Functional organization of photosystem II antenna complexes: CP29 under the spotlight

    Functional organization of photosystem II antenna complexes: CP29 under the spotlight Pengqi Xu, Laura M. Roy, Roberta Croce PII: DOI: Reference:

S0005-2728(17)30113-5 doi:10.1016/j.bbabio.2017.07.003 BBABIO 47820

To appear in:

BBA - Bioenergetics

Received date: Revised date: Accepted date:

22 June 2017 28 July 2017 30 July 2017

Please cite this article as: Pengqi Xu, Laura M. Roy, Roberta Croce, Functional organization of photosystem II antenna complexes: CP29 under the spotlight, BBA - Bioenergetics (2017), doi:10.1016/j.bbabio.2017.07.003

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Functional organization of photosystem II antenna complexes: CP29 under the spotlight

RI

PT

Pengqi Xu, Laura M. Roy, Roberta Croce* Biophysics of Photosynthesis, Department of Physics and Astronomy, Faculty of Sciences, VU University Amsterdam, De Boelelaan 1081, 1081 HV, Amsterdam, The Netherlands

SC

*Corresponding author Email address: [email protected]

NU

Highlights

MA

- CP29-His has been expressed A.thaliana and purified in mild conditions. - The protein binds 13 Chls, with a Chl a/b ratio of 2.7 and 3 carotenoids. - In vivo mutation analysis shows that Chl612 and Chl603 in CP29 are isoenergetic. - The CP29-LHCII-CP24 complex binds one β-carotene in addition to xanthophylls. - The association of CP29, LHCII and CP24 influences their spectral properties.

D

Abstract:

AC CE P

TE

In the first step of the photosynthetic process, light is absorbed by the pigments associated with the antenna proteins, known as Light-harvesting complexes (Lhcs), which in vivo are functionally organized as hetero-oligomers. The architecture of the pigments, chlorophylls, and carotenoids bound to each LHC is responsible for the efficient excitation energy transfer resulting in photochemistry. So far, the only LHC studied in depth was LHCII, the most abundant membrane protein of plants, while less information was available for the other antennae. In particular, despite the availability of the structure of CP29 obtained at near atomic resolution in 2011 (Pan et al. 2011), the mismatch in pigment content and spectroscopic properties between CP29 in solution and in the crystal has hampered the possibility to use the structure to interpret the experimental data. In this work, we purified CP29 and its larger assembly (CP29-LHCII-CP24) from the membrane in very mild conditions using a His-tag, and we have studied their pigment binding and spectroscopic properties. In addition, we have performed mutation analysis in vivo to obtain mutants of CP29 lacking individual chlorophylls. The peculiar properties of this antenna support its role in directing the energy flow from the external antennae to the reaction center.

Key words: Photosystem II, light-harvesting complexes, CP29, PSII supercomplexes, in vivo mutation analysis

1

ACCEPTED MANUSCRIPT 1. Introduction

AC CE P

TE

D

MA

NU

SC

RI

PT

In plants, conversion of solar energy into chemical energy starts with the absorption of light by pigments associated with antenna complexes. The excitation energy is then transferred from the antenna to the reaction center (RC), where it drives charge separation. To understand the overall process and the origin of its high efficiency, it is essential to know how the pigments are organized within the individual complexes and how the complexes are arranged to form supercomplexes. In higher plants, the peripheral antenna system of Photosystem II (PSII) is composed of 6 types of lightharvesting complexes (Lhcb 1-6) [1]. Lhcb 1-3, whose product is known as LHCII, form heterotrimers. Lhcb 4-6, known respectively as CP29, CP26 and CP24, are present as monomers and are located between LHCII and the core complex, which contains the RC [2, 3]. The structure of the largest PSII supercomplex (C2S2M2) purified so far [4, 5] is shown in Fig. 1. The complex is a dimer of the PSII core and contains two copies each of CP29, CP26 and CP24. The LHCII trimer strongly bound to the PSII core is called trimer S and is composed of Lhcb1 and Lhcb2. The LHCII associated to the core via CP29 is called trimer M and consists of Lhcb1 and Lhcb3 [4]. While CP26 and CP24 are at the periphery of the supercomplex, CP29 is located between the M trimer and the PSII core, and seems to act as a wire directing the excitation energy from the periphery to the core [5-7]. Lhcb apoproteins contain 210-260 amino acids [8] and coordinate 10-14 chlorophylls (5-10 Chls a and 46 Chls b) and 2-4 carotenoids. The structures of most of the antenna complexes have become available in recent years [9-12], showing that protein and pigment organizations are highly conserved among Lhcs. However, the selectivity of the binding sites for the pigments (e.g. Chl a vs. Chl b) and the spectral properties of the pigments differ. Knowledge about the organization and the site energies of the pigments is essential to describe the flow of excitation energy transfer in the complexes. For LHCII, a high-resolution structure was released in 2004 [9] and has been the basis for a large number of theoretical studies [13-18]. A high-resolution structure of CP29 was released more recently [10]. However, according to the structure, CP29 binds 8.5 Chls a and 4.5 Chls b for a Chl a/b ratio of 1.89. Chl a/b values of 2.8-3.0 are instead observed for the purified complex, and was expected to contain only 8-9 Chls [19-22]. This difference in the properties of the crystallized and purified complexes hampered the possibility to use the crystal structure to describe the experimental data and to obtain insight about the excitation energy transfer in the complex. A major problem for the characterization of the antenna complexes is that their isolation from the membrane can lead to the loss of pigments [23]. To purify the complexes in their native state, it is crucial to use mild treatments and a limited number of steps. However, in case of the minor antenna complexes, several purification steps are usually necessary, and the number of Chls associated with the isolated monomers was always found to be lower than that of LHCII [21]. Moreover, in the membrane, the antenna complexes are associated with the core and other antennas forming large functional supercomplexes. It can be expected that the presence of neighboring complexes influences the spectroscopic properties of the pigments and stabilizes pigment binding. This is, for example, the case for LHCII, where Chl-Chl interactions vary in monomers and trimers [14, 24]. In this work, to limit the possibility of pigment loss, we have purified CP29 from the membrane by a mild treatment using a His-tag. In addition, we have studied the effect of protein-protein interactions on the pigment content and properties of CP29, CP24 and LHCII by comparing the properties of the individual 2

ACCEPTED MANUSCRIPT antennae with those of their larger assemblies: CP29-LHCII-CP24 complex. Finally, we have performed in vivo mutation analysis to determine the nature and the properties of the pigments of CP29 which are important for the energy transfer in the PSII supercomplex.

PT

2. Materials and Methods

AC CE P

TE

D

MA

NU

SC

RI

2.1 The mutation of CP29-WT/mutant-His: The CP29 (lhcb4.1) promoter and coding region was amplified by PCR from genomic DNA isolated from A. thaliana ecotype Columbia-0 with the forward primer 5' GTCGACCGATATCATATTTGCTGATTAAGGGTAC 3' and reverse primer 5' GCGGCCGCTCAatggtgatggtgatggtgtccaccAGATGAGGAGAAGGTATCGATGATG 3'. The reverse primer was designed to add a spacer of 2 Gly, a tail of 6 His residues. The product was cloned into pMDC99 [25] and the terminator of CP29 was added in frame at the C-terminal through subsequent subcloning. Agrobacterium tumefaciens strain GV3101 was transformed with sequence confirmed constructs. The CP29-KO plants [26] was grown under long-day conditions (16 hours light, 8 hours dark) for 4–5 weeks and transformed by floral dip [27, 28]. Transformed plants were selected on MS plates supplemented with hygromycin 25 mg/ml. The expression of the CP29 transgene was assessed by immunoblotting and the homozygous line containing CP29-WT-His was identified in subsequent generations. The mutants of CP29 were made by site directed mutagenesis (Q5 kit, NEB) and designed to change their chlorophyll associated amino acid to phenylalanine. The pMDC99-CP29-WT-His construct was used as a template for PCR with the following primers: CP29-His143Phe_For 5' CGAACTCATCTTCGGACGGTGG 3' and CP29His143Phe_Rev 5' CATTCCCTGAATCTCTGGATTCCG 3' for CP29-603; CP29-His245Phe_F 5' TGAGATCAAGTTTGCACGTCTTG 3' and CP29-His245Phe_Rev 5' GCTAACTGAAGTTGAGCAG 3' for CP29612. All constructs were verified by sequencing and confirmed again by PCR and sequencing from genomic DNA isolated from the transformed plants. Expression levels of the mutant CP29 proteins in homozygous lines were similar to CP29-WT-His (data not shown). 2.2 Thylakoid preparation and photosynthetic complexes isolation: The CP24-WT-his and CP29-WT/mutant-His used for the thylakoid preparation were grown in a growth chamber under 130 μmol photons m− 2 s− 1 of light (16 h/day) at 21 °C for four weeks. The thylakoids were prepared as described in Passarini et al. [29]. The unstacked thylakoids were solubilized with a final concentration of 0.6% α-DDM at a chlorophyll concentration of 0.5 mg/ml. The supernatant was loaded on a 0-1M continuous sucrose density gradient and ultracentrifuged (288,000 g) for 17 hours. The bands from CP29-WT/mutant-His that contain monomeric Lhcbs were collected. The bands from CP24-WT-His that contains monomers and CP29-LHCII-CP24 complex were collected separately. Further purification for CP24-His, CP29-His, CP29-603, CP29-612 and CP29-LHCII-CP24 were performed by affinity chromatography. All the samples eluted from nickel column were mixed with a 2 M sucrose buffer (2 M sucrose, 10 mM Hepes, 0.03% α-DDM, pH 7.5) to adjust the final concentration of sucrose around 0.3 M before freezing.

3

ACCEPTED MANUSCRIPT

NU

SC

RI

PT

2.3 Steady-state spectroscopy: The absorption spectra at room temperature were recorded on a Varian Cary 4000 UV–visspectrophotometer with a 0.5 nm step from 350-750 nm. Fluorescence spectra were recorded at room temperature with an OD of 0.05/cm at the Qy maximum on a Fluorolog 3.22 spectrofluorimeter (Jobin Yvon-Spex). Fluorescence spectra at 77 K were measured on the same set-up using a cold finger filled with liquid nitrogen. Circular-dichroism (CD) spectra were recorded with a 1 nm step from 350-750 nm at 20 °C on a Chirascan-Plus spectropolarimeter (Applied Photophysics). When necessary the samples were diluted with a sucrose buffer (0.5 M sucrose, 10 mM Hepes, 0.03% α-DDM, pH 7.5) Pigment analysis was performed as described in Xu et al. [30] with slight modification in the HPLC program. The amount of buffer B was linearly increased from 0% to 100% in 9.2 min without stop. SDS-PAGE electrophoresis was performed with 4-12% gradient precast gels from Invitrogen.

AC CE P

3. Results

TE

D

MA

2.4 Time-resolved fluorescence measurements: Time-Correlated Single Photon Counting (TCSPC) was measured using a FluoTime200 setup (Picoquant). The samples were diluted to an OD of 0.05/cm at the Qy maximum, stirred in a 3.5 ml cuvette with a path length of 1 cm, and kept at 283 K. The fluorescence decay kinetics were detected at 680 nm with a channel time spacing of 4 or 8 ps upon 468 nm excitation, using a laser diode operating at a repetition rate of 10 MHz. Data analysis was performed by TRFA DATA processor using a time window of 16 ns.

3.1 Purification of CP29-His and mutants To purify CP29 in mild conditions, we transformed the KO mutant of CP29 with a modified version of its gene carrying a His-tag at the C-terminus. The native promoter and terminator were used to obtain optimal expression. The expression of the target protein was confirmed by immunoblotting (not shown). The highest expressing line was identified and bred to generate homozygous lines that were used for thylakoids preparation. We also transformed the CP29-KO plants with two mutated versions of the CP29 gene that lack the ligands of Chl 603 and Chl 612 (Nomenclature is from Liu et al. 2004 [9]). These are the Chls that in the PSII supercomplex face the core and LHCII-M, respectively, and thus are expected to play an important role in the transfer of excitation energy from the peripheral antenna to the core [5-7]. The solubilized thylakoids from the above-mentioned plants were fractionated on a sucrose density gradient by ultracentrifugation. The light-harvesting complexes were present in different bands, as previously shown [29]. CP29-WT and mutants were isolated from band 2, containing the monomeric antennae, by affinity chromatography. The purity of the complexes was verified by SDS-PAGE (Fig. 2). Some ATPase impurity was visible in the gel, but as the ATPase does not contain pigments, its presence did not influence the analysis. A band at higher MW was visible in the fractions containing the CP29 mutants. The origin of this band is unknown. However, only PsaA/B are pigment-binding proteins with matching MW, but their characteristic red-shifted fluorescence emission [31] was not present in the fluorescence spectrum of the samples, indicating that they are not contaminants in the preparation (SI 4

ACCEPTED MANUSCRIPT

Table 1 Pigment analysis

Chl b

Chl a

total 2 Chl

0.05 0.00

5.1 ±0.01

5.3 ±0.01

10.4

1.06 ±0.01

N.D.

3.4 ±0.01

9.2 ±0.01

12.6

1.12 ±0.01

1.00 ±0.01

N.D.

2.8 ±0.01

7.4 ±0.01

10.2

0.91 ±0.01

1.02 ±0.01

1.06 ±0.01

N.D.

3.4 ±0.00

8.1 ±0.00

11.5

3.64 ±0.02

3.01 ±0.05

0.65 ±0.02

7.84 ±0.11

N.D.

17.9 ±0.03

24.1 ±0.03

42

1.48 ±0.06

4.14 ±0.14

2.95 ±0.28

2.84 ±0.08

9.06 ±0.25

0.86 ±0.08

26.3 ±0.62

38.7 ±0.62

65

1.46

3.94

3.92

2.69

9.83

0.05

26.4

38.6

65

Chl a/b

Chl/Car

Neo

CP24-His

1.04 ±0.01

5.22 ±0.09

0.09 0.00

CP29-His

2.74 ±0.01

4.20 ±0.01

CP29-612

2.66 ±0.01

3.41 ±0.02

CP29-603

2.40 ±0.00

Lut

β-car

0.93 ±0.02

0.93 ±0.02

0.82 ±0.01

1.11 ±0.01

0.87 ±0.01

3.84 ±0.02

1.35 ±0.00

CP29-LHCII-CP24

Sum (CP29,LHCII,CP24)

D

TE

AC CE P

Vio

MA

Sample

LHC II

1

NU

SC

RI

PT

Fig. 1). Finally, differently from the crystallized protein that was missing the N-terminus domain [10], our isolated CP29 has the MW of the complete protein and the preparation does not contain free Chls (SI Fig. 2). The results of the pigment analysis for all samples are shown in Table 1. The Chl a/b ratio of our purified CP29 is 2.74, while it is lower in both mutants which are indeed expected to lose Chl a (Table 1) from the 603 and 612 sites. The ratio between the carotenoids (Neo: Vio: Lut≈0.9:1:1) is virtually identical in CP29-His and the two mutants, indicating that the carotenoid composition is not affected by the mutations. This conclusion allows us to normalize the pigment content of WT and mutants to the carotenoids. Normalization to three carotenoids suggests the presence of 12.6 Chls per monomer in the WT, 11.5 in CP29-603 and 10.2 in CP29-612. Mutant 612 apparently loses almost 2 Chls a and substoichiometric amounts of Chl b, while mutant 603 only loses 1 Chl a.

1

2

The chromatograms are shown in SI Fig. 3 to confirm the existence of β-car. total chlorophylls based on the previous reports or crystal structures [9, 10, 29, 32]. (Chl: chlorophyll, Car: carotenoid, Neo: neoxanthin, Vio: violaxanthin, Lut: lutein, β-car: β-carotene). n=3 replicas.

Each Chl associated with a light-harvesting complex has specific spectroscopic properties depending on its environment. In the absence of excitonic interaction, the absorption properties of Chl 612 and Chl 603 can be obtained by comparing the spectrum of CP29-His with those of the mutants that do not contain these Chls. However, the CD spectra of both mutants differ from that of the WT (Fig. 3B), indicating that both Chls are strongly coupled with neigbouring pigments. In this case, the difference spectrum WT-mutant represents the spectrum of the interacting pigments. If one of the interacting pigments remains associated with the protein the difference spectrum is then the spectrum of the interacting pair minus the spectrum of the Chls which is still present in the protein and now absorbs as a monomer. The difference in the absorption spectrum between CP29-His and mutant 612 shows a main 5

ACCEPTED MANUSCRIPT

MA

NU

SC

RI

PT

component at 679.5 nm. A difference in the Chl b region is also observed (Fig. 3C), in agreement with the loss of a small amount of Chl b in the mutant. Although we have specifically changed the ligand of Chl 612, as indicated by the pigment analysis, the mutation has affected other binding sites, most probably Chl 611. Chl 611 is located closely to Chl 612 and is not directly coordinated by protein, but by a lipid molecule [10], and is in excitonic interaction with Chl 612. The difference spectrum represents thus the spectrum of the interacting pair Chl 612 and 611. The CP29-603 mutant loses only one Chl a which has an absorption maximum at 678.5 nm in the Qy region (Fig. 3C). In both mutants, a blue shift of the carotenoid absorption is observed, likely due to the loss of Chl-carotenoid interactions, because Chl 612 and 603 are close to the xanthophylls in sites L1 and L2, respectively. The fluorescence emission spectrum is dominated by the Chls with the lowest energy. In the case of LHCII and CP24, it was shown that the loss of Chl 612 led to a blue-shift of the fluorescence emission, as compared to the WT, indicating that Chl 612 is part of a Chl cluster responsible for the lowest energy site of the complexes. The situation appears different in CP29 as the fluorescence emission spectra of the both 612 and 603 mutants is close to that of the WT. This can have two explanations: a Chl, different from both 612 and 603 is responsible for the lowest energy state or both Chl clusters contributed to it (Fig. 3D). The small increase in intensity in the region below 670 nm for the CP29-603 mutant is probably due to a change in the population at equilibrium which results from the loss of only Chl a in this mutant.

AC CE P

TE

D

3.2 From individual complex to supercomplexes In the thylakoid membranes, the antenna complexes are associated with the core to form large supercomplexes that favor the transfer of excitation energy from the antenna to the RC [33]. This implies that the pigments of the individual subunits should be close together, as apparent from the most recent PSII supercomplex structure [12], and some of them can be lost upon purification of the individual subunits. To investigate if the association between complexes influences the binding and the properties of some of the pigments, we have compared the properties of CP29, CP24 and LHCII with those of the CP29-LHCII-CP24 complex (see M&M for details on the purification of the individual complexes). The pigment content of all the complexes is reported in Table 1. We then summed up the pigments of each subunit and compared the result with the pigment composition of the large complex. The measured and expected Chl a/b ratios (1.48 vs. 1.46) are very similar, suggesting that no Chls are lost during the separation of the individual subunits. Differences are observed for the carotenoids. In particular, the CP29-LHCII-CP24 complex contains one neoxanthin less than expected, is slightly lower in lutein and instead contains one molecule of β-carotene. To understand the effect of protein-protein interactions on the spectroscopic properties of the pigments, we measured the absorption, fluorescence emission and CD spectra of the individual complexes and compared them (and their sum) with the spectrum of the CP29-LHCII-CP24 complex (Fig. 4 A&B). The sum of the absorption spectra (Fig. 4A) of CP29, LHCII and CP24 differs only slightly from the spectrum of the large complex in the Qy region, but shows more significant differences in the blue region, in agreement with the different carotenoid composition (Table 1). The sum of the CD spectra of the individual complexes reproduces well all the features of the CD of the supercomplex, apart from the negative component at 678nm, which is more intense in the spectrum of the sum than in the CP29-

6

ACCEPTED MANUSCRIPT

RI

PT

LHCII-CP24 complex (Fig. 4B). This indicates that some of the interactions between Chls change/are formed as a result of the interactions between the complexes. The room temperature fluorescence emission spectra of the individual complexes and the CP29-LHCIICP24 complex are shown in Fig. 5. The spectrum of CP24 is broader, probably indicating a larger contribution of Chl b to the emission, and blue-shifted as compared to those of the other antennae. CP29 has the narrowest spectrum, while the emission spectra of LHCII and CP29-LHCII-CP24 are very similar, indicating that the emission of the supercomplex is largely dominated by that of LHCII.

MA

NU

SC

3.3 Fluorescence lifetime The time-resolved fluorescence decay kinetics were measured by time-correlated single photon counting. Three components were necessary to satisfactory fit the decays of all complexes except the LHCII trimer, the decay of which could be fitted with two components. The average lifetimes of the complexes decrease in the order LHCII>CP29>CP24=CP29-LHCII-CP24, indicating that the assembly of the complexes into the CP29-LHCII-CP24 complex leads to a shortening of the lifetime (Table 2).

τ 1 (ns)

A1

τ 2 (ns)

A2

τ 3 (ns)

A3

Average lifetime (ns)

CP24-His

0.304

0.099

1.949

0.270

3.488

0.631

2.76±0.02

CP29-His

0.131

0.112

1.214

0.075

3.926

0.813

3.30±0.02

LHCII

0.804

0.062

3.785

0.938

-

-

3.60±0.01

0.243

0.163

1.394

0.156

3.654

0.681

2.75±0.01

AC CE P

TE

Sample

D

Table 2. Fluorescence lifetime

CP29-LHCII-CP24

The average lifetime for all samples was calculated as

∑

. n= 3 replicas.

4. Discussion

Most of the available information on the light-harvesting complexes has been obtained by studying in vitro purified or reconstituted complexes (e.g. [34-38]). Whereas in the case of the major antenna complex, LHCII, the purification maintains the pigment binding and the properties of the native complex, the situation is less clear for the minor antennae, CP29, CP26 and CP24. It was reported that the number of Chls associated with these complexes varies from 5 to 10, but in all cases was lower than in LHCII. Similarly also the number of carotenoids associated with them was shown to vary between 2 and 3, being again lower than in LHCII. However, the recent structures of CP29 [10] and of the PSII supercomplex [12] have shown that CP29 and CP26 bind 13-14 Chls per monomer as is the case in LHCII. The discrepancy in pigment composition was attributed to the loss of pigments during purification as also suggested by the different pigment composition of the purified and crystallized complexes [10]. Indeed, due to their lower abundance and their similar characteristics, the homogeneous purification of 7

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

the minor antennae requires harsher detergent treatment and several steps, which can lead to pigment loss. This hypothesis was supported by the observation that LHCII purified by isoelectrofocusing (a method commonly used for the purification of the minor antennae [21, 39]), was binding one Chl a and one xanthophyll less than the complex purified by sucrose gradient [23]. Moreover, the recent structural data on the PSII supercomplexes [12] has shown that several pigments are located at the interface between the complexes, and their properties (including their binding) can then be influenced by proteinprotein interactions. To purify the complexes in mild conditions and to avoid, or at least limit, pigment loss, we have complemented the ko mutants of CP24 [29] and CP29 with the genes carrying the sequence of an his-tag. In addition, we have compared the pigment composition and the spectroscopic properties of the individual complexes with those of their assembly: CP29-LHCII-CP24. The data reveals that the mildly purified CP29 has the almost complete occupation of 13 Chls and 3 carotenoid binding sites. The three carotenoids are associated with the three binding sites, L1 which is occupied by lutein, L2 by violaxanthin and N1 by neoxanthin, as suggested previously [10, 40]. Regarding the Chl binding sites, the stoichiometry suggests the presence of 9 Chls a and 3 Chls b binding sites, plus one site which has mixed occupancy or is only partially occupied in the purified complex. It is interesting to note that even if in vivo this site is fully occupied by Chl b, the Chl a/b ratio of the complex would be 2.25, which is still higher than the ratio reported for the crystallized complex, namely 1.89. The two available structures of CP29 contain both 13 Chls, however, while in the crystal structure of the isolated protein Chl 616 is absence [41], CP29 in the C2S2 supercomplex lacks Chl 614 [12]. It is likely that Chl 614 is present in our purified complex as H212 was shown to be a ligand for Chl in the reconstituted complex [34]. Chl 616 is most likely not present in the isolated complex as it is bound at the interface between CP29 and CP47 [12] and can thus be easily lost upon purification. The comparison of the properties of the CP29-LHCII-CP24 assembly with those of the individual antennas reveals a very similar Chl content (note that the presence of one additional Chl a or b in the assembly would have a large effect on the Chl a/b ratio of the complex). Similarly, the absorption properties of the assembly do not differ substantially from that of the sum of the complexes. Only the CD spectrum shows a large variation in the amplitude of the negative component at 678 nm, suggesting that the interaction between the pigments changes or new interactions are created between some of the pigments. This result is in agreement with the observed shortening of the excited state lifetime of the assembly, which is compatible with a tighter packing of the pigments as observed for LHCII in liposomes [42] and in PSII supercomplexes in the presence and absence of detergent [6]. On the other hand, the carotenoid composition of the assembly differs from that of the individual complexes, showing the same Chl/car ratio, but a descrease in neoxanthin, which is compensated by the presence of one molecule of β-carotene. β-carotene was found associated with the PSII/PSI core complexes and with the N1 site of the Lhcas [11, 43], but was never found associated with Lhcbs. It is thus possible that this carotene is located at the interface between the proteins and its binding is thus stabilized by protein-protein interactions. More puzzling is the reduction of neoxanthin, as this xanthophyll is present in 1:1 stoichiometry in both CP29 and LHCII. However, it is known that LHCII M is enriched in Lhcb3 as compared to the other LHCII trimers [44, 45], and Lhcb3 has a lower affinity for neoxanthin [23]. It is thus possible that during purification neoxanthin is lost from the N1 site of Lhcb3, which is enriched in trimer M. Neoxanthin is instead stably bound to Lhcb1 and b2 which are the main components of the isolated LHCII trimers [46]. The relatively higher error in the determination of 8

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

neoxanthin in this complex, indeed suggests that it is lost during isolation. The amount of lutein in the CP29-LHCII-CP24 complex is also slightly lower (- 9%) than in the sum of the complexes. Lutein is tighly bound to the L1 and L2 sites in LHCII and the L1 site in CP29 and CP24. This gives 8 luteins per CP29LHCII-CP24 complex. The additional lutein in LHCII is in the loosely binding sites V1 which also accomondate violaxanthin [23]. Considering that the amount of violaxanthin slightly higher in the complex than in the sum of the components, it is possible that again Lhcb3 has lower affinity for lutein in the V1 site compared to Lhcb1 and 2. More important, the increase of violaxanthin in the assembly compared to the sum of the complex is very small and can be fully attributed to the stabilization of the binding in the V1 site of LHCII, but the absence of additional violaxanthin indicates that the V1 site is not present in CP29 and CP24. The structure of PSII supercomplexes [4, 12] show that Chl 612 and 603 of CP29 might be important for energy transfer between complexes (Fig. 6). In particular, Chl 612 is facing one of the monomers of LHCII-M, while Chl 603 is located in between CP29 and the core. The excited state energy of these Chls can then be an important factor in determining the efficiency of the transfer. Studies on other PSII antenna complexes have shown that Chl 612 is the lowest energy site of the complexes, while Chl 603 is higher in energy [17, 37, 47, 48]. Mutation analysis on CP29 has indicated that the lowest energy site is on the Chl cluster containing Chl 612 [34] as in the other Lhcbs [49]. Feng et al. arrived at the same conclusion analyzing and modeling the spectroscopic properties of the purified complex [50]. Our data shows that, differently from LHCII, these two Chls are almost isoenergetic in CP29 which can be related to the role of this protein in connecting the peripheral antenna with the core. In the PSII supercomplex CP29 binds an extra Chl, Chl 616, which is not present in the structure of the isolated CP29 [41] and that we think it is also not present in our preparation as it is bound at the interface between CP29 and CP47 and can easily be lost when CP29 is disconnected from CP47. Moreover, the ligand of this Chl is located in the flexible N-terminus and it has been shown before by in vitro reconstitution that the absence of the N-terminus of CP29 does not lead to loss of Chls [51]. However, it is possible that in the supercomplex Chl 616 is lower in energy than the other CP29 Chls facilitating the transfer of excitation energy from the peripheral antenna to the core.

Acknowledgements This work was supported by De Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO), Earth and Life Sciences (ALW), through a Vici grant and by the European Research Council through the ERC consolidator grant 281341 (ASAP) (to RC).

9

ACCEPTED MANUSCRIPT Figure captions

RI

PT

Fig. 1. Map of C2S2M2. Architecture of PSII as seen from the stromal side of the membrane. The map is based on the PDB file: 5MDX [5]. The dimeric PSII core is shown in red, the minor antennae in marine blue, trimers S and M in cyan and violet, respectively, chlorophylls are in green.

SC

Fig. 2. SDS-PAGE of isolated light-harvesting complexes. 1 μg of chlorophyll was loaded in each line. (1: CP29-LHCII-CP24, 2: LHCII, 3: CP29-603, 4: CP29-612, 5: CP29-His, 6: CP24-His)

D

MA

NU

Fig. 3. Absorption, Circular Dichroism (CD) and Fluorescence emission spectra of CP29-His, CP29-612 and CP29-603. (A) Absorption of CP29-WT, CP29-612 and CP29-603, normalized to the chlorophyll content (Table 1). (B) CD of CP29-His, CP29-612 and CP29-603, normalized by their normalized absorption. (C) The absorption difference spectra. (D) Fluorescence emission spectra upon excitation at 475 nm. The spectra are normalized to their maximum.

AC CE P

TE

Fig. 4. Absorption and Circular Dichroism spectra of CP24, CP29, LHCII and CP29-LHCII-CP24 complex. (A) The absorption spectra are normalized based on their chlorophyll content. (B) CD spectra were normalized to their normalized absorption.

Fig. 5. RT fluorescence emission spectra of the CP29-LHCII-CP24 complex and its subunits. Samples were excited at 475 nm and normalized to their maximum.

Fig. 6. Map of CP29-LHCII-CP24 complex. PSII dimeric core is shown as surface in gray and the outer antennas are shown as cartoons. The CP29-LHCII-CP24 complex is labeled with a red circle and shown in color. Chls are shown in green. The map is based on the cryo-EM structures of C2S2 [12] and C2S2M2 [5].

10

ACCEPTED MANUSCRIPT References

AC CE P

TE

D

MA

NU

SC

RI

PT

[1] S. Jansson, E. Pichersky, R. Bassi, B.R. Green, M. Ikeuchi, A. Melis, D.J. Simpson, M. Spangfort, L.A. Staehelin, J.P. Thornber, A Nomenclature for the Genes Encoding the Chlorophyll a/b-Binding Proteins of Higher Plants, Plant Mol Biol Rep, 10 (1992) 242-253. [2] E.J. Boekema, H. van Roon, F. Calkoen, R. Bassi, J.P. Dekker, Multiple types of association of photosystem II and its light-harvesting antenna in partially solubilized photosystem II membranes, Biochemistry, 38 (1999) 2233-2239. [3] R. Croce, H. van Amerongen, Light-harvesting and structural organization of Photosystem II: from individual complexes to thylakoid membrane, J Photochem Photobiol B, 104 (2011) 142-153. [4] S. Caffarri, R. Kouril, S. Kereiche, E.J. Boekema, R. Croce, Functional architecture of higher plant photosystem II supercomplexes, Embo J, 28 (2009) 3052-3063. [5] L.S. van Bezouwen, S. Caffarri, R.S. Kale, R. Kouril, A.W.H. Thunnissen, G.T. Oostergetel, E.J. Boekema, Subunit and chlorophyll organization of the plant photosystem II supercomplex, Nat Plants, 3 (2017) 17080. [6] S. Caffarri, K. Broess, R. Croce, H. van Amerongen, Excitation energy transfer and trapping in higher plant Photosystem II complexes with different antenna sizes, Biophys J, 100 (2011) 2094-2103. [7] D.I. Bennett, K. Amarnath, G.R. Fleming, A structure-based model of energy transfer reveals the principles of light harvesting in photosystem II supercomplexes, J Am Chem Soc, 135 (2013) 9164-9173. [8] S. Jansson, A guide to the Lhc genes and their relatives in Arabidopsis, Trends in Plant Science, 4 (1999) 236240. [9] Z. Liu, H. Yan, K. Wang, T. Kuang, J. Zhang, L. Gui, X. An, W. Chang, Crystal structure of spinach major lightharvesting complex at 2.72 A resolution, Nature, 428 (2004) 287-292. [10] X. Pan, M. Li, T. Wan, L. Wang, C. Jia, Z. Hou, X. Zhao, J. Zhang, W. Chang, Structural insights into energy regulation of light-harvesting complex CP29 from spinach, Nat Struct Mol Biol, 18 (2011) 309-315. [11] Y. Mazor, A. Borovikova, I. Caspy, N. Nelson, Structure of the plant photosystem I supercomplex at 2.6 A resolution, Nat Plants, 3 (2017) 17014. [12] X. Wei, X. Su, P. Cao, X. Liu, W. Chang, M. Li, X. Zhang, Z. Liu, Structure of spinach photosystem II-LHCII supercomplex at 3.2 A resolution, Nature, 534 (2016) 69-74. [13] C.D. Duffy, A.V. Ruban, W. Barford, Theoretical investigation of the role of strongly coupled chlorophyll dimers in photoprotection of LHCII, J Phys Chem B, 112 (2008) 12508-12515. [14] S. Georgakopoulou, G. van der Zwan, R. Bassi, R. van Grondelle, H. van Amerongen, R. Croce, Understanding the changes in the circular dichroism of light harvesting complex II upon varying its pigment composition and organization, Biochemistry, 46 (2007) 4745-4754. [15] H.G. Duan, A.L. Stevens, P. Nalbach, M. Thorwart, V.I. Prokhorenko, R.J.D. Miller, Two-Dimensional Electronic Spectroscopy of Light-Harvesting Complex II at Ambient Temperature: A Joint Experimental and Theoretical Study, J Phys Chem B, 119 (2015) 12017-12027. [16] G.S. Schlau-Cohen, G.R. Fleming, Structure, Dynamics, and Function in the Major Light-Harvesting Complex of Photosystem II, Aust J Chem, 65 (2012) 583-590. [17] V.I. Novoderezhkin, M.A. Palacios, H. van Amerongen, R. van Grondelle, Excitation dynamics in the LHCII complex of higher plants: modeling based on the 2.72 Angstrom crystal structure, J Phys Chem B, 109 (2005) 10493-10504. [18] A. Dreuw, P.H.P. Harbach, J.M. Mewes, M. Wormit, Quantum chemical excited state calculations on pigmentprotein complexes require thorough geometry re-optimization of experimental crystal structures, Theor Chem Acc, 125 (2010) 419-426. [19] T. Henrysson, W.P. Schroder, M. Spangfort, H.E. Akerlund, Isolation and Characterization of the Chlorophylla/B Protein Complex Cp29 from Spinach, Biochimica Et Biophysica Acta, 977 (1989) 301-308. [20] E. Giuffra, D. Cugini, R. Croce, R. Bassi, Reconstitution and pigment-binding properties of recombinant CP29, Eur J Biochem, 238 (1996) 112-120. [21] P. Dainese, R. Bassi, Subunit stoichiometry of the chloroplast photosystem II antenna system and aggregation state of the component chlorophyll a/b binding proteins, J Biol Chem, 266 (1991) 8136-8142. [22] A. Pascal, C. Gradinaru, U. Wacker, E. Peterman, F. Calkoen, K.D. Irrgang, P. Horton, G. Renger, R. van Grondelle, B. Robert, H. van Amerongen, Spectroscopic characterization of the spinach Lhcb4 protein (CP29), a minor light-harvesting complex of photosystem II, Eur J Biochem, 262 (1999) 817-823.

11

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

[23] S. Caffarri, R. Croce, J. Breton, R. Bassi, The major antenna complex of photosystem II has a xanthophyll binding site not involved in light harvesting, J Biol Chem, 276 (2001) 35924-35933. [24] E.J.G. Peterman, S. Hobe, F. Calkoen, R. vanGrondelle, H. Paulsen, H. vanAmerongen, Low-temperature spectroscopy of monomeric and trimeric forms of reconstituted light-harvesting chlorophyll a/b complex, BbaBioenergetics, 1273 (1996) 171-174. [25] M.D. Curtis, U. Grossniklaus, A gateway cloning vector set for high-throughput functional analysis of genes in planta, Plant Physiology, 133 (2003) 462-469. [26] S. de Bianchi, N. Betterle, R. Kouril, S. Cazzaniga, E. Boekema, R. Bassi, L. Dall'Osto, Arabidopsis mutants deleted in the light-harvesting protein Lhcb4 have a disrupted photosystem II macrostructure and are defective in photoprotection, Plant Cell, 23 (2011) 2659-2679. [27] S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana, Plant J, 16 (1998) 735-743. [28] X. Zhang, R. Henriques, S.S. Lin, Q.W. Niu, N.H. Chua, Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method, Nature protocols, 1 (2006) 641-646. [29] F. Passarini, P. Xu, S. Caffarri, J. Hille, R. Croce, Towards in vivo mutation analysis: knock-out of specific chlorophylls bound to the light-harvesting complexes of Arabidopsis thaliana - the case of CP24 (Lhcb6), Biochim Biophys Acta, 1837 (2014) 1500-1506. [30] P. Xu, L. Tian, M. Kloz, R. Croce, Molecular insights into Zeaxanthin-dependent quenching in higher plants, Sci Rep, 5 (2015) 13679. [31] R. Croce, G. Zucchelli, F.M. Garlaschi, R.C. Jennings, A thermal broadening study of the antenna chlorophylls in PSI-200, LHCI, and PSI core, Biochemistry, 37 (1998) 17355-17360. [32] F. Passarini, E. Wientjes, R. Hienerwadel, R. Croce, Molecular basis of light harvesting and photoprotection in CP24: unique features of the most recent antenna complex, J Biol Chem, 284 (2009) 29536-29546. [33] H. van Amerongen, R. Croce, Light harvesting in photosystem II, Photosynth Res, 116 (2013) 251-263. [34] R. Bassi, R. Croce, D. Cugini, D. Sandona, Mutational analysis of a higher plant antenna protein provides identification of chromophores bound into multiple sites, Proc Natl Acad Sci U S A, 96 (1999) 10056-10061. [35] F.G. Plumley, G.W. Schmidt, Light-harvesting chlorophyll a/b complexes: Interdependent pigment synthesis and protein assembly, Plant Cell, 7 (1995) 689-704. [36] H. Paulsen, B. Finkenzeller, N. Kuhlein, Pigments Induce Folding of Light-harvesting Chlorophyll a/b binding Protein Eur.J.Biochem., 215 (1993) 809-816. [37] H. Rogl, R. Schodel, H. Lokstein, W. Kuhlbrandt, A. Schubert, Assignment of spectral substructures to pigmentbinding sites in higher plant light-harvesting complex LHC-II, Biochemistry, 41 (2002) 2281-2287. [38] F.J. Kleima, S. Hobe, F. Calkoen, M.L. Urbanus, E.J. Peterman, R. van Grondelle, H. Paulsen, H. van Amerongen, Decreasing the chlorophyll a/b ratio in reconstituted LHCII: structural and functional consequences, Biochemistry, 38 (1999) 6587-6596. [39] A.V. Ruban, A.J. Young, A.A. Pascal, P. Horton, The Effects of Illumination on the Xanthophyll Composition of the Photosystem II Light-Harvesting Complexes of Spinach Thylakoid Membranes, Plant Physiol, 104 (1994) 227234. [40] S. Caffarri, F. Passarini, R. Bassi, R. Croce, A specific binding site for neoxanthin in the monomeric antenna proteins CP26 and CP29 of Photosystem II, FEBS Lett, 581 (2007) 4704-4710. [41] X. Pan, Z. Liu, M. Li, W. Chang, Architecture and function of plant light-harvesting complexes II, Curr Opin Struct Biol, 23 (2013) 515-525. [42] A. Natali, J.M. Gruber, L. Dietzel, M.C.A. Stuart, R. van Grondelle, R. Croce, Light-harvesting Complexes (LHCs) Cluster Spontaneously in Membrane Environment Leading to Shortening of Their Excited State Lifetimes, Journal of Biological Chemistry, 291 (2016) 16730-16739. [43] Y. Umena, K. Kawakami, J.R. Shen, N. Kamiya, Crystal structure of oxygen-evolving photosystem II at a resolution of 1.9 A, Nature, 473 (2011) 55-60. [44] E. Wientjes, H. van Amerongen, R. Croce, Quantum yield of charge separation in photosystem II: functional effect of changes in the antenna size upon light acclimation, J Phys Chem B, 117 (2013) 11200-11208. [45] P. Galka, S. Santabarbara, T.T. Khuong, H. Degand, P. Morsomme, R.C. Jennings, E.J. Boekema, S. Caffarri, Functional analyses of the plant photosystem I-light-harvesting complex II supercomplex reveal that lightharvesting complex II loosely bound to photosystem II is a very efficient antenna for photosystem I in state II, Plant Cell, 24 (2012) 2963-2978.

12

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

[46] S. Caffarri, R. Croce, L. Cattivelli, R. Bassi, A look within LHCII: differential analysis of the Lhcb1-3 complexes building the major trimeric antenna complex of higher-plant photosynthesis, Biochemistry, 43 (2004) 9467-9476. [47] R. Remelli, C. Varotto, D. Sandona, R. Croce, R. Bassi, Chlorophyll binding to monomeric light-harvesting complex. A mutation analysis of chromophore-binding residues, J Biol Chem, 274 (1999) 33510-33521. [48] M. Ballottari, M. Mozzo, R. Croce, T. Morosinotto, R. Bassi, Occupancy and functional architecture of the pigment binding sites of photosystem II antenna complex Lhcb5, J Biol Chem, 284 (2009) 8103-8113. [49] M. Mozzo, F. Passarini, R. Bassi, H. van Amerongen, R. Croce, Photoprotection in higher plants: the putative quenching site is conserved in all outer light-harvesting complexes of Photosystem II, Biochim Biophys Acta, 1777 (2008) 1263-1267. [50] X. Feng, X. Pan, M. Li, J. Pieper, W. Chang, R. Jankowiak, Spectroscopic study of the light-harvesting CP29 antenna complex of photosystem II--part I, J Phys Chem B, 117 (2013) 6585-6592. [51] M. Gastaldelli, G. Canino, R. Croce, R. Bassi, Xanthophyll binding sites of the CP29 (Lhcb4) subunit of higher plant photosystem II investigated by domain swapping and mutation analysis, J Biol Chem, 278 (2003) 1919019198.

13

TE AC CE P

Figure 1

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

14

Figure 2

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

15

AC CE P

Figure 3

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

16

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

Figure 4

17

AC CE P

Figure 5

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

18

AC CE P

Figure 6

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

19