- Email: [email protected]
Functional interaction between amino-acid residues 242 and 290 in cytochromes P-450 2B1 and 2B11
Biochimica et Biophysica Acta 1338 Ž1997. 259–266
Functional interaction between amino-acid residues 242 and 290 in cytochromes P-450 2B1 and 2B11 Greg R. Harlow ) , You Ai He, James R. Halpert Department of Pharmacology and Toxicology, College of Pharmacy, UniÕersity of Arizona, Tucson, AZ 85721, USA Received 3 September 1996; accepted 12 November 1996
Abstract Previous studies have revealed the functional importance of the negatively charged amino-acid residue Asp-290 of the phenobarbital-inducible dog liver cytochrome P-450 Ž P-450. 2B11 ŽHarlow, G.R. and Halpert J.R. Ž1996. Arch. Biochem. Biophys. 326, 85–92.. A search for P-450 2B11 residues capable of forming a charge pair with Asp-290 suggested the positively charged residue Lys-242 as a likely candidate. Replacement of Lys-242 with Asp in a P-450 2B11 fusion protein with rat NADPH-cytochrome P-450 reductase Žreductase. resulted in very low holoenzyme expression levels in Escherichia coli, as did replacement of Asp-290 with Lys. Remarkably, however, expression levels of the double mutant Lys-242™ AsprAsp-290™ Lys were dramatically increased above either single replacement alone. Similarly, the pair-wise substitutions Lys-242™ LeurAsp-290™ Ile in P-450 2B11 and Leu-242™ LysrIle-290™ Asp in P-450 2B1 showed greater holoenzyme expression levels than the constituent single mutants, providing further evidence for the close proximity of these residues within the three-dimensional structure of these two enzymes. These results support the hypothesis that a functional interaction exists between residues 242 and 290, which may help to coordinate the relative positions of proposed helices G and I. All of the mutant combinations, including the additional P-450 2B11 double mutants Tyr-242rAsn-290 and Tyr-242rSer-290, displayed altered stereoselectivity of androstenedione hydroxylation. Keywords: Cytochrome P-450 mutant; Structure–function relationship; Expression; Ž E. coli .
1. Introduction The cytochrome P-450 superfamily comprises a large group of hemoproteins that are capable of me-
Abbreviations: P-450, cytochrome P-450; SRS, substrate recognition site; AD, androstenedione; CHAPS, 3-wŽ3-cholamidopropyl.dimethylammoniox-1-propanesulfonate; yOH, hydroxy; PCR, polymerase chain reaction; TLC, thin-layer chromatography; Reductase, NADPH-cytochrome P-450 reductase; Mops, 4-morpholinepropanesulfonic acid ) Corresponding author. Fax: q1 Ž520. 626-2466; E-mail: [email protected]
tabolizing a wide variety of both endogenous and exogenous compounds. Recent work in this laboratory has primarily focused on the structural basis of substrate specificity of various enzymes of the P-450 2B subfamily, including rat 2B1 w1–8x, rabbit 2B4 and 2B5 w9–11x, and the phenobarbital-inducible dog liver P-450 2B11 w10,12x. In previous studies, the replacement of Asp-290 in P-450 2B11 with Ile, which is the equivalent residue in rat P-450 2B1, altered the metabolism of androstenedione ŽAD., testosterone, 7-ethoxycoumarin, Ž R .- and Ž S .-warfarin, and 2,2X ,4,4X ,5,5X-hexachlorobiphenyl w12x. The lack of charge on these substrates suggested that Asp-290
0167-4838r97r$17.00 Copyright q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 8 3 8 Ž 9 6 . 0 0 2 0 9 - 9
260
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
may have a structural rather than direct catalytic role. It was subsequently shown that both the charge and size of residue 290 in P-450 2B11 have functional significance w13x. In that study, all eleven substitutions tested for Asp-290 in P-450 2B11 resulted in decreased enzyme activities. The replacement D290E yielded the highest activity Ž55% of wild-type. , while substituting the positively charged amino-acid Arg for Asp-290 created an enzyme with the lowest activity Ž- 1% of wild-type activity.. In the absence of an X-ray crystal structure for any mammalian P-450, computer-aided modeling of P450 2B1 w7,8x based on analogy with bacterial enzymes of known crystal structure, suggests that residue 290 of P-450 2B1 may be relatively buried inside the enzyme. The energetic cost of inserting a charged residue into a low dielectric environment is high, but inserting a salt bridge into a hydrophobic environment can be energetically much more favorable w14x. Mutagenesis studies of salt bridges buried within hydrophobic regions of other proteins have demonstrated that these types of interactions play a crucial role in determining protein conformation or folding dynamics w15–19x. However, the exact role of buried salt bridges is not certain and is a subject of current interest w20x. Residue-residue interactions can be very valuable in confirming enzyme structure predictions. Recent results with P-450 2C enzymes have demonstrated that certain residues in positions predicted by alignment with bacterial P-450s interact with each other w21x, thus validating a portion of the proposed P-450 2C three-dimensional structure. In the present study, heterologous expression of site-specifically mutated forms of dog P-450 2B11 and rat P-450 2B1 were used to study whether residue 242 forms a functional interaction with residue 290. Our analysis identifies a potential salt bridge between Asp-290 and Lys-242 in P-450 2B11, which apparently helps determine protein folding, protein stability, andror enzyme activesite characteristics.
Cloning Systems ŽLa Jolla, CA.. Taq DNA polymerase was obtained from Boehringer-Mannheim ŽIndianapolis, IN.. Growth media for Escherichia coli Ž E. coli . were from Difco ŽDetroit, MI.. Androstenedione, NADPH, d-aminolevulinic acid, and IPTG were purchased from Sigma Ž St. Louis, MO.. w4- 14 CxAndrostenedione was from DuPont-New England Nuclear ŽBoston, MA.. TLC plates were obtained from J.T. Baker ŽPhillipsburg, NJ.. Oligonucleotide primers were synthesized by the University of Arizona Macromolecular Structure Facility ŽTucson, AZ. . 2.2. Bacterial strains and heterologous expression The E. coli strain DH5 a was used for all transformations and plasmid preparations. Protein expression was carried out in the E. coli strain TOPP3 purchased from Stratagene Cloning Systems ŽLa Jolla, CA.. Bacterial growth conditions and preparation of solubilized E. coli membranes were as previously described w22x. 2.3. Mutagenesis of residue 242 of P-450 2B11 The plasmid pKK2B11fusion w13x containing an N-terminal modified P-450 2B11 fused to an Nterminal modified rat NADPH-P-450 reductase was used for all experiments involving P-450 2B11. Overlap extension w23x was used with the oligonucleotide primer pairs listed in Table 1 to generate the mutants K242D, K242L, K242F, and K242Y. Outside primers for overlap extension were the Nterminal modification primer w22x and a primer that hybridized to a 21 base-pair stretch 120 nucleotides downstream of the SacII recognition site. The amplified product was cut with StuI and SacII and used to replace the wild-type segment. The StuI-SacII regions of the resulting constructs were completely sequenced. 2.4. Mutagenesis of residue 242 of P-450 2B1
2. Materials and methods 2.1. Materials Restriction endonucleases were purchased from Gibco-BRL ŽGrand Island, NY. and Stratagene
The plasmid pKK2B1ŽGCT. w22x, containing an N-terminally modified P-450 2B1 cDNA, was used as template in an overlap extension reaction using the primers listed in Table 1. The outside primers were a plasmid primer upstream of the ATG start codon and
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
261
Table 1 Sequence of oligonucleotides used for site-directed changes at position 242 in P-450 2B1 or 2B11 P-450
a
2B11 K242D 2B11 K242L 2B11 K242FrY 2B1 L242K a b c
Mutagenic oligonucleotide Sense Antisense Sense Antisense Sense Antisense Sense Antisense
b
GGAAATCGACGCCTTC GAAGCCGTCCATTTCC TGCAGGAAATCCTAGCCTTCATTG CAATGAAGGCTAGGATTTCCTGCA TGCAGGAAATCTWTGCCTTCATTGc CAATGAAGGCAWAGATTTCCTGCAc CACGAAATCAAAGATTACATTGG AATGTAATCTTTGATTTCCTG
Codon change AAA ™ GAC AAA ™ CTA AAA ™ TAT or AAA ™ TTT CTC ™ AAA
Double-replacement mutants were constructed from the constituent, single mutants, as described in Section 2. Altered codons are indicated by underlining. Sequences are presented in 5X ™ 3X order. W s A or T.
a 20 base pair oligonucleotide that hybridized in the reverse orientation to the region of the cDNA that corresponds to amino acids 467–473. The resulting PCR product was digested with PstI and KpnI and used to replace the corresponding wild-type segment creating pKK2B1L242K. 2.5. Mutagenesis of residue 290 in P-450s 2B1 and 2B11 Mutations were introduced into pKK2B11fusion at amino-acid position 290 as described previously w13x. The P-450 2B1 I290D mutation was made with the Bio-Rad Muta-Gene In Vitro Mutagenesis Kit Ž Hercules, CA. using the single-stranded form of pBluescript II KS y Ž Stratagene. carrying the full-length P-450 2B1 cDNA as template and the oligonucleotide primer 5X-CCTCATGGACTCCCTGC-3X. A PstI-HindIII fragment from a plasmid clone containing the I290D mutation was used to replace the wild-type segment of pKK2B1ŽGCT. .
D290 mutants with the StuI-SacII regions of plasmids containing single 242 changes. 2.7. Enzymatic assays Ten pmol P-450 from CHAPS-solubilized membrane preparations was reconstituted with 40 pmol E. coli-expressed rat reductase w24x in 50 m l and assayed for 10 min in 100 m l 1 = Hepes buffer Ž50 mM Hepes, pH 7.6, 15 mM MgCl 2 , 0.1 mM EDTA. containing 25 m M w 14 Cxandrostenedione. Ten pmol cytochrome b5 was included when reconstituting P450 2B1. Reactions were started by addition of 1 mM NADPH and stopped with 50 m l tetrahydrofuran. Quantification of metabolites by TLC, autoradiography, and liquid scintillation were as described previously w22x.
3. Results 3.1. Substitution of Lys-242 with Asp in P-450 2B11
2.6. Construction of 242 r 290 double mutants The P-450 2B1 double mutant L242KrI290D was made by first deleting a pKK2B1I290D MscI site within the vector portion by digestion with PÕuII and NruI followed by vector self-ligation. The resulting plasmid, pKK2B1I290DD Msc, was cut at the Pst I, and single remaining MscI sites and the corresponding fragment from pKK2B1L242K was inserted. Double mutants of P-450 2B11 were created by replacing the StuI-SacII regions of pKK2B11fusion
It was previously noted w12x that the turnover number of the P-450 2B11 mutant D290I was greatly reduced for five substrates, except for production of a minor metabolite of testosterone. The absence of a positive charge on any of the substrates tested suggested that the negative charge on Asp-290 was not interacting directly with the substrate. Since the presence of a charge at residue 290 is unique to P-450 2B11 among the 2B subfamily of enzymes, a search was made for a unique positively charged amino acid
262
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
Fig. 1. Alignment of five portions of the P-450 2B11 protein sequence with other members of the P-450 2B subfamily. The P-450 2B11 sequence was matched to the 2B subfamily alignment previously described w25x. Residues corresponding to the unique positively charged amino acids 36, 221, 242, and 393 and the unique negative residue Asp-290 of P-450 2B11 are shown in bold type. Surrounding residues of the various P-450s are shown for reference.
in P-450 2B11 that might interact with Asp-290 to form an intramolecular charge pair. Fig. 1 lists four positively charged residues in P-450 2B11 that are not found in corresponding positions of any other members of the cytochrome P-450 2B subfamily Žusing the alignment of Korzekwa and Jones w25x.; those residues are Arg-74, His-221, Lys-242, and His-393. An analysis of a three-dimensional model of rat P-450 2B1 w7x, thought to be structurally very similar to P-450 2B11, indicated that only one of these four residues, amino acid 242, was predicted to be in a position close enough to allow interaction with residue 290. To test whether these two residues were involved in a charge pair, a charge swap experiment was performed in which the polarity of the pair was reversed by substituting Asp for Lys-242 and combining that change with either Asp or Lys at position 290. The holoenzyme expression level Ž Fig. 2. of the double mutant protein, K242DrD290K, as measured by reduced COrreduced difference spectra in sonicated whole cells, was much higher than either single mutant Žnondetectable for K242D or D290K.. Furthermore, large amounts of immunologically detectable P-450 could be detected in the single mutant cultures, suggesting an inability on the part of the single mutants K242D and D290K to incorporate or retain the heme ligand Ždata not shown.. 3.2. Construction of additional P-450 2B11 242 and 290 mutant combinations To test additional amino-acid pairs across residues 242 and 290, the residues found in P-450s 2B1 and 2B11 were exchanged, essentially swapping charged residue pairs for hydrophobic pairs. E. coli expression levels were measured for cultures expressing the single P-450 2B1 mutants L242K and I290D, and the
double mutant L242KrI290D along with the P-450 2B11 mutants K242L, D290I and K242LrD290I ŽTable 2.. Both of these double mutant combinations displayed spectrally detectable P-450 expression levels increased over the respective single mutants alone. These results suggest that unpaired charges at either position 242 or 290 prevent incorporation or retention of the heme ligand. Additional single and double mutant combinations were made to test whether hydrogen bonding pairs or alternate hydrophobic pairs could efficiently replace the LysrAsp
Fig. 2. Reduced CO-difference spectra of sonicated E. coli whole cell lysates of P-450 2B11 fusion wild-type and mutant enzymes. 5 ml cultures were grown from individual colonies of E. coli strains expressing wild-type ŽWT. enzyme, single mutant enzymes K242D and D290K, and the double mutant K242DrD290K. Cultures were grown as described in Section 2. The scans shown are representative of those obtained from five independent cultures of each P-450 2B11 fusion expressing strain. The average P-450 expression level was 138"18 nmolrl for the WT enzyme, and 37"16 nmolrl for the double mutant K242DrD290K. P-450 expression levels for strains expressing either single mutant enzyme were too low to be measured in whole cell lysates by reduced COrreduced difference spectra.
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
263
Table 2 Whole cell expression levels of selected wild type and site-directed mutants of P-450s 2B1 and 2B11 expressed in E. coli
3.3. Androstenedione hydroxylation (AD-OH) by double mutant combinations
P-450
Expression level Žnmolrl. a
2B1 WT 2B1 L242K 2B1 1290D 2B1 L242Kr1290D 2B11 WT 2B11 K242L 2B11 D290I 2B11 K242LrD2901
65 nd b nd 4 135 22 44 76
Table 3 lists the AD-OH activities of wild-type P-450 2B1 and P-450 2B11 enzymes and of various double mutant combinations. The P-450 2B11 double mutant K242DrD290K had only 21% of the wild-type enzyme activity but maintained the 16 bOH:16 a-OH ratio of the wild-type enzyme. The AD hydroxylase profiles of P-450s 2B1 and 2B11 could be approximately interconverted by introducing an ion pair L242KrI290D into P-450 2B1 and by changing the ion pair of P-450 2B11 to a hydrophobic pair K242LrD290I. When Met was substituted for Asp-290 instead of Ile to make the hydrophobic pair K242LrD290M the 16 b-OH:16 a-OH ratio more closely resembled the wild-type P-450 2B11 ratio. The potentially hydrogen bonded P-450 2B11 paired substitutions K242YrD290S and K242YrD290N had 16 b-OH:16 a-OH ratios Ž 2.0 and 7.5, respectively. intermediate between wild-type P-450s 2B11 and 2B1.
Each value is the mean of at least three independent experiments. a Whole cell expression levels were determined by reduced COdifference spectra using 5 ml cultures grown for 72 h as described previously w13x. b nd s not detectable. Expression levels too low to be measured in whole cell lysates by reduced COrreduced difference spectra.
charge pair of P-450 2B11. The holoenzyme expression levels of the potentially hydrogen bonded double mutants K242YrD290N and K242YrD290S and the hydrophobic double mutant K242LrD290M were better than the single K242 mutants but not significantly different from the respective single D290 replacements. No holoenzyme expression could be detected in cultures of the P-450 2B11 mutant K242F, even when put in combination with D290A, D290V, or D290I Ždata not shown..
4. Discussion The computer-predicted structure of P-450 2B1 w7x and a search for positively charged amino-acid residues unique to P-450 2B11 which might be
Table 3 Metabolism of androstenedione by solubilized membrane preparations of wild-type and site-directed mutants of P-450s 2B1 and 2B11 expressed in E. coli Double mutants a
2B11 WT K242DrD290K K242LrD290M K242YrD290S K242YrD290N K242LrD2901 2B1 WT a L242KrI290D
P-450 Žnmol productrmin per nmol.
% WT
16 b-OH-AD
16 a-OH-AD
total
activity
16 br16 a
1.3 0.3 0.9 0.6 0.3 1.0 5.0 0.4
1.1 0.2 0.6 0.3 0.04 0.1 0.5 0.5
2.4 0.5 1.5 0.9 0.3 1.1 5.5 0.9
100 21 63 38 13 46 100 16
1.2 1.5 1.5 2.0 7.5 10 10 0.8
Ten pmol P-450 2B11 fusion enzyme from CHAPS-solubilized membrane preparations was reconstituted with 40 pmol E. coli-expressed rat NADPH-cytochrome P-450 reductase in 50 m l and assayed for 10 min in 100 m l 1 = Hepes buffer Ž50 mM Hepes, pH 7.6, 15 mM MgCl 2 , 0.1 mM EDTA. containing 25 m M w 14 Cxandrostenedione. Assay conditions were the same for P-450 2B1 enzymes with the addition of 10 pmol cytochrome b5. a WT s wild-type. Values are the average of duplicate determinations.
264
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
interacting with the unique negatively charged Asp290 led us to the prediction that Lys-242 is interacting with Asp-290. The most direct approach to test this would have been to examine the crystal structures of wild-type and mutant enzymes and determine the structural consequences of site-directed changes at these positions, as was done for analysis of a salt bridge in bacterial chloramphenicol acetyltransferase w17x. Of course, the lack of a crystal structure for mammalian P-450’s made this type of analysis impossible. Without a crystal structure other researchers have been able to use the denaturants urea w26x or heat w15,27x to study the contributions of individual residues to protein stability. Our attempts to purify the various single mutant P-450 2B11fusion enzymes using n-octylamino-Sepharose w22x or Ž 2X ,5X-ADP. Sepharose 4B w13,28x were unsuccessful due to poor bacterial expression levels and possibly decreased enzyme stability. Heat stability studies using solubilized-membrane preparations were unreliable and appeared to be influenced strongly by the holoenzyme expression level of the bacterial culture Ždata not shown.. A study of the E. coli lactose permease charge pair Asp-237-Lys-358 w15x demonstrated that the polarity of the charge pair was not important for enzyme function. For example, Lys could substitute for Asp-237 and Asp could substitute for Lys-358 as long as the changes were made in tandem. Because the 2B11 D290K mutant had low expression levels and low enzymatic activity, a second mutation, 2B11 K242D was engineered, thereby forming a reciprocal charge swap to test whether polarity mattered in the case of P-450 2B11. The expression level of 2B11 K242DrD290K ŽFig. 2. was much improved over the expression levels of either single mutant and the 16 b-OHr16 a-OH AD ratio Ž Table 3. was similar to WT. It is likely that other amino acids in the region normally interact with these two residues by making additional contacts, since expression of the double mutant was not completely restored to the level of the wild-type construct. A study of known protein structures with buried ion pairs revealed that hydrogen bonding with surrounding residues often helps to stabilize the ion pair w31x. We have relied on bacterial expression levels, which others have shown is dependent upon features besides the N-terminal sequence w22,28–30x, as evi-
dence of residue-residue interaction. We believe that interpretation of our results based on expression levels are warranted for the following reasons. There is precedent for reduced expression levels as a result of disrupting a interacting charge pair; for example, when the charge pair of lactose permease protein was disrupted, low expression levels were noted w15x. In three separate double mutant experiments presented in this study, two in P-450 2B11 and one in P-450 2B1, the poorly expressing single mutants could be combined into better-expressing double mutant constructs. Our use of a P-450 2B11 fusion protein is an extension of previous work w13x but should not affect the interpretation of our results. Activity data could be misleading if the mutations in some way affected the ability of the P-450 to associate with NADPH-cytochrome P-450 reductase. However, we are not relying on activity data to prove whether there is evidence of residue-residue interaction. Enzymatic activity is not necessarily a good indicator of the stability of wild-type and mutant P-450 enzymes, especially if the residues are in or near the active site. For example, its easy to envision residue–residue interactions that are very favorable but which create an active site with lowered affinity for the substrate. Expression levels however, should not be affected by whether the P-450 can complex with reductase or not. Analysis of the androstenedione hydroxylase activity data Ž Table 3. for the various double mutant combinations demonstrates, through the 16 bOHr16 a-OH AD ratios, that stereoselectivity is affected and that altering these residues can affect the active-site geometry. It is interesting to note that exchanging the 242r290 residue pairs between P450s 2B1 and 2B11 essentially also exchanged the 16 b-OHr16 a-OH AD ratios as well Ž Table 3. . The proposed model of P-450 2B1 Ž7. suggests that both residues 242 and 290 help to form the substrate pocket. Residue 242 is predicted to help form the upper part of the substrate pocket that allows androstenedione to be held in the 16 b-binding orientation. Residue 290 is predicted to interact with the A-ring of androstenedione but only when the substrate is held in the 16 a-binding orientation. Our experimental results combined with the predictions from modeling suggest that residues 242 and 290
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
make residue-residue contacts as well as residue-substrate contacts. Whether changes in stereoselectivity are due to direct contact of residues 242 and 290 with the substrate or represent longer-range effects on the enzyme active site cannot be determined from our results. It does point out that caution is in order when using changes in stereoselectivity resulting from a residue substitution as evidence that the residue is near or contacting the substrate. According to the computer-generated P-450 2B1 molecular model w7x residues 242 and 290 are predicted to reside on helices G and I respectively. As such, these residues may help define the intersection of these helices. Interestingly, the crystal structure of P-450 BM-3 w32x reveals that residues Asp-217 on helix G and Arg-255 on helix I form a salt bridge. Analysis of the structure-based alignment of P-450 2B1 and P-450 BM-3 w7x reveals that residues 242 and 290 of P-450 2B1 align relatively closely with residues 217 and 255 of P-450 BM-3, respectively; although the polarity of the Asp-217rArg-255 charge pair in P-450 BM-3 is opposite to that of the proposed P-450 2B11 Lys-242rAsp-290 charge pair. The occurrence of oppositely charged residues in equivalent locations of P-450s 2B11 and BM-3 suggests a common function for a salt bridge in this position, namely, to coordinate the intersection of two helices. Ramarao et al. w21x have recently identified amino-acid residues, 368–374 and 386–388, within P-450 2C enzymes that interact functionally to determine enzyme structure. These residues are predicted to be on separate strands of the b 3 sheet. When not properly paired, as in the case of the chimeric enzyme between P-450 2C1 and P-450 2C2, the perturbation of this region led to the altered interaction of enzyme with substrate. In this study we have made a similar attempt to identify and characterize a specific residue–residue interaction within P-450s 2B1 and 2B11 that may influence enzyme tertiary structure. Identification of interacting residues in cytochromes P-450 for which there are no crystallographic data may prove to be a valuable tool for testing the validity of computer-aided three-dimensional homology models of P-450 enzymes and may ultimately provide important information about the structure–function relationships of cytochromes P450.
265
Acknowledgements We thank Dr. Grazyna Szklarz of the University of Arizona for assistance in locating probable positions of certain P-450 2B1 residues. This work was supported by grants from the National Institutes of Health ES04995 ŽJ.R.H.., Center Grant ES06694 ŽUniversity of Arizona., and Institutional Training Grant ES07091 ŽG.R.H...
References w1x Kedzie, K.M., Balfour, C.A., Escobar, G.Y., Grimm, S.W., He, Y.-A., Pepperl, D.J., Regan, J.W., Stevens, J.C. and Halpert, J.R. Ž1991. J. Biol. Chem. 266, 22515–22521. w2x He, Y.A., Balfour, C.A., Kedzie, K.M. and Halpert, J.R. Ž1992. Biochemistry 31, 9220–9226. w3x Halpert, J.R. and He, Y.A. Ž1993. J. Biol. Chem. 268, 4453–4457. w4x He, Y., Luo, Z., Klekotka, P.A., Burnett, V.L. and Halpert, J.R. Ž1994. Biochemistry 33, 4419–4424. w5x Luo, Z., He, Y. and Halpert, J.R. Ž1994. Arch. Biochem. Biophys. 309, 52–57. w6x He, Y.Q., He, Y.A. and Halpert, J.R. Ž1995. Chem. Res. Toxicol. 8, 574–579. w7x Szklarz, G.D., He, Y.A. and Halpert, J.R. Ž1995. Biochemistry 34, 14312–14322. w8x Szklarz, G.D., Ornstein, R.L. and Halpert, J.R. Ž1994. J. Biomol. Struct. Dyn. 12, 61–78. w9x Szklarz, G.D., He, Y.Q., Kedzie, K.M., Halpert, J.R. and Burnett, V.L. Ž1996. Arch. Biochem. Biophys. 327, 308– 318. w10x Liu, J., He, Y.A. and Halpert, J.R. Ž1996. Arch. Biochem. Biophys. 327, 167–173. w11x Kedzie, K.M., Grimm, S.W., Chen, F. and Halpert, J.R. Ž1993. Biochim. Biophys. Acta 1164, 124–132. w12x Hasler, J.A., Harlow, G.R., Szklarz, G.D., John, G.H., Kedzie, K.M., Burnett, V.L., He, Y.-A., Kaminsky, L.S. and Halpert, J.R. Ž1994. Mol. Pharmacol. 46, 338–345. w13x Harlow, G.R. and Halpert, J.R. Ž1996. Arch. Biochem. Biophys. 326, 85–92. w14x Honig, B.H. and Hubbell, W.L. Ž1984. Proc. Natl. Acad. Sci. USA 81, 5412–5416. w15x Dunten, R.L., Sahin-Toth, M. and Kaback, H.R. Ž1993. Biochemistry 32, 3139–3145. w16x Frillingos, S., Sahin-Toth, M., Lengeler, J.W. and Kaback, H.R. Ž1995. Biochemistry 34, 9368–9373. w17x Gibbs, M.R., Moody, P.C.E. and Leslie, A.G.W. Ž1990. Biochemistry 29, 11261–11265. w18x Lee, J.-I., Hwang, P.P., Hansen, C. and Wilson, T.H. Ž1992. J. Biol. Chem. 267, 20758–20764. w19x Sahin-Toth, M. and Kaback, H.R. Ž1993. Biochemistry 32, 10027–10035.
266
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
w20x Hendsch, Z.S. and Tidor, B. Ž1994. Protein Sci. 3, 211–226. w21x Ramarao, M.K., Straub, P. and Kemper, B. Ž1995. J. Biol. Chem. 270, 1873–1880. w22x John, G.H., Hasler, J.A., He, Y. and Halpert, J.R. Ž1994. Arch. Biochem. Biophys. 314, 367–375. w23x Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. Ž1989. Gene 77, 51–59. w24x Shen, A.L., Porter, T.D., Wilson, T.E. and Kasper, C.B. Ž1989. J. Biol. Chem. 264, 7584–7589. w25x Korzekwa, K.R. and Jones, J.P. Ž1993. Pharmacogenetics 3, 1–18. w26x Koshy, T.I., Luntz, T.L., Plotkin, B., Schejter, A. and Margoliash, E. Ž1994. Biochem. J. 299, 347–350.
w27x Lewendon, A., Murray, I.A., Kleanthous, C., Cullis, P.M. and Shaw, W.V. Ž1988. Biochemistry 27, 7385–7390. w28x Fisher, C.W., Shet, M.S., Caudle, D.L., Martin-Wixtrom, C.A. and Estabrook, R.W. Ž1992. Proc. Natl. Acad. Sci. USA 89, 10817–10821. w29x Barnes, H.J., Arlotto, M.P. and Waterman, M.R. Ž1991. Proc. Natl. Acad. Sci. USA 88, 5597–5601. w30x Gillam, E.M., Baba, T., Kim, B., Ohmori, S. and Guengerich, F.P. Ž1993. Arch. Biochem. Biophys. 305, 123–131. w31x Rashin, A. and Honig, B. Ž1984. J. Mol. Biol. 173, 515–521. w32x Ravichandran, K.G., Boddupalli, S.S., Hasemann, C.A., Peterson, J.A. and Deisenhofer, J. Ž1993. Science 261, 731– 736.
Functional interaction between amino-acid residues 242 and 290 in cytochromes P-450 2B1 and 2B11 Greg R. Harlow ) , You Ai He, James R. Halpert Department of Pharmacology and Toxicology, College of Pharmacy, UniÕersity of Arizona, Tucson, AZ 85721, USA Received 3 September 1996; accepted 12 November 1996
Abstract Previous studies have revealed the functional importance of the negatively charged amino-acid residue Asp-290 of the phenobarbital-inducible dog liver cytochrome P-450 Ž P-450. 2B11 ŽHarlow, G.R. and Halpert J.R. Ž1996. Arch. Biochem. Biophys. 326, 85–92.. A search for P-450 2B11 residues capable of forming a charge pair with Asp-290 suggested the positively charged residue Lys-242 as a likely candidate. Replacement of Lys-242 with Asp in a P-450 2B11 fusion protein with rat NADPH-cytochrome P-450 reductase Žreductase. resulted in very low holoenzyme expression levels in Escherichia coli, as did replacement of Asp-290 with Lys. Remarkably, however, expression levels of the double mutant Lys-242™ AsprAsp-290™ Lys were dramatically increased above either single replacement alone. Similarly, the pair-wise substitutions Lys-242™ LeurAsp-290™ Ile in P-450 2B11 and Leu-242™ LysrIle-290™ Asp in P-450 2B1 showed greater holoenzyme expression levels than the constituent single mutants, providing further evidence for the close proximity of these residues within the three-dimensional structure of these two enzymes. These results support the hypothesis that a functional interaction exists between residues 242 and 290, which may help to coordinate the relative positions of proposed helices G and I. All of the mutant combinations, including the additional P-450 2B11 double mutants Tyr-242rAsn-290 and Tyr-242rSer-290, displayed altered stereoselectivity of androstenedione hydroxylation. Keywords: Cytochrome P-450 mutant; Structure–function relationship; Expression; Ž E. coli .
1. Introduction The cytochrome P-450 superfamily comprises a large group of hemoproteins that are capable of me-
Abbreviations: P-450, cytochrome P-450; SRS, substrate recognition site; AD, androstenedione; CHAPS, 3-wŽ3-cholamidopropyl.dimethylammoniox-1-propanesulfonate; yOH, hydroxy; PCR, polymerase chain reaction; TLC, thin-layer chromatography; Reductase, NADPH-cytochrome P-450 reductase; Mops, 4-morpholinepropanesulfonic acid ) Corresponding author. Fax: q1 Ž520. 626-2466; E-mail: [email protected]
tabolizing a wide variety of both endogenous and exogenous compounds. Recent work in this laboratory has primarily focused on the structural basis of substrate specificity of various enzymes of the P-450 2B subfamily, including rat 2B1 w1–8x, rabbit 2B4 and 2B5 w9–11x, and the phenobarbital-inducible dog liver P-450 2B11 w10,12x. In previous studies, the replacement of Asp-290 in P-450 2B11 with Ile, which is the equivalent residue in rat P-450 2B1, altered the metabolism of androstenedione ŽAD., testosterone, 7-ethoxycoumarin, Ž R .- and Ž S .-warfarin, and 2,2X ,4,4X ,5,5X-hexachlorobiphenyl w12x. The lack of charge on these substrates suggested that Asp-290
0167-4838r97r$17.00 Copyright q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 8 3 8 Ž 9 6 . 0 0 2 0 9 - 9
260
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
may have a structural rather than direct catalytic role. It was subsequently shown that both the charge and size of residue 290 in P-450 2B11 have functional significance w13x. In that study, all eleven substitutions tested for Asp-290 in P-450 2B11 resulted in decreased enzyme activities. The replacement D290E yielded the highest activity Ž55% of wild-type. , while substituting the positively charged amino-acid Arg for Asp-290 created an enzyme with the lowest activity Ž- 1% of wild-type activity.. In the absence of an X-ray crystal structure for any mammalian P-450, computer-aided modeling of P450 2B1 w7,8x based on analogy with bacterial enzymes of known crystal structure, suggests that residue 290 of P-450 2B1 may be relatively buried inside the enzyme. The energetic cost of inserting a charged residue into a low dielectric environment is high, but inserting a salt bridge into a hydrophobic environment can be energetically much more favorable w14x. Mutagenesis studies of salt bridges buried within hydrophobic regions of other proteins have demonstrated that these types of interactions play a crucial role in determining protein conformation or folding dynamics w15–19x. However, the exact role of buried salt bridges is not certain and is a subject of current interest w20x. Residue-residue interactions can be very valuable in confirming enzyme structure predictions. Recent results with P-450 2C enzymes have demonstrated that certain residues in positions predicted by alignment with bacterial P-450s interact with each other w21x, thus validating a portion of the proposed P-450 2C three-dimensional structure. In the present study, heterologous expression of site-specifically mutated forms of dog P-450 2B11 and rat P-450 2B1 were used to study whether residue 242 forms a functional interaction with residue 290. Our analysis identifies a potential salt bridge between Asp-290 and Lys-242 in P-450 2B11, which apparently helps determine protein folding, protein stability, andror enzyme activesite characteristics.
Cloning Systems ŽLa Jolla, CA.. Taq DNA polymerase was obtained from Boehringer-Mannheim ŽIndianapolis, IN.. Growth media for Escherichia coli Ž E. coli . were from Difco ŽDetroit, MI.. Androstenedione, NADPH, d-aminolevulinic acid, and IPTG were purchased from Sigma Ž St. Louis, MO.. w4- 14 CxAndrostenedione was from DuPont-New England Nuclear ŽBoston, MA.. TLC plates were obtained from J.T. Baker ŽPhillipsburg, NJ.. Oligonucleotide primers were synthesized by the University of Arizona Macromolecular Structure Facility ŽTucson, AZ. . 2.2. Bacterial strains and heterologous expression The E. coli strain DH5 a was used for all transformations and plasmid preparations. Protein expression was carried out in the E. coli strain TOPP3 purchased from Stratagene Cloning Systems ŽLa Jolla, CA.. Bacterial growth conditions and preparation of solubilized E. coli membranes were as previously described w22x. 2.3. Mutagenesis of residue 242 of P-450 2B11 The plasmid pKK2B11fusion w13x containing an N-terminal modified P-450 2B11 fused to an Nterminal modified rat NADPH-P-450 reductase was used for all experiments involving P-450 2B11. Overlap extension w23x was used with the oligonucleotide primer pairs listed in Table 1 to generate the mutants K242D, K242L, K242F, and K242Y. Outside primers for overlap extension were the Nterminal modification primer w22x and a primer that hybridized to a 21 base-pair stretch 120 nucleotides downstream of the SacII recognition site. The amplified product was cut with StuI and SacII and used to replace the wild-type segment. The StuI-SacII regions of the resulting constructs were completely sequenced. 2.4. Mutagenesis of residue 242 of P-450 2B1
2. Materials and methods 2.1. Materials Restriction endonucleases were purchased from Gibco-BRL ŽGrand Island, NY. and Stratagene
The plasmid pKK2B1ŽGCT. w22x, containing an N-terminally modified P-450 2B1 cDNA, was used as template in an overlap extension reaction using the primers listed in Table 1. The outside primers were a plasmid primer upstream of the ATG start codon and
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
261
Table 1 Sequence of oligonucleotides used for site-directed changes at position 242 in P-450 2B1 or 2B11 P-450
a
2B11 K242D 2B11 K242L 2B11 K242FrY 2B1 L242K a b c
Mutagenic oligonucleotide Sense Antisense Sense Antisense Sense Antisense Sense Antisense
b
GGAAATCGACGCCTTC GAAGCCGTCCATTTCC TGCAGGAAATCCTAGCCTTCATTG CAATGAAGGCTAGGATTTCCTGCA TGCAGGAAATCTWTGCCTTCATTGc CAATGAAGGCAWAGATTTCCTGCAc CACGAAATCAAAGATTACATTGG AATGTAATCTTTGATTTCCTG
Codon change AAA ™ GAC AAA ™ CTA AAA ™ TAT or AAA ™ TTT CTC ™ AAA
Double-replacement mutants were constructed from the constituent, single mutants, as described in Section 2. Altered codons are indicated by underlining. Sequences are presented in 5X ™ 3X order. W s A or T.
a 20 base pair oligonucleotide that hybridized in the reverse orientation to the region of the cDNA that corresponds to amino acids 467–473. The resulting PCR product was digested with PstI and KpnI and used to replace the corresponding wild-type segment creating pKK2B1L242K. 2.5. Mutagenesis of residue 290 in P-450s 2B1 and 2B11 Mutations were introduced into pKK2B11fusion at amino-acid position 290 as described previously w13x. The P-450 2B1 I290D mutation was made with the Bio-Rad Muta-Gene In Vitro Mutagenesis Kit Ž Hercules, CA. using the single-stranded form of pBluescript II KS y Ž Stratagene. carrying the full-length P-450 2B1 cDNA as template and the oligonucleotide primer 5X-CCTCATGGACTCCCTGC-3X. A PstI-HindIII fragment from a plasmid clone containing the I290D mutation was used to replace the wild-type segment of pKK2B1ŽGCT. .
D290 mutants with the StuI-SacII regions of plasmids containing single 242 changes. 2.7. Enzymatic assays Ten pmol P-450 from CHAPS-solubilized membrane preparations was reconstituted with 40 pmol E. coli-expressed rat reductase w24x in 50 m l and assayed for 10 min in 100 m l 1 = Hepes buffer Ž50 mM Hepes, pH 7.6, 15 mM MgCl 2 , 0.1 mM EDTA. containing 25 m M w 14 Cxandrostenedione. Ten pmol cytochrome b5 was included when reconstituting P450 2B1. Reactions were started by addition of 1 mM NADPH and stopped with 50 m l tetrahydrofuran. Quantification of metabolites by TLC, autoradiography, and liquid scintillation were as described previously w22x.
3. Results 3.1. Substitution of Lys-242 with Asp in P-450 2B11
2.6. Construction of 242 r 290 double mutants The P-450 2B1 double mutant L242KrI290D was made by first deleting a pKK2B1I290D MscI site within the vector portion by digestion with PÕuII and NruI followed by vector self-ligation. The resulting plasmid, pKK2B1I290DD Msc, was cut at the Pst I, and single remaining MscI sites and the corresponding fragment from pKK2B1L242K was inserted. Double mutants of P-450 2B11 were created by replacing the StuI-SacII regions of pKK2B11fusion
It was previously noted w12x that the turnover number of the P-450 2B11 mutant D290I was greatly reduced for five substrates, except for production of a minor metabolite of testosterone. The absence of a positive charge on any of the substrates tested suggested that the negative charge on Asp-290 was not interacting directly with the substrate. Since the presence of a charge at residue 290 is unique to P-450 2B11 among the 2B subfamily of enzymes, a search was made for a unique positively charged amino acid
262
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
Fig. 1. Alignment of five portions of the P-450 2B11 protein sequence with other members of the P-450 2B subfamily. The P-450 2B11 sequence was matched to the 2B subfamily alignment previously described w25x. Residues corresponding to the unique positively charged amino acids 36, 221, 242, and 393 and the unique negative residue Asp-290 of P-450 2B11 are shown in bold type. Surrounding residues of the various P-450s are shown for reference.
in P-450 2B11 that might interact with Asp-290 to form an intramolecular charge pair. Fig. 1 lists four positively charged residues in P-450 2B11 that are not found in corresponding positions of any other members of the cytochrome P-450 2B subfamily Žusing the alignment of Korzekwa and Jones w25x.; those residues are Arg-74, His-221, Lys-242, and His-393. An analysis of a three-dimensional model of rat P-450 2B1 w7x, thought to be structurally very similar to P-450 2B11, indicated that only one of these four residues, amino acid 242, was predicted to be in a position close enough to allow interaction with residue 290. To test whether these two residues were involved in a charge pair, a charge swap experiment was performed in which the polarity of the pair was reversed by substituting Asp for Lys-242 and combining that change with either Asp or Lys at position 290. The holoenzyme expression level Ž Fig. 2. of the double mutant protein, K242DrD290K, as measured by reduced COrreduced difference spectra in sonicated whole cells, was much higher than either single mutant Žnondetectable for K242D or D290K.. Furthermore, large amounts of immunologically detectable P-450 could be detected in the single mutant cultures, suggesting an inability on the part of the single mutants K242D and D290K to incorporate or retain the heme ligand Ždata not shown.. 3.2. Construction of additional P-450 2B11 242 and 290 mutant combinations To test additional amino-acid pairs across residues 242 and 290, the residues found in P-450s 2B1 and 2B11 were exchanged, essentially swapping charged residue pairs for hydrophobic pairs. E. coli expression levels were measured for cultures expressing the single P-450 2B1 mutants L242K and I290D, and the
double mutant L242KrI290D along with the P-450 2B11 mutants K242L, D290I and K242LrD290I ŽTable 2.. Both of these double mutant combinations displayed spectrally detectable P-450 expression levels increased over the respective single mutants alone. These results suggest that unpaired charges at either position 242 or 290 prevent incorporation or retention of the heme ligand. Additional single and double mutant combinations were made to test whether hydrogen bonding pairs or alternate hydrophobic pairs could efficiently replace the LysrAsp
Fig. 2. Reduced CO-difference spectra of sonicated E. coli whole cell lysates of P-450 2B11 fusion wild-type and mutant enzymes. 5 ml cultures were grown from individual colonies of E. coli strains expressing wild-type ŽWT. enzyme, single mutant enzymes K242D and D290K, and the double mutant K242DrD290K. Cultures were grown as described in Section 2. The scans shown are representative of those obtained from five independent cultures of each P-450 2B11 fusion expressing strain. The average P-450 expression level was 138"18 nmolrl for the WT enzyme, and 37"16 nmolrl for the double mutant K242DrD290K. P-450 expression levels for strains expressing either single mutant enzyme were too low to be measured in whole cell lysates by reduced COrreduced difference spectra.
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
263
Table 2 Whole cell expression levels of selected wild type and site-directed mutants of P-450s 2B1 and 2B11 expressed in E. coli
3.3. Androstenedione hydroxylation (AD-OH) by double mutant combinations
P-450
Expression level Žnmolrl. a
2B1 WT 2B1 L242K 2B1 1290D 2B1 L242Kr1290D 2B11 WT 2B11 K242L 2B11 D290I 2B11 K242LrD2901
65 nd b nd 4 135 22 44 76
Table 3 lists the AD-OH activities of wild-type P-450 2B1 and P-450 2B11 enzymes and of various double mutant combinations. The P-450 2B11 double mutant K242DrD290K had only 21% of the wild-type enzyme activity but maintained the 16 bOH:16 a-OH ratio of the wild-type enzyme. The AD hydroxylase profiles of P-450s 2B1 and 2B11 could be approximately interconverted by introducing an ion pair L242KrI290D into P-450 2B1 and by changing the ion pair of P-450 2B11 to a hydrophobic pair K242LrD290I. When Met was substituted for Asp-290 instead of Ile to make the hydrophobic pair K242LrD290M the 16 b-OH:16 a-OH ratio more closely resembled the wild-type P-450 2B11 ratio. The potentially hydrogen bonded P-450 2B11 paired substitutions K242YrD290S and K242YrD290N had 16 b-OH:16 a-OH ratios Ž 2.0 and 7.5, respectively. intermediate between wild-type P-450s 2B11 and 2B1.
Each value is the mean of at least three independent experiments. a Whole cell expression levels were determined by reduced COdifference spectra using 5 ml cultures grown for 72 h as described previously w13x. b nd s not detectable. Expression levels too low to be measured in whole cell lysates by reduced COrreduced difference spectra.
charge pair of P-450 2B11. The holoenzyme expression levels of the potentially hydrogen bonded double mutants K242YrD290N and K242YrD290S and the hydrophobic double mutant K242LrD290M were better than the single K242 mutants but not significantly different from the respective single D290 replacements. No holoenzyme expression could be detected in cultures of the P-450 2B11 mutant K242F, even when put in combination with D290A, D290V, or D290I Ždata not shown..
4. Discussion The computer-predicted structure of P-450 2B1 w7x and a search for positively charged amino-acid residues unique to P-450 2B11 which might be
Table 3 Metabolism of androstenedione by solubilized membrane preparations of wild-type and site-directed mutants of P-450s 2B1 and 2B11 expressed in E. coli Double mutants a
2B11 WT K242DrD290K K242LrD290M K242YrD290S K242YrD290N K242LrD2901 2B1 WT a L242KrI290D
P-450 Žnmol productrmin per nmol.
% WT
16 b-OH-AD
16 a-OH-AD
total
activity
16 br16 a
1.3 0.3 0.9 0.6 0.3 1.0 5.0 0.4
1.1 0.2 0.6 0.3 0.04 0.1 0.5 0.5
2.4 0.5 1.5 0.9 0.3 1.1 5.5 0.9
100 21 63 38 13 46 100 16
1.2 1.5 1.5 2.0 7.5 10 10 0.8
Ten pmol P-450 2B11 fusion enzyme from CHAPS-solubilized membrane preparations was reconstituted with 40 pmol E. coli-expressed rat NADPH-cytochrome P-450 reductase in 50 m l and assayed for 10 min in 100 m l 1 = Hepes buffer Ž50 mM Hepes, pH 7.6, 15 mM MgCl 2 , 0.1 mM EDTA. containing 25 m M w 14 Cxandrostenedione. Assay conditions were the same for P-450 2B1 enzymes with the addition of 10 pmol cytochrome b5. a WT s wild-type. Values are the average of duplicate determinations.
264
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
interacting with the unique negatively charged Asp290 led us to the prediction that Lys-242 is interacting with Asp-290. The most direct approach to test this would have been to examine the crystal structures of wild-type and mutant enzymes and determine the structural consequences of site-directed changes at these positions, as was done for analysis of a salt bridge in bacterial chloramphenicol acetyltransferase w17x. Of course, the lack of a crystal structure for mammalian P-450’s made this type of analysis impossible. Without a crystal structure other researchers have been able to use the denaturants urea w26x or heat w15,27x to study the contributions of individual residues to protein stability. Our attempts to purify the various single mutant P-450 2B11fusion enzymes using n-octylamino-Sepharose w22x or Ž 2X ,5X-ADP. Sepharose 4B w13,28x were unsuccessful due to poor bacterial expression levels and possibly decreased enzyme stability. Heat stability studies using solubilized-membrane preparations were unreliable and appeared to be influenced strongly by the holoenzyme expression level of the bacterial culture Ždata not shown.. A study of the E. coli lactose permease charge pair Asp-237-Lys-358 w15x demonstrated that the polarity of the charge pair was not important for enzyme function. For example, Lys could substitute for Asp-237 and Asp could substitute for Lys-358 as long as the changes were made in tandem. Because the 2B11 D290K mutant had low expression levels and low enzymatic activity, a second mutation, 2B11 K242D was engineered, thereby forming a reciprocal charge swap to test whether polarity mattered in the case of P-450 2B11. The expression level of 2B11 K242DrD290K ŽFig. 2. was much improved over the expression levels of either single mutant and the 16 b-OHr16 a-OH AD ratio Ž Table 3. was similar to WT. It is likely that other amino acids in the region normally interact with these two residues by making additional contacts, since expression of the double mutant was not completely restored to the level of the wild-type construct. A study of known protein structures with buried ion pairs revealed that hydrogen bonding with surrounding residues often helps to stabilize the ion pair w31x. We have relied on bacterial expression levels, which others have shown is dependent upon features besides the N-terminal sequence w22,28–30x, as evi-
dence of residue-residue interaction. We believe that interpretation of our results based on expression levels are warranted for the following reasons. There is precedent for reduced expression levels as a result of disrupting a interacting charge pair; for example, when the charge pair of lactose permease protein was disrupted, low expression levels were noted w15x. In three separate double mutant experiments presented in this study, two in P-450 2B11 and one in P-450 2B1, the poorly expressing single mutants could be combined into better-expressing double mutant constructs. Our use of a P-450 2B11 fusion protein is an extension of previous work w13x but should not affect the interpretation of our results. Activity data could be misleading if the mutations in some way affected the ability of the P-450 to associate with NADPH-cytochrome P-450 reductase. However, we are not relying on activity data to prove whether there is evidence of residue-residue interaction. Enzymatic activity is not necessarily a good indicator of the stability of wild-type and mutant P-450 enzymes, especially if the residues are in or near the active site. For example, its easy to envision residue–residue interactions that are very favorable but which create an active site with lowered affinity for the substrate. Expression levels however, should not be affected by whether the P-450 can complex with reductase or not. Analysis of the androstenedione hydroxylase activity data Ž Table 3. for the various double mutant combinations demonstrates, through the 16 bOHr16 a-OH AD ratios, that stereoselectivity is affected and that altering these residues can affect the active-site geometry. It is interesting to note that exchanging the 242r290 residue pairs between P450s 2B1 and 2B11 essentially also exchanged the 16 b-OHr16 a-OH AD ratios as well Ž Table 3. . The proposed model of P-450 2B1 Ž7. suggests that both residues 242 and 290 help to form the substrate pocket. Residue 242 is predicted to help form the upper part of the substrate pocket that allows androstenedione to be held in the 16 b-binding orientation. Residue 290 is predicted to interact with the A-ring of androstenedione but only when the substrate is held in the 16 a-binding orientation. Our experimental results combined with the predictions from modeling suggest that residues 242 and 290
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
make residue-residue contacts as well as residue-substrate contacts. Whether changes in stereoselectivity are due to direct contact of residues 242 and 290 with the substrate or represent longer-range effects on the enzyme active site cannot be determined from our results. It does point out that caution is in order when using changes in stereoselectivity resulting from a residue substitution as evidence that the residue is near or contacting the substrate. According to the computer-generated P-450 2B1 molecular model w7x residues 242 and 290 are predicted to reside on helices G and I respectively. As such, these residues may help define the intersection of these helices. Interestingly, the crystal structure of P-450 BM-3 w32x reveals that residues Asp-217 on helix G and Arg-255 on helix I form a salt bridge. Analysis of the structure-based alignment of P-450 2B1 and P-450 BM-3 w7x reveals that residues 242 and 290 of P-450 2B1 align relatively closely with residues 217 and 255 of P-450 BM-3, respectively; although the polarity of the Asp-217rArg-255 charge pair in P-450 BM-3 is opposite to that of the proposed P-450 2B11 Lys-242rAsp-290 charge pair. The occurrence of oppositely charged residues in equivalent locations of P-450s 2B11 and BM-3 suggests a common function for a salt bridge in this position, namely, to coordinate the intersection of two helices. Ramarao et al. w21x have recently identified amino-acid residues, 368–374 and 386–388, within P-450 2C enzymes that interact functionally to determine enzyme structure. These residues are predicted to be on separate strands of the b 3 sheet. When not properly paired, as in the case of the chimeric enzyme between P-450 2C1 and P-450 2C2, the perturbation of this region led to the altered interaction of enzyme with substrate. In this study we have made a similar attempt to identify and characterize a specific residue–residue interaction within P-450s 2B1 and 2B11 that may influence enzyme tertiary structure. Identification of interacting residues in cytochromes P-450 for which there are no crystallographic data may prove to be a valuable tool for testing the validity of computer-aided three-dimensional homology models of P-450 enzymes and may ultimately provide important information about the structure–function relationships of cytochromes P450.
265
Acknowledgements We thank Dr. Grazyna Szklarz of the University of Arizona for assistance in locating probable positions of certain P-450 2B1 residues. This work was supported by grants from the National Institutes of Health ES04995 ŽJ.R.H.., Center Grant ES06694 ŽUniversity of Arizona., and Institutional Training Grant ES07091 ŽG.R.H...
References w1x Kedzie, K.M., Balfour, C.A., Escobar, G.Y., Grimm, S.W., He, Y.-A., Pepperl, D.J., Regan, J.W., Stevens, J.C. and Halpert, J.R. Ž1991. J. Biol. Chem. 266, 22515–22521. w2x He, Y.A., Balfour, C.A., Kedzie, K.M. and Halpert, J.R. Ž1992. Biochemistry 31, 9220–9226. w3x Halpert, J.R. and He, Y.A. Ž1993. J. Biol. Chem. 268, 4453–4457. w4x He, Y., Luo, Z., Klekotka, P.A., Burnett, V.L. and Halpert, J.R. Ž1994. Biochemistry 33, 4419–4424. w5x Luo, Z., He, Y. and Halpert, J.R. Ž1994. Arch. Biochem. Biophys. 309, 52–57. w6x He, Y.Q., He, Y.A. and Halpert, J.R. Ž1995. Chem. Res. Toxicol. 8, 574–579. w7x Szklarz, G.D., He, Y.A. and Halpert, J.R. Ž1995. Biochemistry 34, 14312–14322. w8x Szklarz, G.D., Ornstein, R.L. and Halpert, J.R. Ž1994. J. Biomol. Struct. Dyn. 12, 61–78. w9x Szklarz, G.D., He, Y.Q., Kedzie, K.M., Halpert, J.R. and Burnett, V.L. Ž1996. Arch. Biochem. Biophys. 327, 308– 318. w10x Liu, J., He, Y.A. and Halpert, J.R. Ž1996. Arch. Biochem. Biophys. 327, 167–173. w11x Kedzie, K.M., Grimm, S.W., Chen, F. and Halpert, J.R. Ž1993. Biochim. Biophys. Acta 1164, 124–132. w12x Hasler, J.A., Harlow, G.R., Szklarz, G.D., John, G.H., Kedzie, K.M., Burnett, V.L., He, Y.-A., Kaminsky, L.S. and Halpert, J.R. Ž1994. Mol. Pharmacol. 46, 338–345. w13x Harlow, G.R. and Halpert, J.R. Ž1996. Arch. Biochem. Biophys. 326, 85–92. w14x Honig, B.H. and Hubbell, W.L. Ž1984. Proc. Natl. Acad. Sci. USA 81, 5412–5416. w15x Dunten, R.L., Sahin-Toth, M. and Kaback, H.R. Ž1993. Biochemistry 32, 3139–3145. w16x Frillingos, S., Sahin-Toth, M., Lengeler, J.W. and Kaback, H.R. Ž1995. Biochemistry 34, 9368–9373. w17x Gibbs, M.R., Moody, P.C.E. and Leslie, A.G.W. Ž1990. Biochemistry 29, 11261–11265. w18x Lee, J.-I., Hwang, P.P., Hansen, C. and Wilson, T.H. Ž1992. J. Biol. Chem. 267, 20758–20764. w19x Sahin-Toth, M. and Kaback, H.R. Ž1993. Biochemistry 32, 10027–10035.
266
G.R. Harlow et al.r Biochimica et Biophysica Acta 1338 (1997) 259–266
w20x Hendsch, Z.S. and Tidor, B. Ž1994. Protein Sci. 3, 211–226. w21x Ramarao, M.K., Straub, P. and Kemper, B. Ž1995. J. Biol. Chem. 270, 1873–1880. w22x John, G.H., Hasler, J.A., He, Y. and Halpert, J.R. Ž1994. Arch. Biochem. Biophys. 314, 367–375. w23x Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. Ž1989. Gene 77, 51–59. w24x Shen, A.L., Porter, T.D., Wilson, T.E. and Kasper, C.B. Ž1989. J. Biol. Chem. 264, 7584–7589. w25x Korzekwa, K.R. and Jones, J.P. Ž1993. Pharmacogenetics 3, 1–18. w26x Koshy, T.I., Luntz, T.L., Plotkin, B., Schejter, A. and Margoliash, E. Ž1994. Biochem. J. 299, 347–350.
w27x Lewendon, A., Murray, I.A., Kleanthous, C., Cullis, P.M. and Shaw, W.V. Ž1988. Biochemistry 27, 7385–7390. w28x Fisher, C.W., Shet, M.S., Caudle, D.L., Martin-Wixtrom, C.A. and Estabrook, R.W. Ž1992. Proc. Natl. Acad. Sci. USA 89, 10817–10821. w29x Barnes, H.J., Arlotto, M.P. and Waterman, M.R. Ž1991. Proc. Natl. Acad. Sci. USA 88, 5597–5601. w30x Gillam, E.M., Baba, T., Kim, B., Ohmori, S. and Guengerich, F.P. Ž1993. Arch. Biochem. Biophys. 305, 123–131. w31x Rashin, A. and Honig, B. Ž1984. J. Mol. Biol. 173, 515–521. w32x Ravichandran, K.G., Boddupalli, S.S., Hasemann, C.A., Peterson, J.A. and Deisenhofer, J. Ž1993. Science 261, 731– 736.