmentation in African cichlid fishes. Gene 343, 337–346. Takahashi, K., Terai, Y., Nishida, M., Okada, N., 2001. Phylogenetic relationships and ancient incomplete lineage sorting among cichlid fishes in Lake Tanganyika as revealed by analysis of the insertion of retroposons. Mol. Biol. Evol. 18, 2057–2066. Terai, Y., Mayer, W.E., Klein, J., Tichy, H., Okada, N., 2002. The effect of selection on a long wavelength-sensitive (LWS) opsin gene of Lake Victoria cichlid fishes. Proc. Natl. Acad. Sci. U. S. A. 99, 15501–15506. Terai, Y., Morikawa, N., Kawakami, K., Okada, N., 2003a. The complexity of alternative splicing of hagoromo mRNAs is increased in an explosively speciated lineage in East African cichlids. Proc. Natl. Acad. Sci. U. S. A. 100, 12798–12803. Terai, Y., Takahashi, K., Nishida, M., Sato, T., Okada, N., 2003b. Using SINEs to probe ancient explosive speciation: “hidden” radiation of African cichlids? Mol. Biol. Evol. 20, 924–930. Terai, Y., et al., 2006. Divergent selection on opsins drives incipient speciation in Lake Victoria cichlids. PLoS Biol. 4, e433. Turner, G.F., Seehausen, O., Knight, M.E., Allender, C.J., Robinson, R.L., 2001. How many species of cichlid fishes are there in African lakes? Mol. Ecol. 10, 793–806. Watanabe, M., et al., 2004. Extensive analysis of ORF sequences from two different cichlid species in Lake Victoria provides molecular evidence for a recent radiation event of the Victoria species flock: identity of EST sequences between Haplochromis chilotes and Haplochromis sp. “Redtailsheller”. Gene 343, 263–269. Watanabe, M., et al., 2006. Spot pattern of leopard Danio is caused by mutation in the zebrafish connexin41.8 gene. EMBO Rep. 7, 893–897.