Functional genetic variation in the serotonin 5-HTTLPR modulates brain damage in frontotemporal dementia

Neurobiology of Aging 36 (2015) 446e451

Contents lists available at ScienceDirect

Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging

Functional genetic variation in the serotonin 5-HTTLPR modulates brain damage in frontotemporal dementia Enrico Premi a, Silvana Archetti b, Andrea Pilotto a, Davide Seripa c, Barbara Paghera d, Alessandro Padovani a, Barbara Borroni a, * a

Centre for Ageing Brain and Neurodegenerative Disorders, Neurology Unit, University of Brescia, Brescia, Italy III Laboratory of Analyses, Brescia Hospital, Brescia, Italy Geriatric Unit and Gerontology-Geriatrics Research Laboratory, Istituto di Ricovero e Cura a Carattere Scientifico, Casa Sollievo della Sofferenza San Giovanni Rotondo, Foggia, Italy d Nuclear Medicine Unit, University of Brescia, Brescia, Italy b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 April 2014 Received in revised form 29 June 2014 Accepted 8 July 2014 Available online 15 July 2014

In frontotemporal dementia (FTD), nonmodifiable (genetic background) and modifiable (cognitive reserve [CR]) factors might interact in affecting frontotemporal damage. Serotoninergic dysfunction has been suggested as a key factor in FTD pathogenesis. 5-HTTLPR polymorphism on SCLA4 gene modulates the serotoninergic transmission. To evaluate the impact of 5-HTTLPR polymorphism on regional cerebral blood flow (rCBF) and its possible interaction with CR, 76 FTD patients with a 5-HTTLPR genotyping were recruited. All subjects underwent neuropsychological assessment and single-photon emission computed tomography imaging. Reserve index (RI) was computed from educational and occupational attainments, as proxy measure of CR. 5-HTTLPR analysis evidenced 14 S/S, 24 L/L, and 38 S/L carriers. No neuropsychological/behavioral differences were present. At the same disease stage, L/L carriers have a greater bilateral frontal rCBF decrease. Patients with higher RI had greater damage in right frontal and temporal regions. The additive effect of 5-HTTLPR polymorphism and RI was characterized by greater frontal rCBF deficit. 5-HTTLPR and CR act together to counteract brain pathology in FTD. Further studies are warranted to test the serotonin role in monogenic forms of FTD. Ó 2015 Elsevier Inc. All rights reserved.

Keywords: Frontotemporal dementia Cognitive reserve 5-HTTLPR SLC6A4 Serotonin SPECT Statistical parametric mapping

1. Introduction Frontotemporal dementia (FTD) is a clinically and neuropathologically heterogeneous disorder characterized by behavioral changes, executive dysfunctions, and language impairment (Kertesz et al., 2005; Neary et al., 1998; Seelaar et al., 2011). The current definition of FTD includes 3 different clinical subtypes: the behavioral variant of FTD (bvFTD) (Rascovsky et al., 2011) and the agrammatic and the semantic variants of primary progressive aphasia (Gorno-Tempini et al., 2011). FTD is still an orphan disorder, and no pharmacologic treatment is available yet. Several studies have attempted to look for modifiers of disease course and possible targets of pharmacologic interventions, but no satisfactory results have been reached (Pressman and Miller, 2014).

* Corresponding author at: Centre for Ageing Brain and Neurodegenerative Disorders, Neurology Unit, University of Brescia, Brescia, Italy. Tel.: þ39 0303995632; fax: þ39 0303995014. E-mail address: [email protected] (B. Borroni). 0197-4580/$ e see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.neurobiolaging.2014.07.008

As in other neurodegenerative disorders such as Alzheimer’s disease (Garibotto et al., 2008), the effect of brain reserve in modulating brain damage and disease onset has been demonstrated (Amieva et al., 2014). Indeed, higher education levels and occupational attainment may cope better with the ongoing FTD by a more efficient neural network recruitment (Perneczky et al., 2007; Premi et al., 2013a, 2013b; Spreng et al., 2011). In other words, FTD patients with greater brain reserve show greater brain damage but comparable clinical stage. Thus, past educational history and occupational attainment may represent the environmental background to counteract the ongoing neurodegenerative process, but it is not susceptible to further manipulation and improvement. Looking at the impairment of neurotransmission pathways in FTD may represent an extra target for pharmacologic intervention and modulation of disease onset. A number of studies have suggested an impairment of serotoninergic system in this disorder (Engelborghs et al., 2004; Franceschi et al., 2005; Huey et al., 2006; Sparks and Markesbery, 1991; Yang and Schmitt, 2001), and the few available works on this issue have argued for the usefulness of

E. Premi et al. / Neurobiology of Aging 36 (2015) 446e451

447

serotoninergic treatment approach in FTD (Mendez, 2009; Seltman and Matthews, 2012). Indeed, serotonin (5-HT) uptake is strongly modulated by genetic background, by a polymorphism in the promoter region of the serotonin transporter gene (SLC6A4) (Hariri et al., 2006). This polymorphism is a variable repeat sequence (5HTTLPR), resulting in either the short (S) variant comprising 14 copies of a 20- to 23-base pair (bp) repeat unit or the long (L) variant comprising 16 copies (Heils et al., 1996). It has been clearly demonstrated that L allele is associated with greater 5-HT reuptake compared with the S allele (Greenberg et al., 1999; Little et al., 1998; Shioe et al., 2003; Singh et al., 2012), and this genetic variation represents a marker of 5-HT neurotransmission efficiency. Thus, 5HTTLPR polymorphism might modulate brain damage in FTD, acting on serotoninergic networks involved in the disease. These premises prompted the present study, and we tested the effect of functional genetic 5-HTTLPR polymorphism on cerebral perfusion in FTD and its potential interaction with cognitive reserve (CR).

patients with high education and occupation (RI ¼ 2); otherwise, it was considered as RI (RI ¼ 0, 1). Frontotemporal DementiaeModified Clinical Dementia Rating Scale (FTD-modified CDR) was assessed to establish disease severity (Knopman et al., 2008), as its significant correlation with brain damage in FTD (Borroni et al., 2010). Stringent exclusion criteria were applied as follows: (1) cerebrovascular disorders, previous stroke, hydrocephalus, and intracranial mass documented by magnetic resonance imaging; (2) a history of traumatic brain injury or another neurologic disease; (3) significant medical problems; and (4) bipolar disorder, schizophrenia, substance abuse disorder, or mental retardation according to criteria of the Diagnostic and Statistical Manual of Mental Disorders (4th edition). The work was conformed to the Helsinki Declaration and was approved by local ethical committee of Brescia hospital, Italy.

2. Methods

Results are expressed as mean  standard deviation. Chi-square or analysis of variance test was used, as appropriate. In regard to neuropsychological scores, the statistical significance for multiple testing was p < 0.001 (corrected for Bonferroni post hoc test). Data analyses were carried out using SPSS 21.0 software (Chicago, IL, USA).

2.1. Subjects Patients fulfilling current clinical criteria for FTD (bvFTD, agrammatic variant Primary Progressive Aphasia [avPPA] and semantic variant Primary Progressive Aphasia [svPPA]) (GornoTempini et al., 2011; Rascovsky et al., 2011) were evaluated at the Centre for Aging Brain and Neurodegenerative Disorders, University of Brescia, Brescia, Italy. To be eligible for the present study, FTD patients had to undergo single-photon emission computed tomography (SPECT) imaging (all the SPECTs done on the same scanner). Each patient underwent a physical evaluation, a routine laboratory examination, and a brain structural imaging study. The diagnostic assessment involved a review of full medical history, a semistructured neurologic examination, and an extensive cognitive assessment according to a standardized battery, as already reported (Borroni et al., 2007). Demographic characteristics, years of schooling, and medical family history (i.e., positive family history for dementia) were carefully recorded (Premi et al., 2012). Education was defined as the number of completed years of formal education, including university or apprenticeship (only in the case a formal educational program was associated). Occupational attainment was rated with a score ranging from 0 to 4 (0 ¼ no occupation; 1 ¼ unskilled laborer, housewife; 2 ¼ skilled laborer, tradesman, low-level civil servant, employee, self-employed small business, office or sales person; 3 ¼ midlevel civil servant or management, head of a small business, academician or specialist in a subordinate position; 4 ¼ senior civil servant or management, senior academic position, self-employed with high degree of responsibility), corresponding to the last employment of the subject (Garibotto et al., 2008). On the basis of the Italian educational system and the mean age of subjects, almost half of patients completed the primary school (5 years of education, 39.5%) and the others completed the secondary school and/or degree (8e13 years, 60.5%); for this reason, we dichotomized educational level into these 2 groups. Furthermore, considering occupational level distribution in our sample (0% with level 0, 3.9% with level 4, 51.3% with level 1, and the others with level >1) (for details, see “Results” section), we dichotomized occupation using 1 as cutoff. Finally, we calculated reserve index (RI) considering both educational and occupational attainment, as the pairwise sum of the 2-rank transformation of education and occupation scales, as previously published (Borroni et al., 2009). We considered RIþ in

2.2. Statistical analysis

2.3. Genetic analysis Patients were screened for the most common FTD monogenic forms, namely granulin (GRN), microtubule-associated protein tau (MAPT), TDP-43 binding protein (TARDBP), and C9orf72 hexanucleotide expansion, as already reported (Premi et al., 2012). 5-HTTLPR polymorphism rs4795541, the 22-bp variable number tandem repeat in the promoter region of SLC6A4 gene was investigated by means of polymerase chain reaction of a 419- or 375-bp DNA fragment (from the L and S allele, respectively) using the oligonucleotide primers 50 ATGCCAGCACCAGCACCTAACCCCTAATGT 30 (forward) and 50 GGACCGCAAGGTGGGCGGGA 30 (reverse) flanking the promoter region of the SLC6A4 gene. The allele identification was made directly by means of 2.5% agarose gel electrophoresis. 2.4.

99m

Tc-ECD SPECT acquisition image preprocessing and analysis

FTD patients were administered an intravenous injection of 1110 MBq 99mTc-ECD (ethylcysteinate dimer, Neurolite; Bristol-Myers Squibb Pharma) with closed eyes in a rest condition, lying supine in a quiet dimly lit room. All individuals were imaged using a dualhead rotating gamma camera (VG Millenium GE) fitted with a lowenergy high-resolution collimator, 30 minutes after intravenous injection of 99mTc-ECD. A 128  128 pixel matrix was used for image acquisition with 120 views over a 360 orbit (in 3 step) with a pixel size and slice thickness of 1 mm, in 27 minutes if total counts were <5  106. Image reconstruction was performed by a ramp-filtered back projection and 3-dimensionally smoothed with a Metz filter (order 3, enhancement 1.24, full-width half maximum 6.7 mm, cutoff 0.61 cycles/cm). The reconstructed images were corrected for gamma ray attenuation using the Chang method (attenuation coefficient 0.11/cm). Statistical Parametric Mapping (SPM8; Welcome Department of Cognitive Neurology, University College, London, UK) and Matlab 7.6 (Mathworks, Inc. Sherborn, MA, USA) were used for image preprocessing. Images were spatially normalized to a reference stereotactic template (Montreal Neurological Institute) and smoothed by a Gaussian kernel of 8  8  8 mm full-width half maximum.

448

E. Premi et al. / Neurobiology of Aging 36 (2015) 446e451

Table 1 Demographic and clinical characteristics according to 5-HTTLPR genotype in FTD patients

Age (y) Age at onset (y) Education (y) RIþ (%) Gender, F (%) Positive family history (%) Antidepressant (SSRI) (%) Antipsychotic (%) Diagnosis (bvFTD/avPPA/svPPA) FTD-modified CDR MMSE Short story Raven matrices Rey figure, copy Rey figure, recall Phonological fluency Semantic fluency Digit span, backward Token test Trail making, A Trail making, B Clock drawing NPI, total score FBI, total score

FTD overall (n ¼ 76)

S/S carriers (n ¼ 14)

S/L carriers (n ¼ 38)

L/L carriers (n ¼ 24)

p

66.4  7.5 63.7  7.3 7.0  3.4 26 (34.2) 39 (51.3) 29 (38.2) 18 (23.7) 8 (10.5) 55/16/5 5.1  3.8 22.1  6.7 5.6  4.5 18.8  6.6 22.8  10.2 8.3  6.6 16.8  11.6 22.0  11.3 4.9  1.5 27.1  7.4 187.7  202.0 362.4  159.6 5.8  3.4 16.6  12.0 16.1  10.9

64.7  8.9 62.0  8.4 6.5  3.6 4 (28.6) 7 (50) 5 (35.7) 2 (14.3) 4 (28.5) 10/4/0 5.2  3.4 22.9  4.0 4.4  4.0 18.6  4.9 21.4  10.9 8.2  6.1 15.2  10.1 22.1  8.3 4.4  1.2 27.4  6.5 140.6  131.3 354.6  173.3 5.9  3.3 15.8  12.1 18.4  11.7

67.3  3.8 64.6  7.4 7.0  3.3 10 (26.3) 22 (57.9) 17 (44.7) 12 (31.6) 2 (7.1) 26/7/5 4.9  3.5 22.7  6.6 5.3  4.3 18.5  7.6 22.7  10.9 8.7  7.0 18.1  11.6 22.6  10.6 5.1  1.3 28.1  6.9 209.0  200.8 343.7  160.9 5.5  3.8 18.1  11.4 17.1  11.7

66.0  6.3 63.3  6.6 7.5  3.5 12 (50) 10 (41.7) 7 (29.2) 2 (8.3) 2 (8.3) 19/5/0 5.3  5.1 20.8  7.9 6.8  5.3 19.3  6.0 23.8  8.9 7.6  6.4 15.6  12.4 21.0  14.0 4.9  1.8 25.3  8.7 222.3  190.3 396.8  153.6 6.3  2.7 14.4  12.9 13.7  9.2

0.51 0.51 0.71 0.14 0.45 0.46 0.27 0.28 0.22 0.94 0.51 0.31 0.91 0.81 0.85 0.65 0.87 0.29 0.41 0.48 0.46 0.73 0.48 0.37

Key: avPPA, agrammatic variant of primary progressive aphasia; bvFTD, behavioral variant of FTD; FBI, frontal behavioral inventory; FTD, frontotemporal dementia; FTDmodified CDR, Frontotemporal Dementia-Modified Clinical Dementia Rating Scale; MMSE, Mini-Mental State Examination; NPI, neuropsychiatry inventory; RIþ, patients with high education and occupation (RI ¼ 2); SSRI, selective serotonin reuptake inhibitors; svPPA, semantic variant of PPA.

2.5. Statistical analysis To test the main effect of rs4795541 (5-HTTLPR) genotype (0 ¼ LL, 1 ¼ LS, 2 ¼ SS) and RI (0 ¼ negative, 1 ¼ positive) and the interaction between these 2 factors, we used a full factorial statistical design. The analyses were adjusted for age, gender, clinical diagnosis, disease severity (FTD-modified CDR), and presence of positive family history for dementia (yes/no). For all the previous analyses, the statistical threshold was set to p < 0.001 uncorrected for multiple comparisons, with an extent threshold voxels of 40. Clusters surviving family-wise error (0.05 cluster level) were reported.

3. Results Seventy-six FTD patients entered the study. Fifty-five patients had the diagnosis of bvFTD, 16 of agrammatic variant of primary progressive aphasia, and 5 of semantic variant of primary progressive aphasia. Mean age at onset was 63.7  7.5 years, 51.3% patients were female, and the mean education level was 7.0  3.4 years.

Genetic screening identified 7 patients with pathogenetic mutations leading to monogenic FTD, namely 1 patient with TARDBP N267S mutation, 1 with C9orf72 expansion, and 5 carrying the T272SfsX10 GRN mutation. A positive family history for dementia was present in the 38.2% of the patients. 5-HTTLPR genotyping evidenced 14 homozygous short-allele carriers (S/S), 24 patients with homozygous long allele (L/L), and 38 heterozygous (S/L) subjects. As reported in Table 1, demographic characteristics, clinical diagnosis and dementia severity were comparable across 5-HTTLPR genotypes. Furthermore, no differences in neuropsychological tests and behavioral scores were detected (Table 1). When the main effect of 5-HTTLPR genotype was tested, significant reduction of regional cerebral blood flow in the frontal lobes bilaterally in LL carriers was detected (Table 2, Fig. 1A). As represented by the plot (Fig. 1A), the mean cluster perfusion was lower in L/L, higher in S/S, and intermediate in heterozygous L/S carriers. The inverse relationship did not show any cluster surviving the preestablished threshold. Considering RI as a proxy measure of CR, RIþ showed a reduced regional cerebral blood flow in right frontal and

Table 2 Effect of 5-HTTLPR polymorphism, CR (as measured by RI), and their interaction on brain perfusion Region 5-HTTLPR main effect (LL < SS) Left middle frontal gyrus Right superior frontal gyrus Reserve index (RIþ < RI) Right superior frontal gyrus Right middle temporal gyrus Interaction of 5-HTTLPR and reserve index (LL/RIþ
x

y

32 28

46 56

18 40

26 22

z

T

p

Cluster size

36 26

4.42 4.02

0.001 (unc) 0.001 (unc)

1049 352

32 4

42 38

3.60 3.49

0.001 (unc) 0.001 (unc)

65 42

58 58

28 10

4.99 4.66

0.001 (unc) <0.001 FWE 0.001 (unc) 0.002 FWE

2065 1645

Talairach coordinates of significant voxels, at p < 0.001 unc. Clusters surviving p < 0.05 FWE cluster level are indicated. Key: CR, cognitive response; FWE, family-wise error; L, long; RI, reverse index; RIþ, subjects with high education and occupation attainments (RI ¼ 2); RI, subjects with either high occupation or education attainments or subjects with both low occupation and education attainments (RI ¼ 0 or 1); S, small; unc, uncorrected.

E. Premi et al. / Neurobiology of Aging 36 (2015) 446e451

449

Fig. 1. Effect of 5-HTTLPR genotype and reserve index (RI) on brain perfusion in frontotemporal dementia patients. (A) Main effect of 5-HTTLPR genotype, comparing long (L/L) versus short (S/S) carriers (L/L < S/S). Statistical threshold was set at p < 0.001 uncorrected for multiple comparisons, and voxel threshold was set at 200 voxels. Results are superimposed on a 2-dimensional (2D) anatomic brain template (MRIcron). Plot shows the mean regional cerebral blood flow values at the more significant cluster (x, y, z ¼ 32, 46, 36) in the 3 groups (L/L, L/S, S/S). (B) Main effect of RI. Statistical threshold was set at p < 0.001 uncorrected for multiple comparisons, and voxel threshold was set at 40 voxels. Results are superimposed on a 2D anatomic brain template (MRIcron). Abbreviations: L, left; R, right.

temporal regions, compared with RI group (Table 2, Fig. 1B). The inverse relationship did not show any cluster above the preestablished threshold. Finally, the interaction between 5-HTTLPR and RI was tested. In FTD patients with favorable genetic background and high CR (LL/ RIþ, n ¼ 12), greater brain damage in frontal lobes bilaterally was detected than in patients with unfavorable genetic background and low CR (SS/RI, n ¼ 10) (Table 2, Fig. 2). In Fig. 2, the additive effect between 5-HTTLPR and RI is reported, and greater damage than considering the 2 variables separately is shown. The inverse relationship did not show any voxel above the preestablished threshold.

4. Discussion FTD is a neuropathologic heterogeneous disorder commonly defined by frontal and temporal brain damage. Although the molecular bases of FTD subtypes are still unpredictable during disease course, an impairment of 5-HT neurotransmission as key in FTD symptomatology has been demonstrated (Bowen et al., 2008; Canli and Lesch, 2007; Huey et al., 2006). In brains of individuals with FTD, a reduction of 5-HT1 has been consistently found (Bowen et al., 2008; Lanctot et al., 2007) and impairment of serotoninergic projections from the raphe nuclei to the prefrontal cortex (Wilson and Molliver, 1991). Neuroimaging findings have accomplished autopsy

Fig. 2. Interaction between 5-HTTLPR genotype and cognitive reserve (as measured by reserve index [RI]) in frontotemporal dementia patients. (A) Long (LL)/RIþ
450

E. Premi et al. / Neurobiology of Aging 36 (2015) 446e451

studies demonstrating a reduction of 5-HT-2A receptors in the frontal lobes of FTD patients (Franceschi et al., 2005). In the present study, we explored the role of 5-HT pathway in FTD by considering the functional 5-HTTLPR L/S polymorphism in modulating the regional brain perfusion. We demonstrated a significant effect on frontal brain perfusion by 5-HTTLPR genetic variation and the L/L carriers having greater brain damage at comparable disease stage. To effectively evaluate the effect of 5HTTLPR polymorphism, not only we considered age, gender, and clinical phenotype as possible confounders but also in the analyses we introduced disease severity (as measured with FTDmodified CDR) as covariate correction. Given this, we can conclude that patients carrying the L allele better compensate the disease onset and progression, showing greater brain damage but comparable severity of disease; notably, the protective effect of L allele was intermediate in heterozygous and higher in homozygous carriers (Fig. 1). Brain reserve hypothesis was also confirmed as depending on RI, as already reported (Fig. 1), and an addictive effect of 5-HT and education was clearly demonstrated (Fig. 2). The functional role of 5-HTTLPR polymorphism in driving 5-HT availability has been consistently documented, S/S genotype being associated with a reduction in intraneural 5-HT, because of an altered function of the serotonin reuptake (Kim et al., 2005). Additionally, in healthy subjects, 5-HTTLPR polymorphism might affect perfusion of amygdala and prefrontal brain regions (El-Hage et al., 2013; Rao et al., 2007; Viviani et al., 2010). According to this, it has been demonstrated that S/S carriers had reduced prefrontal inhibitory regulation when social emotional behavior needs to be controlled (Volman et al., 2013) and had abnormalities of amygdala-prefrontal cortex connectivity (Fang et al., 2013), compared with L/L carriers. We might conclude that brain reserve associated with L/L genotype may be because of the larger amount of available 5-HT and a more efficient modulation of remaining corticocortical projections. Accordingly, 5-HT1A receptor and 5-HT are expressed in the cortical layers II and III and in the von Economo neurons, both strongly and early involved in FTD neuropathology (Brettschneider et al., 2014; Kim et al., 2012; Seltman and Matthews, 2012). Intriguingly, in FTD, the 5-HT1A receptor loss was more evident in the Broadmann area 9 (Bowen et al., 2008), the same brain region we found to be associated with 5-HTTLPR brain reserve. Finally, testing the combined effect of 5-HTTLPR and CR, we demonstrated an addictive effect of the 2 variables, with greater involvement of frontal regions. This observation argues for different modulating targets able to affect FTD onset and progression. Indeed, if educational and occupational attainment cannot be modified in adulthood, pharmacologic intervention on 5-HT metabolism may represent an appealing target to improve brain reserve in FTD. This is in line with the few available study on the efficacy of SSRI treatment on behavioral and cognitive symptoms in FTD (Herrmann et al., 2012; Mendez, 2009), and this issue would warrant further exploration in larger sample of patients (Bigni et al., 2012). Some limitations have to be considered in our work. First of all, we studied a large FTD cohort with unknown neuropathology, and we cannot exclude that 5-HTTLPR modulation may be restricted to some pathology subgroups. Second, we do not have a biochemical or cerebrospinal fluid measure of serotonergic activity in the different 5-HTTLPR genotypes. In conclusion, our findings claim for serotonin modulation on FTD onset and progression; unraveling the factors that modulate FTD represents a promising research field for a condition still orphan of any evidence-based approach.

Disclosure statement The authors have no actual or potential conflicts of interest.

References Amieva, H., Mokri, H., Le Goff, M., Meillon, C., Jacqmin-Gadda, H., Foubert-Samier, A., Orgogozo, J.M., Stern, Y., Dartigues, J.F., 2014. Compensatory mechanisms in higher-educated subjects with Alzheimer’s disease: a study of 20 years of cognitive decline. Brain 137(Pt 4), 1167e1175. Bigni, B., Premi, E., Pilotto, A., Padovani, A., Borroni, B., 2012. Disease-modifying therapies in frontotemporal lobar degeneration. Curr. Med. Chem. 19, 1008e1020. Borroni, B., Agosti, C., Premi, E., Cerini, C., Cosseddu, M., Paghera, B., Bellelli, G., Padovani, A., 2010. The FTLD-modified Clinical Dementia Rating scale is a reliable tool for defining disease severity in frontotemporal lobar degeneration: evidence from a brain SPECT study. Eur. J. Neurol. 17, 703e707. Borroni, B., Brambati, S.M., Agosti, C., Gipponi, S., Bellelli, G., Gasparotti, R., Garibotto, V., Di Luca, M., Scifo, P., Perani, D., Padovani, A., 2007. Evidence of white matter changes on diffusion tensor imaging in frontotemporal dementia. Arch. Neurol. 64, 246e251. Borroni, B., Premi, E., Agosti, C., Alberici, A., Garibotto, V., Bellelli, G., Paghera, B., Lucchini, S., Giubbini, R., Perani, D., Padovani, A., 2009. Revisiting brain reserve hypothesis in frontotemporal dementia: evidence from a brain perfusion study. Demen. Geriatr. Cogn. Disord. 28, 130e135. Bowen, D.M., Procter, A.W., Mann, D.M., Snowden, J.S., Esiri, M.M., Neary, D., Francis, P.T., 2008. Imbalance of a serotonergic system in frontotemporal dementia: implication for pharmacotherapy. Psychopharmacology 196, 603e610. Brettschneider, J., Del Tredici, K., Irwin, D.J., Grossman, M., Robinson, J.L., Toledo, J.B., Fang, L., Van Deerlin, V.M., Ludolph, A.C., Lee, V.M., Braak, H., Trojanowski, J.Q., 2014. Sequential distribution of pTDP-43 pathology in behavioral variant frontotemporal dementia (bvFTD). Acta Neuropathol. 127, 423e439. Canli, T., Lesch, K.P., 2007. Long story short: the serotonin transporter in emotion regulation and social cognition. Nat. Neurosci. 10, 1103e1109. El-Hage, W., Zelaya, F., Radua, J., Gohier, B., Alsop, D.C., Phillips, M.L., Surguladze, S.A., 2013. Resting-state cerebral blood flow in amygdala is modulated by sex and serotonin transporter genotype. Neuroimage 76, 90e97. Engelborghs, S., Vloeberghs, E., Maertens, K., Marescau, B., De Deyn, P.P., 2004. Evidence for an association between the CSF HVA:5-HIAA ratio and aggressiveness in frontotemporal dementia but not in Alzheimer’s disease. J. Neurol. Neurosurg. Psychiatry 75, 1080. Fang, Z., Zhu, S., Gillihan, S.J., Korczykowski, M., Detre, J.A., Rao, H., 2013. Serotonin transporter genotype modulates functional connectivity between amygdala and PCC/PCu during mood recovery. Front. Hum. Neurosci. 7, 704. Franceschi, M., Anchisi, D., Pelati, O., Zuffi, M., Matarrese, M., Moresco, R.M., Fazio, F., Perani, D., 2005. Glucose metabolism and serotonin receptors in the frontotemporal lobe degeneration. Ann. Neurol. 57, 216e225. Garibotto, V., Borroni, B., Kalbe, E., Herholz, K., Salmon, E., Holtoff, V., Sorbi, S., Cappa, S.F., Padovani, A., Fazio, F., Perani, D., 2008. Education and occupation as proxies for reserve in aMCI converters and AD: FDG-PET evidence. Neurology 71, 1342e1349. Gorno-Tempini, M.L., Hillis, A.E., Weintraub, S., Kertesz, A., Mendez, M., Cappa, S.F., Ogar, J.M., Rohrer, J.D., Black, S., Boeve, B.F., Manes, F., Dronkers, N.F., Vandenberghe, R., Rascovsky, K., Patterson, K., Miller, B.L., Knopman, D.S., Hodges, J.R., Mesulam, M.M., Grossman, M., 2011. Classification of primary progressive aphasia and its variants. Neurology 76, 1006e1014. Greenberg, B.D., Tolliver, T.J., Huang, S.J., Li, Q., Bengel, D., Murphy, D.L., 1999. Genetic variation in the serotonin transporter promoter region affects serotonin uptake in human blood platelets. Am. J. Med. Genet. 88, 83e87. Hariri, A.R., Drabant, E.M., Weinberger, D.R., 2006. Imaging genetics: perspectives from studies of genetically driven variation in serotonin function and corticolimbic affective processing. Biol. Psychiatry 59, 888e897. Heils, A., Teufel, A., Petri, S., Stober, G., Riederer, P., Bengel, D., Lesch, K.P., 1996. Allelic variation of human serotonin transporter gene expression. J. Neurochem. 66, 2621e2624. Herrmann, N., Black, S.E., Chow, T., Cappell, J., Tang-Wai, D.F., Lanctot, K.L., 2012. Serotonergic function and treatment of behavioral and psychological symptoms of frontotemporal dementia. Am. J. Geriatr. Psychiatry 20, 789e797. Huey, E.D., Putnam, K.T., Grafman, J., 2006. A systematic review of neurotransmitter deficits and treatments in frontotemporal dementia. Neurology 66, 17e22. Kertesz, A., McMonagle, P., Blair, M., Davidson, W., Munoz, D.G., 2005. The evolution and pathology of frontotemporal dementia. Brain 128 (Pt 9), 1996e2005. Kim, D.K., Tolliver, T.J., Huang, S.J., Martin, B.J., Andrews, A.M., Wichems, C., Holmes, A., Lesch, K.P., Murphy, D.L., 2005. Altered serotonin synthesis, turnover and dynamic regulation in multiple brain regions of mice lacking the serotonin transporter. Neuropharmacology 49, 798e810. Kim, E.J., Sidhu, M., Gaus, S.E., Huang, E.J., Hof, P.R., Miller, B.L., DeArmond, S.J., Seeley, W.W., 2012. Selective frontoinsular von Economo neuron and fork cell loss in early behavioral variant frontotemporal dementia. Cereb. Cortex 22, 251e259. Knopman, D.S., Kramer, J.H., Boeve, B.F., Caselli, R.J., Graff-Radford, N.R., Mendez, M.F., Miller, B.L., Mercaldo, N., 2008. Development of methodology for

E. Premi et al. / Neurobiology of Aging 36 (2015) 446e451 conducting clinical trials in frontotemporal lobar degeneration. Brain 131 (Pt 11), 2957e2968. Lanctot, K.L., Herrmann, N., Ganjavi, H., Black, S.E., Rusjan, P.M., Houle, S., Wilson, A.A., 2007. Serotonin-1A receptors in frontotemporal dementia compared with controls. Psychiatry Res. 156, 247e250. Little, K.Y., McLaughlin, D.P., Zhang, L., Livermore, C.S., Dalack, G.W., McFinton, P.R., DelProposto, Z.S., Hill, E., Cassin, B.J., Watson, S.J., Cook, E.H., 1998. Cocaine, ethanol, and genotype effects on human midbrain serotonin transporter binding sites and mRNA levels. Am. J. Psychiatry 155, 207e213. Mendez, M.F., 2009. Frontotemporal dementia: therapeutic interventions. Front. Neurol. Neurosci. 24, 168e178. Neary, D., Snowden, J.S., Gustafson, L., Passant, U., Stuss, D., Black, S., Freedman, M., Kertesz, A., Robert, P.H., Albert, M., Boone, K., Miller, B.L., Cummings, J., Benson, D.F., 1998. Frontotemporal lobar degeneration: a consensus on clinical diagnostic criteria. Neurology 51, 1546e1554. Perneczky, R., Diehl-Schmid, J., Drzezga, A., Kurz, A., 2007. Brain reserve capacity in frontotemporal dementia: a voxel-based 18F-FDG PET study. Eur. J. Nucl. Med. Mol. Imaging 34, 1082e1087. Premi, E., Garibotto, V., Alberici, A., Paghera, B., Giubbini, R., Padovani, A., Borroni, B., 2012. Nature versus nurture in frontotemporal lobar degeneration: the interaction of genetic background and education on brain damage. Demen. Geriatr. Cogn. Disord. 33, 372e378. Premi, E., Garibotto, V., Gazzina, S., Grassi, M., Cosseddu, M., Paghera, B., Turla, M., Padovani, A., Borroni, B., 2013a. Beyond cognitive reserve: behavioural reserve hypothesis in frontotemporal dementia. Behav. Brain Res. 245, 58e62. Premi, E., Gazzina, S., Bozzali, M., Archetti, S., Alberici, A., Cercignani, M., Bianchetti, A., Gasparotti, R., Turla, M., Caltagirone, C., Padovani, A., Borroni, B., 2013b. Cognitive reserve in granulin-related frontotemporal dementia: from preclinical to clinical stages. PLoS One 8, e74762. Pressman, P.S., Miller, B.L., 2014. Diagnosis and management of behavioral variant frontotemporal dementia. Biol. Psychiatry 75, 574e581. Rao, H., Gillihan, S.J., Wang, J., Korczykowski, M., Sankoorikal, G.M., Kaercher, K.A., Brodkin, E.S., Detre, J.A., Farah, M.J., 2007. Genetic variation in serotonin transporter alters resting brain function in healthy individuals. Biol. Psychiatry 62, 600e606. Rascovsky, K., Hodges, J.R., Knopman, D., Mendez, M.F., Kramer, J.H., Neuhaus, J., van Swieten, J.C., Seelaar, H., Dopper, E.G., Onyike, C.U., Hillis, A.E., Josephs, K.A., Boeve, B.F., Kertesz, A., Seeley, W.W., Rankin, K.P., Johnson, J.K., GornoTempini, M.L., Rosen, H., Prioleau-Latham, C.E., Lee, A., Kipps, C.M., Lillo, P.,

451

Piguet, O., Rohrer, J.D., Rossor, M.N., Warren, J.D., Fox, N.C., Galasko, D., Salmon, D.P., Black, S.E., Mesulam, M., Weintraub, S., Dickerson, B.C., DiehlSchmid, J., Pasquier, F., Deramecourt, V., Lebert, F., Pijnenburg, Y., Chow, T.W., Manes, F., Grafman, J., Cappa, S.F., Freedman, M., Grossman, M., Miller, B.L., 2011. Sensitivity of revised diagnostic criteria for the behavioural variant of frontotemporal dementia. Brain 134 (Pt 9), 2456e2477. Seelaar, H., Rohrer, J.D., Pijnenburg, Y.A., Fox, N.C., van Swieten, J.C., 2011. Clinical, genetic and pathological heterogeneity of frontotemporal dementia: a review. J. Neurol. Neurosurg. Psychiatry 82, 476e486. Seltman, R.E., Matthews, B.R., 2012. Frontotemporal lobar degeneration: epidemiology, pathology, diagnosis and management. CNS drugs 26, 841e870. Shioe, K., Ichimiya, T., Suhara, T., Takano, A., Sudo, Y., Yasuno, F., Hirano, M., Shinohara, M., Kagami, M., Okubo, Y., Nankai, M., Kanba, S., 2003. No association between genotype of the promoter region of serotonin transporter gene and serotonin transporter binding in human brain measured by PET. Synapse 48, 184e188. Singh, Y.S., Altieri, S.C., Gilman, T.L., Michael, H.M., Tomlinson, I.D., Rosenthal, S.J., Swain, G.M., Murphey-Corb, M.A., Ferrell, R.E., Andrews, A.M., 2012. Differential serotonin transport is linked to the rh5-HTTLPR in peripheral blood cells. Transl. Psychiatry 2, e77. Sparks, D.L., Markesbery, W.R., 1991. Altered serotonergic and cholinergic synaptic markers in Pick’s disease. Arch. Neurol. 48, 796e799. Spreng, R.N., Drzezga, A., Diehl-Schmid, J., Kurz, A., Levine, B., Perneczky, R., 2011. Relationship between occupation attributes and brain metabolism in frontotemporal dementia. Neuropsychologia 49, 3699e3703. Viviani, R., Sim, E.J., Lo, H., Beschoner, P., Osterfeld, N., Maier, C., Seeringer, A., Godoy, A.L., Rosa, A., Comas, D., Kirchheiner, J., 2010. Baseline brain perfusion and the serotonin transporter promoter polymorphism. Biol. Psychiatry 67, 317e322. Volman, I., Verhagen, L., den Ouden, H.E., Fernandez, G., Rijpkema, M., Franke, B., Toni, I., Roelofs, K., 2013. Reduced serotonin transporter availability decreases prefrontal control of the amygdala. J. Neurosci. 33, 8974e8979. Wilson, M.A., Molliver, M.E., 1991. The organization of serotonergic projections to cerebral cortex in primates: retrograde transport studies. Neuroscience 44, 555e570. Yang, Y., Schmitt, H.P., 2001. Frontotemporal dementia: evidence for impairment of ascending serotoninergic but not noradrenergic innervation. Immunocytochemical and quantitative study using a graph method. Acta Neuropathol. 101, 256e270.