Functional Intracellular Antibody Fragments Do Not Require Invariant Intra-domain Disulfide Bonds

doi:10.1016/j.jmb.2007.11.085

J. Mol. Biol. (2008) 376, 749–757

Available online at www.sciencedirect.com

Functional Intracellular Antibody Fragments Do Not Require Invariant Intra-domain Disulfide Bonds Tomoyuki Tanaka and Terence H. Rabbitts⁎ MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 0QH, UK Leeds Institute of Molecular Medicine, St. James's University Hospital, Wellcome Trust Brenner Building, Leeds LS9 7TF, UK Received 29 September 2007; received in revised form 23 November 2007; accepted 27 November 2007 Available online 4 December 2007 Edited by I. Wilson

Intracellular antibody fragments that interfere with molecular interactions inside cells are valuable in investigation of interactomes and in therapeutics, but their application demands that they function in the reducing cellular milieu. We show here a 2.7-Å crystal structure of intracellular antibody folds based on scaffolds developed from intracellular antibody capture technology, and we reveal that there is no structural or functional difference with or without the intra-domain disulfide bond of the variable domain of heavy chain or the variable domain of light chain. The data indicate that, in the reducing in vivo environment, the absence of the intra-domain disulfide bond is not an impediment to correction of antibody folding or to interaction with antigen. Thus, the structural constraints for in-cell function are intrinsic to variable single-domain framework sequences, providing a generic scaffold for isolation of functional intracellular antibody single domains. © 2007 Elsevier Ltd. All rights reserved.

Keywords: intrabody; RAS; single domains; X-ray crystallography; disulfide-free

Introduction Antibodies have contributed extensively to the field of bioscience as in vitro tools and in medical applications such as diagnosis and therapeutics due to their specificity and high affinity. Intracellular antibodies (intrabodies) can interfere with cellular functions by a number of mechanisms,1 such as prevention of protein–protein interactions,2 and also provide powerful tools in the field of functional genomics. However, the use of intrabodies still has several technical issues that have limited their full development and more general application. One of the most critical tasks is the generic improvement of *Corresponding author. Section of Experimental Therapeutics, Leeds Institute of Molecular Medicine, St. James's University Hospital, Wellcome Trust Brenner Building, Leeds LS9 7TF, UK. E-mail address: [email protected]. Abbreviations used: IAC, intracellular antibody capture; scFv, single-chain Fv; VH, variable domain of heavy chain; VL, variable domain of light chain; Fv, variable-domain fragment; CDR, complementaritydetermining region; BLI, bioluminescence imaging; PEG, polyethylene glycol; IMGT, the international ImMunoGeneTics information system; GTP, guanidine triphosphate.

their stability inside cells, as many intrabodies with promising affinity are folded poorly in vivo and thus lack function.3 In particular, the reducing environment of the cell is likely to preclude the formation of invariant intra-domain disulfide bonds that would normally contribute about 4–5 kcal/mol to the stability of antibody domains.4 Therefore, only intrinsically stable antibody fragments would be able to fold properly and maintain function in the reducing milieu. There has been considerable effort to achieve stabilised frameworks for intracellular antibodies,5,6 and we have developed the intracellular antibody capture (IAC) method7,8 to facilitate isolation of intrabodies against diverse targets using intrabody libraries based on an intrinsically stable antibody framework. We also have shown that single-variable domains can prove more efficacious as intrabodies9 than the more conventional singlechain Fv (scFv) format, which comprises the variable domain of heavy chain (VH) and the variable domain of light chain (VL) held together by a flexible peptide linker. Single-variable domains have several advantages as intrabodies compared to scFv, since scFv stability depends not only on the intrinsic VH and VL domains but also on the VH–VL interface and the flexible linker. However, both scFv and single-domain antibodies have stabilising intradomain disulfide bonds that will not form in vivo due to the reducing environment.

0022-2836/$ - see front matter © 2007 Elsevier Ltd. All rights reserved.

750 Here we have shown the crystal structures of VH and VL based on the IAC-derived scaffold8,9 and in the presence or in the absence of intra-domain disulfide bonds. We show that the loss of the disulfide bond does not affect the overall variable-domain fragment (Fv) structure, including the antigen-binding complementarity-determining regions (CDRs). This suggests that the VH and VL intrabody scaffolds are ideal for use under reducing conditions and can be used as a template for building intracellular binders against a plethora of intracellular targets.

Results and Discussion In a previous study,2,9 we derived VH and VL single-domain intracellular antibodies against the RAS oncogenic protein. The VH single domain is functionally active in the reducing cytoplasm of mouse and human cells, preventing tumour formation in mouse models.2,10 Nevertheless, the in vitro crystal structure of RAS–anti-RAS Fv (non-covalent VH and VL) complex demonstrated the presence of intra-domain disulfide bonds (Protein Data Bank accession code 2uzi). To verify whether single domains without disulfide bonds are functional in vitro and in vivo, random mutagenesis (Fig. 1a) was carried out on invariant cysteine codons using the VH#610 or the VL#204 templates,2 and these were screened in yeast using the IAC.7,8 The sequence of 20 of these VH clones (Fig. 1b) showed substituted amino acids with small side chains that should have similar steric requirements as the cysteines, but are relatively variable in shape, volume and polarity. The VL disulfide-free library screen was found to have predominantly valine– alanine substitutions (Fig. 1c). The RAS-binding ability of the disulfide-free anti-RAS VH and VL single domains was assessed (Fig. 2a) in comparison to the disulfide wild-type VH#6 [Fig. 2a, VH#6(CC) (C23 and C104)]. All the amino acid changes detected in the VH mutagenesis screen showed RAS binding, whereas other mutants with larger side chains [e.g., VH#6(RI) (C23 N R; C104 N I; Δtotal side-chain volume, 124 Å3) or VH#6(RK) (C23 N R; C104 N K; Δtotal side-chain volume, 126 Å3)] had no detectable binding. The VL mutant VL#204(VA) (C23 N V; C104 N A) had a binding ability equivalent to that of wild-type VL. The expression of anti-RAS VH proteins was determined as soluble proteins in 293T cell

Structure of Functional Disulfide-Free Antibodies

cytoplasm. Disulfide-bond-free VH#6(AV) (C23 N A; C104 N V) or VH#6(SS) (C23 N S; C104 N S) proteins were expressed as soluble proteins at approximately similar levels to wild-type VH#6, but the VH#6(RI) mutant protein was undetectable (Fig. 2b). The biological effect of disulfide-free anti-RAS VH single domains was examined by reverting RASdependent transformation of NIH3T3-EJ cells with VH protein using anchorage independence10 (Fig. 2c). Inhibition of soft agar colony formation was observed in NIH3T3-EJ cells expressing disulfidefree anti-RAS VH#6(AV) and VH#6(SS) mutants, as well as original VH#6(CC), while the VH#6(RI) mutant had no effect. Comparable biological properties were found with these disulfide mutant proteins in a lung tumour in vivo assay (Fig. 2d–f). NIH3T3-EJ cells were stably transfected with a constitutive promoter expressing luciferase and, when injected into the tail vein of nude mice, they formed bilateral multi-focal lung tumours that are detectable by bioluminescence imaging (BLI) following administration of the luciferase substrate, luciferin (Fig. 2d). NIH3T3-EJLuc cells were infected with retroviruses expressing one of the single-domain mutants, each with an IRES element controlling GFP translation. Injected cells were cloned by flow cytometry and, after expansion, injected into recipient mice. After 14 days, BLI was carried out to detect tumour development. Representative images of the recipients are displayed in Fig. 2d, illustrating that tumour inhibition occurs with wild-type VH#6(CC) and with the VH#6 (AV) and VH#6(SS) mutants. This was confirmed by post-mortem resection of the lungs from these animals (Fig. 2e) and by histology (Fig. 2f). These results suggest that anti-RAS VH fragments with selected amino acid changes that create disulfidefree single domains are fully functional as intrabodies that inhibit the oncogenic RAS tumourigenic function in vivo. The folding of the single domain in the environment of the cell is therefore intrinsic to the amino acid sequence of the variable region. The structural basis for this biological effect was solved by resolving the crystal structure of the trimeric complex of HRAS(G12V) and a disulfidefree anti-RAS, VH#6(AV) and VL#204(VA) (designated HRAS-FvSS-free). The X-ray diffraction structure was solved to 2.7 Å by molecular replacement method using as search models the coordinates of the RAS–anti-RAS Fv complex.2 (The structure data

Fig. 1. Construction and isolation of disulfide-free single-domain mutants. (a) Diagram of disulfide-free intrabody library construction. VH#6 or VL#204 with native cysteine residues at positions 23 and 104 (indicated in red and numbered according to the international ImMunoGeneTics information system (IMGT) numbering11) was mutated as shown12. Firstly, three PCR amplifications were prepared with a mixture of primers EFFP2, VHr1 (or VLr1) and VHf1 (or VLf1) [which randomises position 23 as shown in (b) or (c)], or a mixture of primers VHr2 (or VLr2) and VHf2 (or VLf2) [which randomises position 104 as shown in (b) or (c)], plus VP162R (oligo sequences can be found in Table 2). The three PCR products were assembled into a complete single-variable domain using EFFP2 + VP162R primers. These mutated VH or VL fragment mixtures were digested with SfiI and NotI and cloned into yeast pVP16* vector. (b and c) The amino acid sequences (in single-letter code) isolated from disulfide-free libraries screening are shown for anti-RAS VH#6 (b) and antiRAS VL#204 (c). Each table shows the substituted residues at positions 23 and 104 of selected clones from each disulfidefree library (b, VH; c, VL). Residue numbering is performed according to the IMGT unique numbering for V-DOMAIN.11 Randomised residues in each library are shown as X in red, and CDRs are highlighted in yellow. The CDR-IMGT lengths are VH [8.8.8] and VL [6.3.9].

751

Structure of Functional Disulfide-Free Antibodies

Fig. 1 (legend on previous page)

collection and refinement statistics are summarised in Table 1.) The structures of RAS were essentially identical whether bound by wild type or bound by HRAS-FvSS-free, and the two Fvs are remarkably

similar for both VH and VL elements, with or without the intra-domain disulfide bonds (the root mean square deviations for Cα position are 0.31 Å for VH and 0.41 Å for VL) (Fig. 3a and b), except

752

Structure of Functional Disulfide-Free Antibodies

Fig. 2. Binding and anti-tumour effect of anti-RAS single domains without intra-domain disulfide bonds. Mutations were made in the cysteine residues of anti-RAS VH#6 and VL#204 to generate proteins lacking intra-domain disulfide bonds. There were characterised by reporter (a), expression (b) or RAS-dependent transformation assays (c, d and f). (a) Left-hand panel: COS-7 cells were co-transfected with pEFVP16 vectors expressing anti-RAS VH#6, anti-RAS cysteinefree mutants or anti-ATF2 VH#27 control,10 and pM-HRAS(G12V) (DBD-RAS bait) plus the luciferase reporters pG5-Luc and pRL-CMV. Normalised fold luciferase inductions are presented as the mean ± SEM of three experiments. VH#6(CC) is the wild-type VH, and the mutants are indicated as single-letter codes. Right-hand panel: luciferase assays with VL single domains. VL(CC) is the wild-type VL#204, I21VL,2 and VL(VA) is the cysteine-free VL mutant. (b) Expression of intracellular antibodies in 293T cells. The cells were transiently transfected with the retroviral vector pGCIG13 encoding anti-RAS VH#6 with an N-terminal FLAG tag. Soluble proteins were extracted from transfected cells after 48 h and fractionated on SDS-PAGE. FLAG-tagged VH#6 proteins were detected by Western blotting with anti-FLAG monoclonal antibody (M2). (c) Anchorage-independent growth on soft agar. Oncogenic RAS-transformed NIH3T3-EJ cells2 were infected with retroviruses expressing anti-RAS VH#6-memb,2 Cys-free variants or retroviruses only. Three weeks after seeding, colonies (N 0.1 mm) were counted, and colony-forming efficiency was calculated as: number of colonies/number of seeded cells (the values are presented as mean ± SEM, in percent). (d–f) Inhibition of tumourigenesis by anti-RAS VH#6 in nude mice. NIH3T3-EJ-Luc cells were injected into the tail vein of nude mice. (d) After 14 days, the mice were imaged by BLI, as described in Methods. The colour overlay on the image represents the photons (per second) emitted from each animal according to the colour scale shown. Red represents the highest signal, and blue represents the lowest signal. After 21 days, the lungs were dissected, and whole mount displays were shown for macroscopic findings (e) or histological analysis (f).

that the alanine–valine replacements slightly altered the conformational distance of the β strands B and F in both VH and VL domains (Fig. 3c shows the VH and Fig. 3d shows the VL, indicating little difference between the native VH#6 and VL#204 Cys–Cys domains and the disulfide-free VH#6(AV) and VL#204(VA) domains, respectively). However, these minor alterations did not affect significantly

the conformation of any of the CDRs in both VH and VL domains, which are essentially identical in wild-type and mutant forms (Fig. 4a–c, VH; Fig. 4d–f, VL). These data strongly suggest that, as the single domains are expressed in the reducing environment of the cells, the lack of intra-domain disulfide bond does not affect the affinity for antigen.

753

Structure of Functional Disulfide-Free Antibodies Table 1. Structure data collection and refinement statistics Data collection and processing X-ray source Wavelength (Å) Space group Unit cell dimensions (Å) a b c Resolution range (Å)a Number of complexes/asymmetric unit Observationsa Unique reflectionsa Completeness (%)a Ra,b I/σ(I)a Multiplicitya Refinement Reflections Number of atoms Protein GTP Mg Zn Water Rcryst (%)c Rfree (%)c (% data used) Ramachandran (PROCHECK) (%) Core Allowed Generous Disallowed rmsd from ideality Bond length (Å) Bond angle (°) Average B-factor (Å2) All atoms RAS/VH/VL/GTP

Rigaku RuH3R 1.5418 (CuKα) P21212 75.9 85.4 63.1 42.18–2.70 (2.85–2.70) 1 51,551 (7231) 11,682 (1689) 99.5 (99.8) 0.131 (0.522) 12.4 (2.8) 4.4 (4.4) 11,076 3081 3003 32 1 3 42 19.7 29.1 (5.0) 88.4 10.7 0.6 0.3 0.011 1.4 40.7 40.8/40.7/40.9/35.1

a Values in parentheses are for the highest-resolution shell (2.85–2.70 Å). b Rmerge = ∑hlk(∑| i Ihlk − 〈Ihlk〉|)/∑hlk|〈Ihlk〉|. c R cryst and R free = ∑‖F obs|−|F calc ‖/∑|F obs|. R free was calculated with the percentage of the data shown in parentheses.

We have shown that both variable domains VH and VL of anti-RAS Fv can be intrinsically stable independent of intra-domain disulfide bonds and interactions with partner domains, and are fully functional as intrabodies against oncogenic RAS. The 2.7-Å crystal structure of RAS Fv with alanine– valine substitutions has been determined, and it can be concluded that the loss of disulfide bond does not affect protein structural conformation. This also suggests that the formation of disulfide bonds is not essential to the correct folding of immunoglobulin domains, and it is possible that it may take place at a relatively late stage in the folding pathway. As the intra-domain disulfide bond is dispensable for single-domain folding and in vivo stability (Tanaka et al.10, Colby et al.14 and this study), the structural frameworks of both variable domains, based on the scaffolds derived from IAC methods, 8,9 must be intrinsically stable. These scaffolds, derived from IGHV3 and IGKV1 subgroups, are ideal for forming the basis of singledomain intracellular antibodies against any antigen. Strategically, the IAC approach allows for the con-

struction and screening of single-domain VH (or VL) libraries directly in a yeast system (i.e., in vivo selection) and the potential development of isolated single domains as macrodrugs for use directly in therapy using, for example, vectors allowing the expression of the intrabodies in vivo. At present, we have constructed a series of single-domain intrabody libraries based on these VH and VL frameworks with randomised CDRs and have successfully isolated functional intrabodies for several different antigens (LMO2, P53 and HOX11) using our IAC approach (manuscript in preparation). Furthermore, these stable variable-domain frameworks could be used for antibody engineering as functional intracellular antibody scaffolds acting as recipients of CDR loop transplantation from established monoclonal antibodies, or as recombinant antibody scaffolds for expression of single domains and Fv in the cytoplasmic compartment of bacterial cells.15

Methods Yeast disulfide-free library construction Disulfide-free (S-S-free) VH#6 and VL#204 libraries were constructed in the yeast prey vector, pVP16*. The randomisation of cysteine residues was performed by the previously described mutagenesis method16 (Fig. 1a). In brief, for the S-S-free VH#6 library construction, three PCR amplification products of the VH#6 DNA were amplified from pEFVP16-VH#610 as template with mixtures of primers: a mixture of EFFP2, VHr1 and VHf1 (VHf1a: VHf1b:VHf1c:VHf1d = 48:1:1:1 ratio) and a mixture of VHr2, VHf2 (VHf2a:VHf2b:VHf2c:VHf2d = 48:1:1:1 ratio) and VP162R (Table 2). For the S-S-free VL#204 library construction, three PCR amplification products were made from the pEFVP16VL#204 (manuscript in preparation) template with the following pairs of primers: a mixture of EFFP2, VLr1 and VLf1 (VLf1a:VLf1b:VLf1c:VLf1d = 48:1:1:1 ratio) and a mixture of VLr2, VLf2 (VLf2a:VLf2b:VLf2c:VLf2d = 48:1:1:1 ratio) and VP162R (Table 2). Each amplified DNA fragment was purified and assembled with a second PCR using EFFP2 and VP162R. The assembled PCR fragments were digested with SfiI and NotI restriction enzymes and subcloned into pVP16*. The total number of clones for each library was N105. Yeast S-S-free VH and VL library screening The screening of S-S-free libraries was performed basically in accordance with the protocol of the IAC method† and as described elsewhere.8,9 For the S-S-free VH#6 library, 2.5 μg of pBTM116-HRAS(G12V) was transformed into yeast L40 using a lithium acetate method and then selected on plates lacking Trp to establish a stable yeast L40 clone expressing LexADBD-HRAS(G12V) fusion protein. Five hundred micrograms of the pVP16*S-S-free VH#6 library was transformed into this clone for selection (see next paragraph). For the S-S-free VL#204

† http://www.mrc-lmb.cam.ac.uk/PNAC/Rabbitts_T /group

754

Structure of Functional Disulfide-Free Antibodies

Fig. 3. Structural comparison of native and disulfide-free RAS–anti-RAS Fv complex. (a) Representation of HRAS bound by disulfide-free Fv. HRAS(G12V) (green) is shown as a molecular surface model. The switch I and switch II regions of RAS are shown in cyan and magenta, respectively, and guanidine triphosphate (GTP) is shown in orange. The Fv [comprising VH (blue) and VL (red)] is shown as a ribbon representation, with the CDRs of VH and VL in blue and pink, respectively. The positions 23 and 104 where cysteines were substituted by alanine and valine in VH, or by valine and alanine in VL, are in yellow. (b) Superimposition of anti-RAS Fv native form2 and disulfide-free Fv with alanine– valine substitutions in VH [VH#6(AV)] and with valine–alanine substitutions in VL(VA). The structure is shown as a stereo view of the Cα trace VH and VL of the native forms shown in cyan and pink and of the disulfide-free forms shown in blue and red, respectively. (c and d) 2Fo − Fc electron density maps (contoured at 0.5σ) around the disulfide bond regions of VH (c) and VL (d): native form (left) and disulfide-free mutant (right). The distance of Cα atom between the residues of cysteines or their substitutions is shown as a dotted line in yellow. library, an L40-ura3 stable yeast clone carrying pBTM116HRAS(G12V) and pCatcher-VH#6 was used (manuscript in preparation), and 500 μg of pVP16*-S-S-free VL#204 library was transformed into this yeast for selection. Clones in which S-S-free VH or VL mutants interacted with the RAS bait were selected on plates lacking Trp, Leu and His for the S-S-free VH#6 library screen or on plates lacking Trp, Leu, Ura and His for the S-S-free VL#204 library screen, each containing increasing concentrations of 3-amino-1,2,4-triazole (3-AT) (to inhibit histidine biosynthesis and to reduce the growth of yeast in which lowaffinity bait–prey interactions occur). The screening plates were incubated at 30 °C for 5–9 days (depending on the concentration of 3-AT), and clones with N 3 mm size were scored as positive. For each library screen, 20 clones were preferentially selected from plates containing 200 mM 3AT for the S-S-free VH#6 library and 20 mM for the S-Sfree VL#204 library. Yeast pVP16* plasmids were rescued from these clones and re-transformed into the stable yeast clones carrying bait with or without pCatcher-VH#6, and positivity was confirmed by growth on plates lacking histidine and by β-gal reporter gene activation. Mammalian two-hybrid and three-hybrid assays Mammalian luciferase reporter assays were performed as previously described.9 Briefly, the combination of bait pM-HRAS(G12V) and prey plasmid pEFVP16-VH, or the combination of pM-HRAS(G12V), pEFVP16-VL

and pEF/myc/cyto/VH#6 with the reporter plasmids with pG5-Luc and pRL-CMV was co-transfected into COS-7 cells using Lipofectamine (Invitrogen). Forty-eight hours after transfection, the cells were lysed and assayed with the Dual-Luciferase reporter system (Promega) on a luminometer. Transfection and infection of mammalian cells Expression of single domains in mammalian cells was achieved using the retroviral vector pGC-IRES transfected into 293T cells (for testing transient expression of intracellular antibodies) or Phoenix-E cells (for producing recombinant retroviruses), and recombinant retroviruses were infected as described elsewhere.2 To test the transient expression of intracellular antibodies, protein extracts were made from transfected cells by re-suspension of harvested cells in ice-cold TBS buffer containing 1% NP-40. Intracellular antibody proteins were detected using Western blotting with anti-FLAG (M2) monoclonal antibody. To establish NIH3T3-EJ cells stably expressing luciferase (NIH3T3-EJ-Luc cells), parental cells were transfected with linearised pEF-luciferase plasmid DNA, which were constructed by subcloning firefly luciferase cDNA in the NcoI and XbaI sites of pEF/myc/cyto (Invitrogen). Transfected cells were selected with G418 (1 mg/ml), and resistant clones were cultured for 3 weeks. Luciferase expression was established in stable lines by carrying out luciferase reporter assays on a luminometer.

755

Structure of Functional Disulfide-Free Antibodies

Fig. 4. Electron density maps of VH and VL CDRs. Views of VH and VL CDR structures with a 2Fo − Fc electron density map. The map is contoured at 0.5σ. Left panels show the native anti-RAS VH (a–c) and VL (d–f) single domains. Right panels show the disulfide-free form. (a) VHCDR1; (b) VHCDR2; (c) VHCDR3; (d) VLCDR1; (e) VLCDR2; (f) VLCDR3. NIH3T3-EJ-Luc cells were infected with recombinant retroviruses, and GFP-expressed cells were sorted from whole infected cells using a MOFLOW fluorescenceactivated cell sorter and expanded in cell culture. For soft agar assays, 5 × 103 cells were resuspended in 1.5 ml of medium with 10% fetal calf serum and 0.3% agar, and

overlaid on solidified medium comprising 10% fetal calf serum and 0.5% agar. This was performed in triplicate in six-well plates. After 3 weeks, the colonies (N 0.1 mm in size) were counted under a microscope. For the metastatic tumour assay in nude mice, 106 NIH3T3-EJ-Luc cells were injected intravenously. After 2 weeks, the mice

Table 2. Primer sequences Primer

Oligonucleotide sequence (5′→3′)

EFFP2 VHr1 VHr2 VHf1a VHf1b VHf1c VHf1d VP162R VHf2a VHf2b VHf2c VHf2d VLr1 VLr2 VLf1a VLf1b VLf1c VLf1d Vlf2a Vlf2b Vlf2c Vlf2d

GGAGGGGTTTTATGCGATGG GGAGAGTCTCAGGGACCCCC GTAATAGACAGCCGTGTCC GGGGGTCCCTGAGACTCTCCVNNGCAGCCTCTGGATTCACCTTa GGGGGTCCCTGAGACTCTCCTGGGCAGCCTCTGGATTCACCTT GGGGGTCCCTGAGACTCTCCTTTGCAGCCTCTGGATTCACCTT GGGGGTCCCTGAGACTCTCCTATGCAGCCTCTGGATTCACCTT CAACATGTCCAGATCGAA GGACACGGCTGTCTATTACVNNGCGAGAGGGAGATTCTTTGACa GGACACGGCTGTCTATTACTGGGCGAGAGGGAGATTCTTTGAC GGACACGGCTGTCTATTACTTTGCGAGAGGGAGATTCTTTGAC GGACACGGCTGTCTATTACTATGCGAGAGGGAGATTCTTTGAC AGTGATGGTAACTCTGTCTCC GTAGTAAGTTGCAAAATCTTC GAGACAGAGTTACCATCACTVNNCGGGCAAGTCAGAGCATTAGCa GAGACAGAGTTACCATCACTTGGCGGGCAAGTCAGAGCATTAGC GAGACAGAGTTACCATCACTTTTCGGGCAAGTCAGAGCATTAGC GAGACAGAGTTACCATCACTTATCGGGCAAGTCAGAGCATTAGC AAGATTTTGCAACTTACTACVNNCAACAGAGTGTGATGATTCCa AAGATTTTGCAACTTACTACTGGCAACAGAGTGTGATGATTCC AAGATTTTGCAACTTACTACTTTCAACAGAGTGTGATGATTCC AAGATTTTGCAACTTACTACTATCAACAGAGTGTGATGATTCC

a

Where N = A, G, C or T, and V = A, C or G.

756 were imaged for the growth of cells with luciferase expression in the lungs using the Xenogen IVIS imaging system. Animals were injected intraperitoneally with the luciferase substrate, D-luciferin Na salt (150 mg/kg body weight in phosphate-buffered saline). After 10 min, the mice, under isoflurane anaesthesia, were placed in a dark imaging chamber. Photon emission from tumours in the lungs was detected with a charge-coupled device camera. This photon image was superimposed on a normal video image of the mice with Living Image software (Xenogen). At 3 weeks after injection, the mice were sacrificed, and autopsy and pathological examination were performed. Lungs were resected, and histological sections were made after wax embedding. The sections were stained with haematoxylin and eosin. Protein expression and purification For expression of Fv (comprising VH and VL with cysteine mutations) and RAS recombinant proteins in Escherichia coli, the modified tricistronic pRK-HISTEVVHRASVL plasmid was used as described elsewhere.2 Transformed E. coli C41 (DE3) cells were grown to an OD600 of 0.6 and induced with IPTG (final 0.5 mM) at 16 °C for 12 h. The proteins were extracted from bacterial cells using sonication and French press in extraction buffer comprising 25 mM phosphate (pH 7.4), 500 mM NaCl and 20 mM imidazole, and purified on His-Trap Ni-affinity columns (GE Healthcare) employing gradient elution (20–300 mM imidazole). The His-tag peptide was removed from the purified protein by digestion with TEV protease and dialysed against 20 mM Tris (pH 8.0), 300 mM NaCl and 20 mM imidazole at 4 °C overnight. The HRAS–anti-RAS mutant Fv heterotrimer complex was purified again by passing through Ni-NTA agarose column (Qiagen) and by gel filtration on HiLoad Superdex-75 columns (GE Healthcare) in 20 mM Tris (pH 8.0) and 150 mM NaCl and concentrated to 10 mg/ml. Protein crystallisation and structure determination The purified protein was crystallised in sitting-drop vapour-diffusion method. Two microliters of purified protein was mixed with an equal volume of reservoir solution [17–18% polyethylene glycol (PEG) 3350, 320 mM zinc acetate, 100 mM sodium cacodylate (pH 5.8) and 0.03% dichloromethane] and set in a 24-well Cryschem plate (Hampton Research) with 400 μl of reservoir solution. Crystals grew to the maximum size within 3 days at 19 °C. Larger crystals were transferred to a cryoprotectant reservoir with 25% PEG 3350 and frozen by immersing into liquid N2. Data sets were collected at 100 K on a MAR345dtb image plate detector (MAR-Research) using radiation from a Rigaku RuH3R X-ray generator (running at 5 kW) equipped with Osmic confocal optics. Reflections were indexed and integrated with MOSFLM,17 then merged and scaled with SCALA18 (Table 1). The crystals belonged to space group P21212 and diffracted to a resolution of 2.7 Å. The structure was determined by molecular replacement as implemented in AMoRe19 using the structure of HRAS–anti-RAS Fv determined previously.2 The program O20 was used to build the model into the 2Fo − Fc and Fo − Fc maps in iterative rounds of refinement with REFMAC. 21 The CCP4 suite was used extensively during refinement (Table 1). The final model displayed good geometry with all residues in allowed regions of the Ramachandran plot, as defined

Structure of Functional Disulfide-Free Antibodies by PROCHECK.22 Figures were prepared with Pymol‡ software. Protein Data Bank accession codes Coordinates and structure factors of the RAS–anti-RAS Fv (disulfide-free) complex have been deposited with the entry code 2vh5.

Acknowledgements This work was supported by the Medical Research Council, and T.T. was supported by the National Foundation for Cancer Research. We are indebted to Dr. Roger Williams (MRC Laboratory of Molecular Biology) for helping with the structural crystallography analysis and for critical reading of the manuscript. We also thank Fraser Lewis and Mike Shires (Leeds Institute of Molecular Medicine Histology Service) for the histology of lung tumours.

References 1. Lobato, M. N. & Rabbitts, T. H. (2003). Intracellular antibodies and challenges facing their use as therapeutic agents. Trends Mol. Med. 9, 390–396. 2. Tanaka, T., Williams, R. L. & Rabbitts, T. H. (2007). Tumour prevention by a single antibody domain inhibiting binding of signal transduction molecules to activated RAS. EMBO J. 26, 3250–3259. 3. Worn, A. & Pluckthun, A. (2001). Stability engineering of antibody scFv-chain Fv fragments. J. Mol. Biol. 305, 989–1010. 4. Worn, A. & Pluckthun, A. (1998). An intrinsically stable antibody scFv fragment can tolerate the loss of both disulfide bonds and fold correctly. FEBS Lett. 427, 357–361. 5. Proba, K., Worn, A., Honegger, A. & Pluckthun, A. (1998). Antibody scFv fragments without disulfide bonds made by molecular evolution. J. Mol. Biol. 275, 245–253. 6. Worn, A. & Pluckthun, A. (1999). Different equilibrium stability behavior of ScFv fragments: identification, classification, and improvement by protein engineering. Biochemistry, 38, 8739–8750. 7. Visintin, M., Settanni, G., Maritan, A., Graziosi, S., Marks, J. D. & Cattaneo, A. (2002). The intracellular antibody capture technology (IACT): towards a consensus sequence for intracellular antibodies. J. Mol. Biol. 317, 73–83. 8. Tse, E., Lobato, M. N., Forster, A., Tanaka, T., Chung, G. T. Y. & Rabbitts, T. H. (2002). Intracellular antibody capture technology: application to selection of single chain Fv recognising the BCR-ABL oncogenic protein. J. Mol. Biol. 317, 85–94. 9. Tanaka, T. & Rabbitts, T. H. (2003). Intrabodies based on intracellular capture frameworks that bind the RAS protein with high affinity and impair oncogenic transformation. EMBO J. 22, 1025–1035.

‡ http://www.pymol.org

Structure of Functional Disulfide-Free Antibodies 10. Tanaka, T., Lobato, M. N. & Rabbitts, T. H. (2003). Single domain intracellular antibodies: a minimal fragment for direct in vivo selection of antigen-specific intrabodies. J. Mol. Biol. 331, 1109–1120. 11. Lefranc, M. P., Pommié, C., Ruiz, M., Giudicelli, V., Foulquier, E., Truong, L. et al. (2003). IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev. Comp. Immunol. 27, 55–77. 12. Creighton, T. E. (1983). Proteins: Structure and Molecular Properties. Freeman, New York. 13. Costa, G. L., Benson, J. M., Seroogy, C. M., Achacoso, P., Fathman, C. G. & Nolan, G. P. (2000). Targeting rare populations of murine antigen-specific T lymphocytes by retroviral transduction for potential application in gene therapy for autoimmune disease. J. Immunol. 164, 3581–3589. 14. Colby, D. W., Chu, Y., Cassady, J. P., Duennwald, M., Zazulak, H., Webster, J. M. et al. (2004). Potent inhibition of Huntington aggregation and cytotoxicity by a disulfide bond-free single-domain intracellular antibody. Proc. Natl Acad. Sci. USA, 101, 17616–17621. 15. Ewert, S., Honegger, A. & Pluckthun, A. (2004). Stability improvement of antibodies for extracellular and intracellular applications: CDR grafting to stable frameworks and structure-based framework engineering. Methods, 34, 184–199.

757 16. Tanaka, T., Chung, G. T. Y., Forster, A., Lobato, M. N. & Rabbitts, T. H. (2003). De novo production of diverse intracellular antibody libraries. Nucleic Acids Res. 31, e23. 17. Leslie, A. G. W. (1992). Recent Changes to the MOSFLM Package for Processing Film and Image Plate Data. In Joint CCP4 and ESF-EACMB Newsletter on Protein Crystallography. 26, Daresbury Laboratory, Warrington, UK. 18. CCP4. (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallogr. Sect. D, 50, 760–763. 19. Navaza, J. (1994). AMoRe: An Automated Package for Molecular Replacement. Acta Crystallogr. Sect. A, 50, 157–163. 20. Jones, T. A., Zou, J. Y., Cowan, S. W. & Kjeldgaard, M. (1991). Improved methods for building protein models in electron density maps and the location of errors in these models. Acta Crystallogr. Sect. A, 47, 110–119. 21. Murshudov, G. N., Vagin, A. A. & Dodson, E. J. (1997). Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. Sect. D, 53, 240–255. 22. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 26, 283–291.