Functional expression of a bark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol

ARTICLE IN PRESS Insect Biochemistry and Molecular Biology Insect Biochemistry and Molecular Biology 36 (2006) 835–845 www.elsevier.com/locate/ibmb

Functional expression of a bark beetle cytochrome P450 that hydroxylates myrcene to ipsdienol$ Pamela Sandstrom, William H. Welch, Gary J. Blomquist, Claus Tittiger Department of Biochemistry and Molecular Biology, University of Nevada, Reno, Reno, NV 89557, USA Received 24 June 2006; received in revised form 4 August 2006; accepted 4 August 2006

Abstract The final steps in the pheromone-biosynthetic pathway of the pine engraver beetle, Ips pini (Say) (Coleoptera: Scolytidae) are unknown, but likely involve myrcene (7-methyl-3-methylene-1,6-octadiene) hydroxylation to produce the aggregation pheromone component, ipsdienol (2-methyl-6-methylene-2,7-octadien-4-ol). We have isolated a full-length I. pini cDNA encoding a cytochrome P450, CYP9T2. The recovered cDNA is 1.83 kb and the open reading frame encodes a 532 amino acid protein. CYP9T2 is regulated by the same physiological factors that induce pheromone production. Quantitative real-time PCR experiments showed that feeding on host phloem induced CYP9T2 expression in males, but not females, and that basal expression levels are highest in male midguts, similar to other I. pini pheromone-biosynthetic genes. Microsomes prepared from Sf9 cells co-expressing baculoviral-mediated recombinant CYP9T2 and housefly (Musca domestica) NADPH-cytochrome P450 reductase converted myrcene to ipsdienol. The product identified by coupled GC-MS was mostly (4R)-(
)-ipsdienol, an important aggregation pheromone component for western North American I. pini. These results are consistent with CYP9T2 encoding a myrcene hydroxylase that functions near the end of the pheromone-biosynthetic pathway. r 2006 Elsevier Ltd. All rights reserved. Keywords: P450; Bark beetle; Pheromone biosynthesis; Detoxification; Functional expression; Monoterpene; Baculovirus

1. Introduction Pine bark beetles are intimately associated with monoterpenoids both as host resin defense components (Raffa, 2001; Trapp and Croteau, 2001; Langenheim, 2003) and as semiochemicals (Seybold et al., 2000; Santos et al., 2006). The monoterpene, myrcene (7-methyl-3-methylene-1,6octadiene), is of particular significance to the pine engraver, Ips pini (Say) (Coleoptera: Scolytidae). I. pini encounters host-produced myrcene when individuals infest weakened or fallen trees and branches from a number of species (Anderson, 1969; Kegley et al., 2002). Male I. pini exposed to myrcene vapors produce racemic ipsdienol (2methyl-6-methylene-2,7-octadien-4-ol) (Quilici, 1997), consistent with the suggestion that successful colonization $ Data deposition: The sequence reported in this paper has been deposited in GenBank, accession no. DQ676820. Corresponding author. Tel.: +1 775 784 6480; fax: +1 775 784 1419. E-mail address: [email protected] (C. Tittiger).

0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.08.004

involves metabolism of host monoterpenes (Byers, 1995; Phillips and Croteau, 1999). Male I. pini also produce myrcene de novo (Martin et al., 2003) as a probable intermediate in the biosynthesis of aggregation pheromone. The aggregation pheromone of western North American populations is a blend of mostly (4R)-(
)-ipsdienol (Birch et al., 1980; Seybold et al., 1995a, b; Miller et al., 1997). It is produced by males de novo (Seybold et al., 1995a, b) in the anterior midgut (Hall et al., 2002) and is regulated by feeding and juvenile hormone (JH) III (Tillman et al., 1998; Seybold et al., 2000). The metabolic pathway diverts from the mevalonate pathway at geranyldiphosphate (GPP) through the activity of GPP synthase (GPPS) (Fig. 1) (Gilg et al., 2005). The intermediate steps from GPP to ipsdienol are unclear, but likely include myrcene as a metabolic intermediate (Hughes, 1974; Hendry et al., 1980; Seybold et al., 1995a, b; Martin et al., 2003). Thus, both diet and endogenous metabolism are sources of myrcene in I. pini.

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

836

Mevalonate Pathway

DMAPP

P P

P P

IPP

Geranyldiphosphate Synthase P P

geranyl diphosphate

cally to produce ipsdienol, and that the western I. pini pheromone component, (4R)-(
)-ipsdienol, is produced in fourfold excess over the non-pheromonal (4S)-(+)enantiomer. This first example of an insect pheromonebiosynthetic P450 confirms the prediction that ipsdienol production is catalyzed by a P450 (Vanderwel and Oehlschlager, 1987; Hunt and Smirle, 1988) and suggests an explanation for the presence of the putative pheromone precursor ipsdienone in male I. pini.

Myrcene Synthase myrcene

Diet

P450 OH

ipsdienol oxidase?

O

ipsdienone stereo-specific reductase?

pheromonal ipsdienol [~95% (-)]* Fig. 1. Monoterpene metabolism in I. pini. Myrcene is ingested in the diet and produced de novo, and converted to ipsdienol. Hypothesized reactions involving ipsdienone are shown with dashed arrows. Circled ‘‘P’’s designate phosphates. DMAPP, dimethylallyldiphosphate; IPP, isopentenyldiphosphate. *The enantiomeric composition for ‘‘pheromonal ipsdienol’’ is noted for western North American I. pini populations.

Vanderwel and Oehlschlager (1987) predicted that a cytochrome P450 enzyme likely hydroxylates myrcene to ipsdienol. Insect cytochromes P450 are physiologically important for biosynthesis and degradation of endogenous compounds, including pheromones, and also catalyze metabolic detoxification of insecticides and host plant chemicals (Wen et al., 2003; Feyereisen, 2005). The different enantiomeric blends of ipsdienol produced from detoxification and pheromone biosynthesis in I. pini suggests either stereo-selective modification to increase the enantiomeric excess of (4R)-(
)-ipsdienol (Fig. 1), as is implied in Ips paraconfusus (Fish et al., 1984), or that enzymes with differing stereo-specific product profiles may hydroxylate myrcene in I. pini. Of nearly 200 identified coleopteran P450 sequences, most are from the recently completed Tribolium genome project (http://www.bioinformatics.ksu.edu/BeetleBase) and none have been functionally characterized. Here we report the cDNA isolation and functional expression of CYP9T2, a putative pheromone-biosynthetic P450 from I. pini. It is the most highly transcribed P450 gene in pheromone-biosynthetic I. pini midguts and has an expression pattern consistent with other pheromonebiosynthetic genes (Keeling et al., 2004, 2006). Functional assays show that CYP9T2 hydroxylates myrcene specifi-

2. Materials and methods 2.1. Reagents and chemicals Hink’s TNM-FH Medium 1x (Supplemented Grace’s Medium) and Grace’s Insect Basal Medium 1x were from Mediatech, Inc. (Herndon, VA) and FBS was from Atlas Biologicals (Fort Collins, CO). Grace’s Insect Medium 2x, 4% Agarose Gel, and Pluronic F-68 were from Gibco (Grand Island, NY). The Sf9 cells were a gift from G. Pari (U. Nevada, Reno) and the housefly reductase baculoviral clone (Andersen, 1997; Wen et al., 2003) was kindly provided by M. Schuler (U. Illinois at Urbana-Champaign). [4-2H]myrcene and the ipsdienol standard were gifts from D. Vanderwel (U. Winnipeg) and C. Oehlschlager (ChemTika International, San Jose, Costa Rica), respectively. Unlabeled myrcene and hemin were from SigmaAldrich (St. Louis, MO). All oligonucleotides were from Integrated DNA Technologies (Coralville, IA).

2.2. Insects Immature I. pini were obtained from infested Jeffrey pine (Pinus jeffreyi) bolts collected from the Sierra Nevada in California and Nevada, USA and reared to adults as per Browne (1972). Emerged adult I. pini were collected daily, separated by sex according to Wood (1982), and stored for up to 2 weeks at 4 1C in moist paper towels. Larvae were removed from under the bark and dissected the same day.

2.3. cDNA isolation Clustering analysis of I. pini ESTs suggested that cluster 128 (12 EST) represented the most highly expressed cytochrome P450 in the midgut (Eigenheer et al., 2003). The longest cDNA in the cluster, IPG002G06 (CB408249), was selected for further sequencing by primer walking (Table 1) of purified plasmid template DNA (Qiagen, QIAprep Spin Miniprep Kit, Valencia, CA) using the ABI BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1. The reactions were run on an ABI3730 DNA Analyzer at the Nevada Genomics Center (UNR) and the sequences were analyzed using Vector NTIv.9 software (Informax, N. Bethesda, MD).

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

837

Table 1 Oligonucleotide primers used in this study Primer name

Sequence

Amplicon length (bp)

Sequencing IPG002G06 (CYP9T2) T3 T-mix 2G06F2 2G06F3 2G06R1

ATTAACCCTCACTAAAGGGA (T)22 (A/C/T/G) GATTCCATTGCATCGTCAGC CTGCTTCACCCAGAAAATGG AACGCTCACCTCTAATCTGC

n.a. n.a. n.a. n.a. n.a.

qRT-PCR IPG002G06 (CYP9T2)a Forward Reverse

TTCCAACTCCACATCCATCACTT TAATGTCAGCCCTCAGTCTTTCTTG

83

IPG009C09 #CB408287 (P450) Forward Reverse

CTTCTGATATGTTAGTAGCAGGAGTGGAT TTCTGGACTTGAGGATGTTTTGAC

91

IPG009D04 #CB408294 (P450) Forward Reverse

AAAGGTTTGAAATGGAGGGAAAT TGCGTCATTGATGGTGCTAAA

93

IPG024D01 #CB407841 (P450) Forward Reverse

CGTCACAACTACTGGGCAAGAC CAGTGGCGACAGGAGTAAAATTG

82

IPG05E02 (cytoplasmic actin)a Forward Reverse

GCCGTCTTTCCATCAATCGT TTTTGCTCTGGGCTTCATCAC

100

Cloning IPG0002G06 (CYP9T2) F1 R1 (untagged) R2 (tagged)

CGGTCGACAAACATGTTGGTCGAG CGCTCGAGTTAGTTTTCATTTT GCCTCGAGGGTTCCAATGCAAGGTG

1631 1606

n.a., not applicable. a Described in Keeling et al. (2006).

2.4. Expression analysis P450 mRNA levels were determined by quantitative real time (RT)-PCR (qRT-PCR). cDNA templates for the fed and JH III-treated male and female midgut time course studies were prepared previously. Briefly, for the fed samples, beetles were placed in small holes drilled into the phloem of Jeffrey pine bolts and secured there with wire mesh for the required time, while unfed controls were held in plastic cups in the dark (Keeling et al., 2004). For the JH-treated samples, 10 mg (7) JH III in 0.5 ml acetone or just acetone (controls) was applied to the abdominal venter, and the beetles were then incubated in the dark at room temperature for the required times (Keeling et al., 2006). For the tissue distribution study, males and females were either allowed to feed on the phloem of uninfested Jeffrey pine bolts or kept as unfed controls as per Keeling et al. (2004) for 16 h and then dissected in water under a stereo-microscope. Tissues from the head (including the prothorax), anterior midgut, posterior midgut, hindgut, fat body, and carcass of 10 insects were pooled and frozen in N2(l). There were three male and four female biological

replicates. Four replicates of five larval anterior midguts/ replicate were similarly dissected and frozen in N2(l). The tissues were kept at
80 1C until RNA was extracted using the RNeasy Plant Mini Kit (Qiagen). Twenty percent of the isolated RNA was reverse-transcribed using Superscript III RNase H
reverse transcriptase and random hexamer primers (Invitrogen). RT-PCR primers (Table 1) with minimal potential for primer-dimer formation were identified using Vector NTI among primers suggested by Primer Express software (Applied Biosystems, Foster City, CA). Relative gene expression was determined using the DDCT method (Livak and Schmittgen, 2001). The results were normalized with an internal control gene, Cytoplasmic actin (IPG005E02), which is unaffected by feeding in I. pini (Keeling et al., 2004). An ABI Prism 7000 sequence detection system provided qRT-PCR data from 25 ml reactions with optimal concentrations of RT primers, template cDNA and SYBRs Green PCR Master Mix using the supplier’s recommended conditions (Applied Biosystems). Dissociation curves for each product were examined for nonspecific amplification. A Q-test (95% confidence) was

ARTICLE IN PRESS 838

P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

performed to account for outliers (Dean and Dixon, 1951). If an element tested as an outlier, its value was replaced with the average value of the two or three other replicate elements on the same RT plate. At most, one outlier was replaced per replicate. 2.5. Expression cloning The CYP9T2 ORF was amplified by PCR, directionally cloned into the SalI and XhoI sites of pENTR4 (Invitrogen) (modified to remove the NotI site in the poly-linker) by standard methods (Sambrook et al., 1989), and transformed into DH5a cells. The forward primer was used with two different reverse primers, R2 (tagged) and R1 (untagged), in separate reactions to create separate constructs with or without a C-terminal extension containing a V5 epitope and the polyhistidine tag (encoded by the vector), respectively (Table 1). Each 100 ml PCR reaction contained 50 pmol of forward and reverse primer, 1  Pfu buffer [10 mM (NH4)2SO4, 20 mM Tris–HCl (pH 8.8), 2 mM MgSO4, 10 mM KCl, 0.1% Triton X-100 and 1 mg/ ml BSA], 0.3 mM each dNTP, 5–10 ng of IPG002G06 plasmid template, and 2.5 U Pfu Turbo DNA Polymerase (Stratagene, La Jolla, CA). The profile for linker-ramp PCR was: 95 1C for 1 min, three cycles of 94 1C for 40 s, 41 1C for 1 min, 0.3 1C/s ramp to 72 1C, and 72 1C for 4 min, followed by 35 cycles of 94 1C for 40 s, 57 1C for 1 min, 72 1C for 4 min, and a final extension of 72 1C for 10 min. The recombinant plasmids, pENTR4-NcoI-2G06 (untagged) and pENTR4-NcoI-2G06V5H6 (tagged) were confirmed by sequencing. 2.6. Recombinant baculoviral protein Protocols for growth and maintenance of Sf9 cells, recombinant baculovirus construction, and heterologous expression using the BaculoDirectTM Expression Kit were as described by Invitrogen. Briefly, an LR recombinase reaction between each pENTR4 recombinant clone and BaculoDirect Linear DNA produced untagged and tagged recombinant baculoviral CYP9T2 clones that were transfected separately into Sf9 cells and grown in the presence of ganciclovir to select for recombinant virus. High titer P3 viral stocks for each construct were produced by successive 72 h amplifications of the initial and P2 stocks. Approximate viral titers were determined by a plaque assay. The viral stocks were used to infect Sf9 cells grown to a density of 2.0  106 cells/ml in a disposable spinner flask. Hemin (5 mg/ml final conc.) was added at the time of infection. For CYP9T2 and housefly reductase co-expression, Sf9 cells were infected with recombinant CYP9T2 baculovirus and housefly reductase baculovirus (Wen et al., 2003) at multiplicities of infection (MOIs, pfu/cell) ranging from 0.1 to 1. A fixed MOI ratio of 1:1 for recombinant CYP9T2: housefly P450 reductase was used in all infections.

2.7. Microsomal preparation Sf9 cells were typically harvested 96 h post-infection (PI) and microsomes were prepared by differential centrifugation essentially as per Wen et al. (2003). Briefly, cells were pelleted by centrifugation at 3000g at 4 1C for 10 min. The pellets were resuspended in half a cell culture volume of 100 mM sodium phosphate buffer (pH 7.8) and repelleted at 3000g for 10 min, washed in ice cold cell lysate buffer (100 mM sodium phosphate pH 7.8, 1.1 mM EDTA, 0.1 mM DTT, 0.5 mM PMSF, 1/1000 vol/vol Sigma protease inhibitor cocktail, 20% glycerol), repelleted at 3000g for 10 min and resuspended in 1/50 cell culture volume of cold cell lysate buffer. The cells were lysed by sonification twice for 30 s on ice with a Branson Sonifier 450, and vortexing for 15 s. The lysate was centrifuged at 10,000g for 20 min at 4 1C in a microcentrifuge and the supernatant was further centrifuged in a TLA110 rotor at 120,000g for 1 h in a Beckman-Coulter Optima ultracentrifuge to pellet the microsomes. The microsomal pellet was resuspended in 500 mL cold cell lysate buffer and used immediately or flash-frozen in N2(l) and stored at
80 1C for up to a month. 2.8. Recombinant protein detection Sf9 microsomes infected with V5-epitope-tagged CYP9T2 recombinant baculovirus at a MOI of 1 were assayed 2–5 days PI. The cell lysates were either sonicated or homogenized on day 5. Non-infected Sf9 cells were prepared similarly. Protein production was determined by western blotting using 1:10,000 Anti-V5 primary antibody (Invitrogen), 1:20,000 Goat Anti-Mouse secondary antibody (Biorad, Hercules, CA), and SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL). Total P450 s in Sf9 microsomes and in untagged CYP9T2 recombinant Sf9 microsomes were determined by carbon monoxide (CO)-difference spectrum analysis (Omura and Sato, 1964) using a Hewlett Packard 8452A Diode-Array Spectrophotometer and OriginTM (Version 5) software. 2.9. Enzyme assays In vitro assays were conducted in 500 ml reactions containing 468 ml of CYP9T2/housefly P450 reductaseexpressing lysate, 132 mM unlabeled myrcene or 120 mM [4-2H]myrcene in pentane, and 0.3 mM NADPH. Reactions were initiated with the addition of NADPH, incubated in a 28 1C water bath for 10, 20 or 30 min, and then extracted three times with pentane:ether (1:1) spiked with 200 ng/ml n-octanol (internal standard). The organic phase was concentrated to approximately 100 ml with N2 gas and directly analyzed by coupled GC-MS at the Nevada Proteomics Center (UNR). Reactions were performed separately with untagged or tagged CYP9T2. Negative controls included reactions run in the absence of substrate, boiled microsomes, or microsomes infected

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

with housefly P450 reductase virus only (no CYP9T2). A Thermo Finnigan Polaris Q ion trap was used with a molecular weight scanning range of 40–160 atomic mass unit (amu) at an ionization potential of 70 eV. A Trace gas chromatograph containing a 60 m  0.25 mm (ID), 0.25 mm film thickness DB-5 capillary column (J&W Scientific, Palo Alto, CA) was programmed for an initial temperature of 50 1C (1 min hold), increase to 200 1C at 5 1C/min, 10 1C/min to 320 1C (20 min hold). The injector was split at a ratio of 100:1 at a temperature of 280 1C with a column flow of 1.5 ml He/min. The detector was set at 200 1C. The enantiomeric composition of ipsdienol was determined by chiral separation using the same GC-MS with a CycloSil-B (30 m  0.25 mm internal diameter, 0.25 mm film thickness) column (J&W Scientific) that was isothermal at 100 1C for 45 min and a flow rate of 1.3 ml He/min. Ipsdienol was identified by comparing retention times and mass spectra with those of an authentic standard. 3. Results 3.1. cDNA isolation and expression A modest EST survey of pheromone-biosynthetic male I. pini midguts revealed five unique putative cytochrome P450 genes. The most highly transcribed gene, which contributed 12 ESTs (represented by EST IPG002G06, GenBank Accession no. CB408249), was selected for further characterization. The cDNA was completely sequenced and designated CYP9T2 by the P450 Nomenclature Committee (David Nelson, personal communication). The 1827 bp cDNA contained a 1599 nt ORF encoding a 532 amino acid (a.a.) protein flanked by 85 nt and 143 nt 50 and 30 UTRs, respectively (Fig. 2). The predicted translation product has a molecular mass of 61 kDa and a PI of 9.5 (Gasteiger et al., 2003). The primary structure has an Nterminal membrane anchor and typical P450 conserved residues, including the WxxxR, ExxR, and PxxFxPERF (PERF) motifs, and the canonical heme-binding domain (PFxxGxRxCxG) surrounding the heme-cysteine ligand (Cys475) (Fig. 2) (Feyereisen, 2005). BLAST searches (Altschul et al., 1990) indicated that CYP9T2 is most similar to coleopteran CYP9 s, including 42% a.a. identity to Colorado potato beetle (Leptinotarsa decemlineata) CYP9V1 and 41% to a red flour beetle (Tribolium castaneum) P450 similar to CYP9F2. It is 94% identical to an uncharacterized CYP9T1 from the California fivespined Ips, I. paraconfusus (http://drnelson.utmem.edu/). To our knowledge, CYP9V1, CYP9F2 and CYP9T1 have not been functionally characterized. CYP9T2 was the only P450 gene among four (represented by ESTs: IPG002G06, GenBank accession no. CB408249; IPG09C09, CB408287; IPG009D04, CB408294; IPG024D01, CB407841) assayed by qRT-PCR that was induced in males by feeding (Fig. 3A) or topical JH III application (not shown). CYP9T2 mRNA levels in males gradually increased over time, with a maximal

839

induction of approximately 28-fold at 32 h. In contrast, mRNA levels in females remained essentially unchanged (Fig. 3A, B). Transcript levels in fed males were nearly 200fold higher than those in fed females or in larvae (all larval digestive tracts contained phloem) (Fig. 3B) and were induced above basal levels in fed males, but not in fed females (Fig. 3B). CYP9T2 mRNA was predominately localized to the anterior midgut of males, with elevated levels also observed in the fat body and posterior midgut within 16 h of feeding (Fig. 3C). 3.2. Functional expression and product formation A baculoviral system was used to produce sufficient enzyme to functionally analyze CYP9T2. The V5-epitopetagged version of CYP9T2 was used to follow recombinant protein production as an antibody for CYP9T2 is unavailable. Western blot analysis indicated low expression of an approximately 65 kDa tagged protein at 2 days PI, and high expression up to 5 days PI. No recombinant protein was detected in non-infected Sf9 cells (Fig. 4A). Sonication and homogenization were equally effective to lyse the cells. CO-difference absorption spectra of microsomes from Sf9 cells producing untagged CYP9T2 had the characteristic peak at 450 nm (Fig. 4B), while microsomes from Sf9 cells without recombinant CYP9T2 did not (not shown). Assays with microsomes from Sf9 cells co-expressing recombinant untagged CYP9T2 and housefly P450 reductase were analyzed by coupled GC-MS for products of myrcene hydroxylation. Selective ion monitoring (SIM) and mass spectrum analyses of microsomes incubated with unlabeled myrcene yielded a retention time and mass spectrum identical to an ipsdienol standard (Fig. 5A, E). Products from reactions incubated with deuterium-labeled myrcene gave the same retention times (Fig. 5B), but with a mass spectrum of appropriate mass to charge (m/z) diagnostic fragments that were one amu larger (Fig. 5F). SIM using the a CycloSil-B (chiral) column with both unlabeled and deuterium-labeled myrcene produced two major peaks with 16.32 and 16.97 min retention times corresponding to (4R)-(
)-ipsdienol and (4S)-(+)-ipsdienol; the unlabeled myrcene yielded 81%-(4R)-(
)-ipsdienol (Fig. 5C). A time course of 10, 20, and 30 min reactions with deuterium-labeled myrcene showed a non-linear increase in ipsdienol production relative to the n-octanol standard (not shown). The products and their relative abundance were statistically identical for both the untagged and tagged versions of CYP9T2. Ipsdienol was not detectable by SIM of products from reactions run in the absence of substrate (not shown), boiled microsomes (Fig. 5D), or microsomes infected with housefly P450 reductase baculovirus construct only (not shown). No other hydroxylated versions of myrcene [amitinol (trans-2-methyl-6-methylene-3,7-octadien-2-ol), E-myrcenol (2-methyl-6-methylene-2,7-octadien-1-ol), linalool (2,6-dimethylocta-2,7-dien-6-ol), or

ARTICLE IN PRESS 840

P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

Fig. 2. Sequence and translation of CYP9T2 cDNA. The deduced a.a. sequence of CYP9T2 is shown above the cDNA sequence, positions for both are indicated to the left. The N-terminal target sequence and conserved WxxxR, ExxR, and PxxFxPERF motifs are underlined. The heme-binding domain (PFxxGxRxCxG) is boxed.

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

(A) 7 6

841

2 CYP9T2

IPG009D04

1 4 0 2 -1 Log2 (Relative Expression) +/- s.e.

0 -2 -2 -3 -4 -5

-4

2

2 IPG024D01

IPG009C09

1

1

0

0

-1 -1

-2

-2

-3 -4

-3 0

4

8

16

32

0

4

Time (h) 5

16

8

32

Time (h)

(B)

4 Unfed

Fed

3

Relative Expression (2-ddCT +/- s.e.)

2 1 n. a.

0 Female 7 6

Larvae

Male

(C)

5 Unfed

4

Fed

3 2 1 0 H

AM

PM

HG

FB

C

Tissue Fig. 3. qRT-PCR analysis of P450 mRNA levels. (A) Time course of midgut expression (log2) of CYP9T2 (IPG002G06), IPG009C09, IPG009D04, and IPG024D01 in fed males (square symbol with solid line) and females (round symbol with dashed line) relative to unfed males and females. Filled-in symbols indicated a statistically significant difference compared to unfed samples at a given time point (Student’s t-test, po0.05, n ¼ 3). (B) Relative CYP9T2 mRNA levels in midguts of starved or fed (16 h) adults and larvae; n.a. ¼ not applicable (all larvae had fed). (C) Relative CYP9T2 mRNA levels in various tissues of starved or fed (16 h) males; H, head/pro-thorax; AM, anterior midgut; PM, posterior midgut; HG, hindgut; FB, fat body; C, carcass.

ARTICLE IN PRESS 842

P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

for monoterpene detoxification and monoterpenoid pheromone biosynthesis (Vanderwel and Oehlschlager, 1987; Greis et al., 1990; Seybold et al., 2000) may uncover new avenues to mitigate the effects of these destructive pests.

100

0 100

Fig. 4. (A) Western blot analysis of V5-tagged CYP9T2 production over time by Sf9 cells infected with recombinant baculovirus. Each lane contains microsomes from cell lysates sonicated on day 2 (lane 1), day 3 (lane 2), day 4 (lane 3), and day 5 (lane 4) PI, cell lysates homogenized on day 5 PI (lane 5), or from noninfected Sf9 cells (lane 6). (B) CO-difference absorption spectra of Sf9 microsomes infected with untagged CYP9T2 recombinant baculovirus. The arrow indicates the characteristic absorbance peak at 450 nm.

(A)

16.7

(B)

16.66

0 100

16.32

(C)

(4R)-(-)

(4S)-(+)

4. Discussion I. pini readily oxidizes host tree monoterpenes, including myrcene, possibly to detoxify resin components (Raffa and Smalley, 1995; Paine et al., 1997) and/or attenuate interference with pheromone reception (Raffa, 2001). One product of myrcene hydroxylation is ipsdienol, which is also produced de novo as a pheromone component by males that feed or have been treated with JH III (Seybold et al., 1995a, b; Tillman et al., 1998). Detoxification and pheromone biosynthesis are related but distinct because non-pheromone ipsdienol is produced as a racemic mixture, whereas pheromonal ipsdienol of the western population of I. pini is 95% (
)-enantiomer (Seybold et al., 1995a, b; Miller et al., 1997; Quilici, 1997; Seybold and Tittiger, 2003). Understanding bark beetle-host tree interactions and the expected evolutionarily related pathways Fig. 5. GC-MS analysis of ipsdienol formed from myrcene by recombinant untagged CYP9T2. SIM analysis using a DB-5 column with reactions containing (A) unlabeled myrcene or (B) deuterium-labeled myrcene (identical to the ipsdienol standard, not shown). (C) SIM analysis using a CycloSil-B (chiral) column of ipsdienol from reactions incubated with unlabeled myrcene. The calculated enantiomeric percentages are 81% (4R)-(
)-ipsdienol and 19% (4S)-(+)-ipsdienol. (D) Products from reactions incubated with boiled microsomes (negative control). (E, F) Mass spectra of the peaks from A and B, respectively.

% Relative Abundance

OH

geraniol (2,6-dimethyl-2,6-octadien-8-ol)] were detected in any sample.

HO 16.97

0 35

(D)

0 14

14.5

15

15.5

16

16.5

17

17.5

18

Time (min) 100

85.1

(E)

67.1

91.1

57.1 0 100

109.2 119.1

86.1

(F)

58.2 68.2

92.1

110.1 120.1

0 40

50

60

70

80

90

100 110 120 130 140 150 160 m/z

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

Here, we report the isolation and functional expression of a monoterpene-oxidizing cytochrome P450 cDNA, CYP9T2, which produces the pheromone component, (4R)-(
)-ipsdienol. The predicted translation product has a hydrophobic N-terminal target sequence and many motifs, including the classic heme-binding domain, common to P450 s (Fig. 2). Pheromone-biosynthetic genes have conserved transcription profiles: they are transcribed predominantly in midguts (Tillman et al., 2004; Gilg et al., 2005; Bearfield et al., 2006); basal expression levels are higher in males than in females; and their mRNA levels are coordinately induced by feeding (Keeling et al., 2004) and topical JH III treatment (Keeling et al., 2006). The CYP9T2 EST (IPG002G06) clusters with the EST for GPPS in microarray analyses and has 4500-fold higher basal expression levels in male midguts relative to females (Keeling et al., 2006). Here, we show that unlike other I. pini P450 genes tested, CYP9T2 mRNA levels increased in male anterior midguts in response to feeding (Fig. 3A). CYP9T2 mRNA was predominately localized to the anterior midgut of pheromone-producing male I. pini (Fig. 3C) and feeding raised CYP9T2 mRNA levels in males, but not females (Fig. 3A, B). These data correlate with other pheromonebiosynthetic genes and strongly support a role for CYP9T2 in pheromone biosynthesis. The expression data suggested myrcene as a logical CYP9T2 substrate. A baculovirus system was used to produce sufficient enzyme for functional assays. Housefly cytochrome P450 reductase was co-expressed with CYP9T2 since over-expressed P450 s in baculoviral systems can exhaust endogenous reductase activities (Wen et al., 2003). CO-difference absorption spectra of Sf9 microsomes infected with untagged CYP9T2 recombinant baculovirus revealed the characteristic peak at 450 nm (Fig. 4B), indicating the presence of a functional P450 enzyme. The significant peak at 420 nm suggests that the protein was not completely reduced, or that a fraction of recombinant proteins did not properly bind heme (Lambalot et al., 1995; Wen et al., 2003). Sf9 microsomes containing recombinant CYP9T2 readily hydroxylated myrcene to ipsdienol (Fig. 5). The amount of ipsdienol produced increased with time, and myrcene hydroxylation activity was abolished if microsomes were heat-denatured prior to the reaction (Fig. 5D), confirming that ipsdienol is an enzymatic product. Furthermore, microsomes from cells that were infected with recombinant housefly P450 reductase baculovirus (without recombinant CYP9T2) did not hydroxylate myrcene (not shown). Thus, ipsdienol production was due to CYP9T2, and not to an endogenous activity of Sf9 cells. Other possible myrcene hydroxylation products were not detected, suggesting high product specificity. The substrate specificity of CYP9T2 has not yet been determined. Inferring P450 activity from sequence data must be done with extreme caution due to the limited number of functionally characterized insect P450 s and the

843

variability that a single a.a. change can cause (Feyereisen, 2005). Insect P450 s in the CYP4, 6, 9 and 15 families can accept terpenoid substrates when expressed in heterologous systems, and many P450 s have wide substrate ranges. Diploptera punctata CYP15A1 catalyzes the stereoselective epoxidation of methyl farnesoate to JH III (Sutherland et al., 1998), while Musca domestica CYP6A1 is relatively unspecific, metabolizing pesticides in addition to terpenoids (Helvig et al., 2004). We expect future experiments to show that CYP9T2 is a highly specific P450, like CYP15A1, due to the apparently preferential hydroxylation of myrcene to (
)-ipsdienol. CYP9T2 consistently produced an excess of the (4R)(
)-enantiomer (Fig. 5C). While the possibility that the enantiomeric ratio of CYP9T2 products may be affected by experimental conditions is a topic of ongoing study, it is reasonable to assume that the observed excess of (4R)-(
)ipsdienol is biologically relevant. The 81:19 (
):(+) ipsdienol product from CYP9T2 (Fig. 5C) is notably different from the approximately 95:5 (
):(+) ratio of ipsdienol recovered from the volatile headspace of western North American populations of pheromone-biosynthetic male I. pini (Seybold and Tittiger, 2003; Domingue et al., 2006), implying that the ratio is modified by terminal steps in the pheromone-biosynthetic pathway. Our biochemical data are supported by the observation that different enantiomeric ratios of ipsdienol from different populations of North American I. pini are controlled mostly by a single locus, with contributions from additional loci (Domingue et al., 2006). If CYP9T2 provides a ‘‘nearly correct’’ enantiomeric ratio, (4R)-(
)-ipsdienol levels may be increased by subsequent metabolic steps that oxidize (4S)-(+)-ipsdienol to ipsdienone and then stereo-selectively reduce the ketone back to (4R)-(
)-ipsdienol. This may explain high levels of ipsdienone in pheromonebiosynthetic male I. pini (Ivarsson et al., 1997; D. Vanderwel, personal communication). In this respect, some ESTs that cluster with pheromone-biosynthetic pathway genes in a recent microarray analysis are predicted to encode dehydrogenases and reductases (Keeling et al., 2006). These are currently being investigated for their possible contributions to monoterpenoid metabolism. Acknowledgments We thank D. Vanderwel for deuterium-labeled myrcene and for sharing unpublished data; M. Schuler for the housefly P450 reductase baculoviral clone; C. Oehlschlager for the ipsdienol standard; D. Nelson for naming of CYP9T2 in accordance with current P450 nomenclature; the Nevada Genomics Center for assistance with sequencing and qRT-PCR; D. Quilici at the Nevada Proteomics Center for GC/MS analysis; M. Ginzel for use of his chiral column; H. Damke for help with baculovirus expression; members of GJB and CT’s laboratories for assistance with collecting beetles and helpful advice; and the US Forest Service, South Tahoe District, and the Whittell Board

ARTICLE IN PRESS 844

P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845

which oversees the UNR Little Valley forest, for permission to collect beetle-infested trees. This work was supported by the USDA (2006-35604-16727), NSF (IBN 0316370), and the Nevada Agricultural Experiment Station (NAES) (NEV00339). This paper is a contribution of the NAES, publication #03066929. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Molec. Biol. 215, 403–410. Andersen, J.F., Walding, J.K., Evands, P.H., Bowers, W.S., Feyereisen, R., 1997. Substrate specificity for the epoxidation of terpenoids and active site topology of house fly cytochrome P450 6A1. Chem. Res. Toxicol. 10, 156–164. Anderson, A.B., 1969. Monoterpenes, fatty and resin acids of Pinus ponderosa and Pinus jeffreyi. Phytochemistry 8, 873–875. Bearfield, J.C., Keeling, C.I., Young, S., Blomquist, G.J., Tittiger, C., 2006. Isolation, endocrine regulation, and mRNA distribution of the 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMG-S) gene from the pine engraver, Ips pini. Insect Molec. Biol. 15, 187–195. Birch, M.C., Light, D.M., Wood, D.L., et al., 1980. Pheromonal attraction and allomonal interruption of Ips pini in California by the two enantiomers of ipsdienol. J. Chem. Ecol. 6, 703–717. Browne, L.E., 1972. An emergence cage and refrigerated collector for wood-boring insects and their associates. J. Econ. Entomol. 65, 1499–1501. Byers, J.A., 1995. Host tree chemistry affecting colonization in bark beetles. In: Carde, R.T., Bell, W.J. (Eds.), Chemical Ecology of Insects 2. Chapman & Hall, New York, pp. 154–213. Dean, R., Dixon, W., 1951. Simplified statistics for small numbers of observations. Anal. Chem. 23, 636–638. Domingue, M., Starmer, W., Teale, S., 2006. Genetic control of the enantiomeric composition of ipsdienol in the Pine Engraver, Ips pini. J. Chem. Ecol. 32, 1005–1026. Eigenheer, A.L., Keeling, C.I., Young, S., Tittiger, C., 2003. Comparison of gene representation in midguts from two phytophagous insects, Bombyx mori and Ips pini, using expressed sequence tags. Gene 316, 127–136. Feyereisen, R., 2005. Insect Cytochromes P450. In: Gilbert, L.I., Iatrou, K., Gill, S.S. (Eds.), Comprehensive Molecular Insect Science, vol. 4. Elsevier BV, Amsterdam, pp. 1–77. Fish, R., L. Browne, E., Bergot, B.J., 1984. Pheromone biosynthetic pathways: conversion of ipsdienone to (
)-ipsdienol, a mechanism for enantioselective reduction in the male bark beetle, Ips paraconfusus. J. Chem. Ecol. 10, 1057–1064. Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R.D., Bairoch, A., 2003. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucl. Acids Res. 31, 3784–3788. Gilg, A.B., Bearfield, J.C., Tittiger, C., Welch, W.H., Blomquist, G.J., 2005. Isolation and functional expression of the first animal geranyl diphosphate synthase and its role in bark beetle pheromone biosynthesis. Proc. Natl. Acad. Sci. USA 102, 9760–9765. Greis, G., Leufven, A., LaFontaine, J.P., et al., 1990. New metabolites of a-pinene produced be the mountain pine beetle, Dendroctonus ponderosae (Coleoptera: Scolytidae). Insect Biochem. 20, 365–367. Hall, G.M., Tittiger, C., Andrews, G.L., et al., 2002. Midgut tissue of male pine engraver, Ips pini, synthesizes monoterpenoid pheromone component ipsdienol de novo. Naturwissenschaften 89, 79–83. Helvig, C., Koener, J.K., Unnithan, G.C., Feyereisen, R., 2004. CYP15A1, the cytochrome P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in cockroach corpora allata. Proc. Natl. Acad. Sci. USA 101, 4024–4029. Hendry, L.B., Piatek, B., Browne, L.E., et al., 1980. In vivo conversion of a labelled host plpant chemical topheromones of the bark beetle, Ips paraconfusus. Nature 284, 485.

Hughes, P.R., 1974. Myrcene: a precursor of pheromones in Ips beetles. J. Insect Physiol. 20, 1274–1275. Hunt, D.W.A., Smirle, M.J., 1988. Partial inhibition of pheromone production in Dendroctonus ponderosae (Coleoptera: Scolytidae) by polysubstrate monooxygenase inhibitors. J. Chem. Ecol. 14, 529–536. Ivarsson, P., Blomquist, G.J., Seybold, S.J., 1997. In vitro production of the pheromone intermediates ipsdienone and ipsenone by the bark beetles Ips pini (Say) and I. paraconfusus Lanier (Coleoptera: Scolytidae). Naturwissenschaften 84, 454–457. Keeling, C.I., Blomquist, G.J., Tittiger, C., 2004. Coordinated gene expression for pheromone biosynthesis in the pine engraver beetle, Ips pini (Coleoptera: Scolytidae). Naturwissenschaften 91, 324–328. Keeling, C.I., Bearfield, J.C., Young, S., Blomquist, G.J., Tittiger, C., 2006. Juvenile hormone-regulated gene expression in the anterior midgut of the pine engraver beetle, Ips pini. Insect Molec. Biol. 15, 207–216. Kegley, S.J., Livingston, R.L., Gibson, K.E., 2002. Pine engraver, Ips pini (Say) in the western United States. 2002, from /http://www.barkbeetles. org/ips/PEFIDL122.htmS. Lambalot, R.H., Cane, D.E., Aparicio, J.J., Katz, L., 1995. Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry 34, 1858–1866. Langenheim, J.H., 2003. Plant Resins: Chemistry, Evolution, Ecology, Ethnobiology. Timber Press, Portland, OR. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Martin, D., Bohlmann, J., Gershenzon, J., Francke, W., Seybold, S.J., 2003. A novel sex-specific and inducible monoterpene synthase activity associated with a pine bark beetle, the pine engraver, Ips pini. Naturwissenschaften 90, 173–179. Miller, D.R., Gibson, K.E., Raffa, K.F., Seybold, S.J., Teale, S.A., Wood, D.L., 1997. Geographic variation in response of pine engraver, Ips pini, and associated species to pheromone, lanierone. J. Chem. Ecol. 23, 2013–2031. Omura, S., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes II. J. Biol. Chem. 239, 2379–2385. Paine, T.D., Raffa, K.F., Harrington, T.C., 1997. Interactions among scolytid bark beetles, their associated fungi, and live host conifers. Ann. Rev. Entomol. 42, 179–206. Phillips, M.A., Croteau, R.B., 1999. Resin-based defenses in conifers. Trends Plant Sci. 4, 184–190. Quilici, D.R., 1997. De novo biosynthesis of aggregation pheromone components by the pine bark beetles, Ips paraconfusus (Lanier) and Ips pini (Say) (Coleoptera: Scolytidae), and identification of an interruptant and a synergist produced by Ips pini. Ph.D. Dissertation. Biochemistry, University of Nevada, Reno, 89 pp. Raffa, K.F., 2001. Mixed messages across multiple trophic levels: the ecology of bark beetle chemical communication systems. Chemoecology 11, 49–65. Raffa, K.F., Smalley, E.B., 1995. Interaction of pre-attack and induced monoterpene concentrations in host conifer defense against bark beetle-fungal complexes. Oecologia 102, 285–295. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, MA. Santos, A.M., Vasconcelos, T., Mateus, E., et al., 2006. Characterization of the volatile fraction emitted by phloems of four pinus species by solid-phase microextraction and gas chromatography-mass spectrometry. J. Chromatogr. A. 1105, 191–198. Seybold, S.J., Tittiger, C., 2003. Biochemistry and molecular biology of de novo isoprenoid pheromone production in the Scolytidae. Ann. Rev. Entomol. 48, 425–453. Seybold, S.J., Ohtsuka, T., Wood, D.L., Kubo, I., 1995a. The enantiomeric composition of ipsdienol: a chemotaxonomic character for North American populations of Ips spp. in the pini subgeneric group (Coleoptera: Scolytidae). J. Chem. Ecol. 21, 995–1016.

ARTICLE IN PRESS P. Sandstrom et al. / Insect Biochemistry and Molecular Biology 36 (2006) 835–845 Seybold, S.J., Quilici, D.R., Tillman, J.A., Vanderwel, D., Wood, D.L., Blomquist, G.J., 1995b. De novo biosynthesis of the aggregation pheromone components ipsenol and ipsdienol by the pine bark beetles Ips paraconfusus Lanier and Ips pini (Say) (Coleoptera: Scolytidae). Proc. Natl. Acad. Sci. USA 92, 8393–8397. Seybold, S.J., Bohlmann, J., Raffa, K.F., 2000. Biosynthesis of coniferophagous bark beetle pheromones and conifer isoprenoids: evolutionary perspective and synthesis. Can. Entomol. 132, 697–753. Sutherland, T.D., Unnithan, G.C., Andersen, J.F., et al., 1998. A cytochrome P450 terpenoid hydroxylase linked to the suppression of insect juvenile hormone synthesis. Proc. Nat. Acad. Sci. U.S.A 95, 12884–12889. Tillman, J.A., Holbrook, G.L., Dallara, P.L., et al., 1998. Endocrine regulation of de novo aggregation pheromone biosynthesis in the pine engraver, Ips pini (Say) (Coleoptera: Scolytidae). Insect Biochem. Molec. Biol. 28, 705–715.

845

Tillman, J.A., Lu, F., Staehle, L., et al., 2004. Juvenile hormone regulates de novo isoprenoid aggregation pheromone biosynthesis in pine bark beetles, Ips spp. (Coleoptera: Scolytidae), through transcriptional control of HMG-CoA reductase. J. Chem. Ecol. 30, 2459–2494. Trapp, S., Croteau, R., 2001. Defensive resin biosynthesis in conifers. Ann. Rev. Plant Physiol. 52, 689–724. Vanderwel, D., Oehlschlager, A.C., 1987. Biosynthesis of pheromones and endocrine regulation of pheromone production in Coleoptera. In: Prestwich, G.D., Blomquist, G.J. (Eds.), Pheromone Biochemistry. Academic Press, Orlando, pp. 175–215. Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and angular furanocoumarins by Papilio polyxenes CYP6B1 coexpressed with NADPH cytochrome P450 reductase. Insect Biochem. Molec. Biol. 33, 937–947. Wood, S.L., 1982. The bark and ambrosia beetles of North and Central America: (Coleoptera: Scolytidae): a taxonomic monograph. Brigham Young University, Provo, Utah.