A2 genotype

Alcohol 24 (2001) 15 – 23

Further investigation of citalopram on alcohol consumption in heavy drinkers: responsiveness possibly linked to the DRD2 A2/A2 genotype Matts Erikssona, Ulf Berggrena, Kaj Blennowa, Claudia Fahlkeb, Jan Balldina,* a

Institute of Clinical Neuroscience, Department of Psychiatry and Neurochemistry, Go¨teborg University, Sahlgren University Hospital/Mo¨lndal, SE-431 80 Mo¨lndal, Sweden b Department of Psychology, Go¨teborg University, Go¨teborg, Sweden Received 18 February 2000; received in revised form 19 January 2001; accepted 31 January 2001

Abstract Citalopram, a selective serotonin reuptake inhibitor, has been suggested to reduce alcohol intake, at least in some studies. The present study aimed to replicate our earlier finding that citalopram reduces alcohol intake only in subjects with a weekly consumption ranging between 300 and 800 g of pure alcohol. Subjects (n = 37) in this study were therefore randomized into a double-blind treatment with either 40 mg of citalopram daily or placebo for a 4-week period. Another purpose was to investigate whether different measures of central neurotransmission might predict an effect of citalopram or placebo on alcohol consumption. Therefore, prolactin response to d-fenfluramine, platelet monoamine oxidase-B activity, as well as the genotype of the dopamine D2 receptor (DRD2), A1 and A2 alleles, were determined and related to individual changes in alcohol consumption. Citalopram was not found to be superior to placebo in reducing alcohol intake. Prolactin responses to d-fenfluramine and levels of platelet monoamine oxidase-B activities were not related to changes in alcohol consumption, regardless of treatment with citalopram or placebo. When subjects were grouped according to the presence or absence of the DRD2 A1 allele, those with the genotype DRD2 A2/A2 were found to transiently reduce their alcohol consumption during citalopram treatment. This finding seems to indicate that, in subjects with heavy alcohol consumption, possession of the genotype DRD2 A2/A2 may be prerequisite for a treatment effect of citalopram. D 2001 Elsevier Science Inc. All rights reserved. Keywords: Citalopram; Alcohol intake; Serotonin; DRD2

1. Introduction Selective serotonin reuptake inhibitors (SSRIs) have been shown to reduce alcohol intake in rodents (e.g., Engel et al., 1992; Sellers et al., 1992; see also Maurel et al., 1999) and in nonhuman primates (Higley & Bennett, 1999). The results of clinical studies seem to have indicated a central serotonergic dysfunction in people with high alcohol consumption (for review, see LeMarquand et al., 1994). Thus, lower cerebrospinal fluid (CSF) levels of the serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) have been found in abstinent alcoholics (Ballenger et al., 1979; Banki, 1981; Borg et al., 1985). Moreover, recent * Corresponding author. Tel.: +46-31-343-23-72; fax: +46-31-34323-48. E-mail address: [email protected] (J. Balldin). Editor: S. Borg

studies have extended these findings by linking serotonin metabolism with age of onset for alcoholism. The results of studies of persons with early onset of alcoholism (i.e., type 2; see Cloninger et al., 1981) have thus demonstrated that low levels of 5-HIAA in CSF are associated with this type of alcoholism (Fils-Aime et al., 1996; Virkkunen & Linnoila, 1990). Furthermore, in subjects with alcohol dependence or heavy drinking, the results of several studies have demonstrated reduced hormonal responses to serotoninreleasing agents or receptor agonists both during an active drinking period (Balldin et al., 1994a) and during abstinence from drinking (Buydens-Branchey et al., 1997; Lee & Melzer, 1991). The results of clinical double-blind placebo-controlled studies with SSRIs in people with heavy drinking or alcohol dependence have shown either a moderate decrease in alcohol consumption (Gorelick & Paredes, 1992; Naranjo & Sellers, 1989; Naranjo et al., 1984, 1987, 1989, 1990,

0741-8329/01/$ – see front matter D 2001 Elsevier Science Inc. All rights reserved. PII: S 0 7 4 1 - 8 3 2 9 ( 0 1 ) 0 0 1 3 7 - 9

16

M. Eriksson et al. / Alcohol 24 (2001) 15–23

1992, 1995; Sellers et al., 1992; Tiihonen et al., 1996) or no effect compared with findings for placebo (Balldin et al., 1994b; Kabel & Petty, 1996; Kranzler et al., 1995). In one study, treatment with fluoxetine even seemed to reduce the beneficial effect of cognitive – behavioral therapy (Kranzler et al., 1996) in heavy drinkers of type B (Babor et al., 1992). In some of these studies large interindividual variations in the response pattern to SSRIs have been observed (Balldin et al., 1994b; Naranjo et al., 1984, 1987), suggesting that at least a subgroup might respond to treatment. In an earlier double-blind crossover study (Balldin et al., 1994b), we found that citalopram reduced alcohol intake in a subgroup of heavy drinkers with a daily consumption between 60 and 100 g of pure alcohol (mean baseline alcohol intake: 85 ± 15 g per day). The amount of alcohol was reduced on drinking days, but no decrease was found in number of days of alcohol intake. The present study was designed to investigate whether findings from our earlier study (Balldin, 1994b) could be replicated. The effect of citalopram, 40 mg daily, versus placebo was therefore investigated in men with a reported average weekly consumption similar to that of the responders in our earlier study — that is, between 300 and 800 g of pure alcohol. Another purpose was to investigate whether different aspects of central neurotransmission might be related to such an effect of citalopram on alcohol consumption. Therefore, platelet monoamine oxidase B (MAO-B) activities and prolactin (PRL) responses to d-fenfluramine were assessed and related to individual changes in alcohol consumption. In addition, because the study included a placebo group, the biological markers could also be related to changes in alcohol consumption in a group that was without any influence of an SSRI. The results of molecular genetic studies seem to indicate that variation of the gene encoding the dopamine D2 receptor (DRD2) confers vulnerability to addiction. Thus, an increased prevalence of carriers of the DRD2 A1 allele was reported in subjects with alcoholism and other addiction disorders. Several subsequent studies have replicated these findings, whereas other studies have not found such association (for review, see Noble, 1998). Alcoholics who are

carriers of the A1 allele of the DRD2 gene have been suggested to have reduced numbers of brain dopamine D2 receptors (Noble, 1998). The subjects with the A1 allele have been reported to experience a more salutary effect of dopaminergic agents, such as the DRD2 agonist bromocriptine (Lawford et al., 1995). We therefore determined the DRD2 genotype to investigate whether the effects of citalopram and placebo on alcohol consumption differ between subjects carrying the DRD2 A2 or DRD2 A1 allele.

2. Materials and methods 2.1. Subjects Male subjects (25 – 65 years of age) were recruited by advertisement in a local newspaper. They had to be socially stable (i.e., employed or living on a pension and with a permanent place of residence) and without any physical and psychiatric disorders not associated with alcohol intake, including abuse or dependence on other substances. Their ongoing alcohol consumption had to be between 300 and 800 g of pure alcohol per week. Thirty-seven subjects were, during telephone interviews, found to meet these criteria and could therefore proceed to a screening visit. 2.2. Study design The design of the study is presented in Fig. 1. 2.2.1. Screening visit The study started with a screening visit that included a physical examination. A structured interview was held concerning demographics and present and earlier physical and psychiatric health problems, including substance abuse or dependence or both. Anxiety and depressive symptoms were assessed by using the Hamilton Anxiety Scale [HAS; total sum of scores ranging from 0 to 56 (Hamilton, 1959)] and the Hamilton Depression Scale [HDS; total sum of scores ranging from 0 to 52 (Hamilton, 1967)]. Subjects were diagnosed for alcohol abuse or dependence according

Fig. 1. The design of the present study. Shown are the different visits and study periods.

M. Eriksson et al. / Alcohol 24 (2001) 15–23

to the DSM-IV criteria (American Psychiatric Association, 1994). Blood samples were drawn for assessment of hematological, liver (including carbohydrate-deficient transferrin [CDT]), and renal functions together with drug analyses of urine for determination of narcotic drugs (including benzodiazepines). Blood was also collected for determination of platelet MAO-B activity and type of DRD2 A allele. Alcohol consumption for the 2 weeks preceding the screening visit was assessed by using the timeline follow-back (TLFB) method (Sobell et al., 1988). The TLFB requires subjects to provide retrospective estimates of their alcohol consumption of a specified time period. The reliability of this procedure has been established with several different populations of alcoholics. 2.2.2. Baseline period After the screening visit, the subjects had to report their alcohol consumption for 2 weeks until the day of the challenge test. Thus, for each day, the subjects were instructed to record their alcohol consumption on a selfmonitoring form called alco-card. This card consists of eight columns, with a graphic display of various sizes of bottles, cans, and glasses and six rows of various types of liquor, wine, and beer (Balldin, 1994b). Subjects also used this procedure to record their daily alcohol consumption during the medication and postmedication periods. 2.2.3. Challenge test d-Fenfluramine challenge tests were performed at the end of the 2-week baseline period after a night of fasting. No smoking or alcohol intake was allowed in the morning of the day of the challenge test, which started at 9:00 a.m. Blood samples for determination of PRL were collected at time-point 0 and every 60 min thereafter for 4 h. d-Fenfluramine hydrochloride (Isomeride) was administered orally in a dose of 30 mg at time 0. 2.2.4. Medication and postmedication periods The medication period started about 2 weeks after the challenge test to prevent influences of d-fenfluramine on alcohol consumption and any possible interaction with the trial medication. This period was designed as a doubleblind placebo-controlled parallel study. Before the start of medication, the subjects were randomly allocated to receive either 40 mg of citalopram (2
20 mg) or placebo (containing lactose) once daily during a treatment period of 4 weeks. At this visit, each subject was given a box of 60 tablets for the treatment period. The box was to be returned to the investigator at the end of the medication period, and the remaining tablets were counted. Antihypertensive drugs and hypnotics (alimemazine or propiomazine) but no other psychotropic drugs were allowed during this treatment period. The medication period was terminated with a visit, in which adverse drug reactions were registered, alco-cards were collected, and blood samplings for the assessment of liver function

17

and CDT were drawn. The following 2-week postmedication period was terminated with a visit for the collection of alco-cards and for the assessment of liver function and CDT. 2.2.5. Follow-up visit The subjects were monitored 8 to 12 months after the last study visit, and their alcohol consumption in the 2 preceding weeks was estimated according to the TLFB technique. Liver parameters and CDT were analyzed on this occasion. 2.3. Biochemical analyses 2.3.1. Liver function and CDT Liver-function tests were performed with the use of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and g-glutamyltransferase (GGT). Upper laboratory reference limits for all these parameters were 0.8 mkat/l. CDT was analyzed at the same time points as those for the liver function tests (upper laboratory reference limit: 1.7%). 2.3.2. Prolactin Prolactin was analyzed by a double-antibody radioimmunoassay (Diagnostic Products Corp., Los Angeles, CA). 2.3.3. Monoamine oxidase B activity Levels of MAO-B activity were determined according to ˚ kefeldt and Ma˚nsson (1998) with b-phenylethylamine as A substrate. The laboratory mean ± S.D. value for platelet MAO-B activity in healthy controls (aged 25– 55 years) ˚ kefeldt & Ma˚nsson, 1998). was 5.1 ± 1.3 mkat/kg protein (A 2.3.4. DRD2 allele The DRD2 TaqA polymerase chain reaction (PCR) was performed as described by Grandy et al. (1993) with minor modifications. Briefly, genomic DNA was extracted from venous blood samples, and the DRD2 gene was amplified by PCR with the use of the primers 50CCGTCGACGGCTGGCCAAGTTGTCTA and 5 0CCGTCGACCCTTCCTGAGTGTCATCA. The 310 base-pair (bp) PCR product was cleaved with Taq1, resulting in cleavage of the DRD2-2 allele into two fragments of 180 and 130 bp, whereas the DRD2-1 allele was not cleaved. 2.4. Statistical analyses Data obtained from subjects who failed to record their consumption on the alco-cards for a period of l week or more or who returned more tablets than the number allotted for 1 week of medication were excluded. For each person, the average intake of alcohol (grams of pure alcohol per day) was calculated in each period of the investigation (baseline period, medication period, and postmedication period). Two-way analysis of variance (ANOVA; StatView,

18

M. Eriksson et al. / Alcohol 24 (2001) 15–23

3. Results

the subjects were homeless. Ages were 51 ± 6 years; height, 181 ± 6 cm; and weight, 91 ± 13 kg. At the physical examination, two subjects were found to have a slight hepatomegaly and one had gynecomasty. Heart rate was 79 ± 11 beats per minute. Mean systolic and diastolic blood pressures were 147 ± 18/86 ± 8 mmHg. There were no differences in background data between the citalopram and placebo groups. DSM-IV criteria for alcohol dependence were met by 73% (citalopram, n = 11; placebo, n = 13). The remaining subjects met only one or two of the DSM-IV criteria for alcohol dependence; that is, they were ‘‘diagnostic orphans,’’ according to Hasin and Paykin (1999) and Pollock and Martin (1999). None were found to meet the DSMIV criteria for alcohol abuse. No differences were seen in scores of anxiety or depressive symptoms according to HAS and HDS between the groups. The total sum of HAS scores for the citalopram group was 7.1 ± 7.8 and for the placebo group was 6.1 ± 6.5; that for HDS was 4.0 ± 4.7 and 2.5 ± 2.0, respectively. Hematological and renal parameters were all within normal range.

3.1. Background data

3.2. Liver-function tests and CDT

Data obtained from 33 of the 37 Caucasian men included in this study could be statistically evaluated (citalopram, n = 16; placebo, n = 17). The reasons for exclusions were insufficient intake of tablets or failure to report daily alcohol intake (two subjects in the citalopram group) and failure to return to agreed-on visits (two subjects in the placebo group). The statistically evaluated subjects reported drinking problems for 12 ± 10 years, and 49% were nicotine users. Seventy-three percent were married or cohabitant. Ninetyfour percent were employed and 6% had pensions. None of

Repeated measures of ANOVA showed no main effects on liver function parameters or on CDT between the two groups during the study (Table 1). There was, however, a between-group difference when values of each visit were analyzed separately. At the end of the medication period, the citalopram group had lower ALT levels compared with findings for the placebo group (t = 2.21, P < .05). Withingroup comparisons in the citalopram group showed significant increases in AST and ALT (t = 2.42, P < .05, and t = 2.73, P < .02, respectively), comparing the screening

Abacus) with repeated measures was used to analyze treatment effects on alcohol consumption and liver parameters. Between-group comparisons (background data, alcohol consumption, and liver parameters) were made by using Student t test, and within-group comparisons were made with the paired t test. To analyze the correlations between levels of platelet MAO-B activities and PRL responses to d-fenfluramine, respectively, versus changes in alcohol consumption between the baseline and the 4-week medication period, Pearson’s product– moment correlation was used. DPRL was calculated as the differences between baseline levels (time 0 or the lowest level thereafter) and the highest levels of PRL. Data were corrected according to Bonferroni when appropiate. Two-tailed levels of significance were used. The data are presented as mean ± S.D. This study was approved by the Ethics Committee of Go¨ teborg University, Sweden. Informed consent was obtained from all subjects.

Table 1 Values for liver function parameters (mean ± S.D.) in subjects investigated at start of baseline (screening visit), at end of medication period, at end of postmedication period, and 8 – 12 months after medication period Start of baseline (screening visit)

End of medication period

End of postmedication period

8 – 12 months after medication

AST (mkat/l; 0.2 – 0.8) Citalopram Placebo

0.46 ± 0.18 0.61 ± 0.37

0.54 ± 0.24 0.70 ± 0.60

0.59 ± 0.35a 0.87 ± 0.49

0.51 ± 0.31 0.83 ± 0.63

ALT (mkat/l; 0.2 – 0.8) Citalopram Placebo

0.59 ± 0.27 0.98 ± 0.66

0.63 ± 0.32b 1.06 ± 0.68

0.84 ± 0.50a 1.39 ± 0.94

0.74 ± 0.45 1.18 ± 0.88

GGT (mkat/l; <0.8) Citalopram Placebo

1.39 ± 1.55 1.39 ± 0.88

1.37 ± 1.48 1.56 ± 1.02

1.81 ± 1.75 1.86 ± 1.16

2.26 ± 2.21 1.65 ± 0.94

CDT (%; <1.7) Citalopram Placebo

2.22 ± 1.72 2.01 ± 1.37

3.01 ± 3.18 2.56 ± 2.04

3.20 ± 4.77 2.69 ± 1.72

2.92 ± 3.08 2.17 ± 1.51

AST, asparate aminotransferase; ALT, alanine aminotransferase; GGT, gamma-glutamyltransferase; CDT, carbohydrate-deficient transferrin. Laboratory reference values are given within brackets. a P < .05 within citalopram group: start of baseline versus end of postmedication period. b P < .05 citalopram versus placebo.

M. Eriksson et al. / Alcohol 24 (2001) 15–23

visit values with values at the postmedication visit. There were no within-group differences at any time in the placebo group. 3.3. Effect of citalopram or placebo treatment on alcohol consumption As seen in Table 2, the levels of alcohol consumption during the 2 baseline weeks were similar in the citalopram and the placebo groups. Repeated measurement with ANOVA for baseline and each of the 4 medication weeks revealed no significant effect of group
time for alcohol consumption. The mean daily alcohol consumption during the 4-week medication period was 78 ± 45 g of pure alcohol in the citalopram group and 86 ± 38 g in the placebo group, a reduction in mean values from baseline of 19% and 6%, respectively. During the first medication week, the citalopram group reduced its mean daily alcohol consumption by 25%. In the placebo group, the reduction was only 1%. During the fourth medication week, this reduction was 9% and 13%, respectively. Within-group calculations showed no differences between consumption levels during baseline compared with those in each of the 4 medication weeks or with those in the postmedication period in either group. Nor were any differences observed in comparisons of the two treatment groups during baseline, each of the 4 medication weeks, or the postmedication period. Neither were there any differences in alcohol consumption between citalopram and placebo when only subjects with alcohol dependence according to DSM-IV were included. In the citalopram group, 11 subjects decreased and 4 subjects increased their alcohol consumption in a comparison of baseline with the 4-week medication period. The corresponding numbers for the placebo group were 11 and 6, respectively. The two treatment groups were therefore divided into four subgroups: subjects given citalopram who increased or decreased their alcohol consumption and those given placebo who increased or decreased alcohol consumption (i.e., on the basis of differences between the baseline period and the 4-week medication period). Within-group comparisons showed that decreased alcohol consumption was significant in both groups (citalopram, t = 3.41, P < .01; placebo, t = 3.38, P < .01). Reduction in mean daily alcohol consumption in the citalopram group was thus 40% and in the placebo group 21%, a difference that nearly achieved significance (t = 2.01, P = .07). Among

19

those subjects who increased their alcohol consumption, a significance was observed only in the citalopram group (t = 3.90, P < .01). In the citalopram group, the most commonly reported side effects were nausea (41%), asthenia, dizziness, increased sweating (24%, respectively), gastrointestinal disturbances, diminished sexual desire (18%, respectively) and headache (6%), whereas 24% experienced no side effects. In the placebo group, few side effects were reported (nausea, headache, insomnia, anorexia, and depression [6%, respectively]), whereas 76% reported no side effects at all. All side effects in the citalopram group were assessed by the subjects as being moderate to severe but were reversible and disappeared within 1 or 2 days after the end of the medication. 3.4. Platelet MAO-B activity and results of d-fenfluramine challenge tests versus alcohol consumption Platelet MAO-B activity was 5.2 ± 1.9 mkat/kg of protein in the total group (n = 33). There was no difference in platelet MAO-B activity between nicotine users and nonusers (5.2 ± 1.7 and 5.2 ± 2.0 mkat/kg of protein, respectively). Neither was there any difference in platelet MAO-B activity between subjects given citalopram or placebo. No correlation was observed between levels of platelet MAO-B activities and individual changes in alcohol consumption. In the d-fenfluramine challenge tests, baseline serum PRL values were 119 ± 63 mU/l for the citalopram group and 156 ± 52 mU/l for the placebo group (not significant). A comparison of serum PRL levels between the two treatment groups during the period of the challenge test showed a significant main effect only for time (Table 3). Thus, regardless of groups, d-fenfluramine had a significant drug effect on the hormone levels [ F (1,145) = 22.56, P < .0001]. There were no differences in PRL levels at any time point or in DPRL between the groups after d-fenfluramine administration. For either group, no correlations were observed between DPRL, as calculated in two different ways (see Section 2.4.) and changes in alcohol consumption over time. 3.5. DRD2-A2/A2 genotype and alcohol consumption Of the 33 subjects, 8 were carriers of the DRD2 A1 allele, 4 in each treatment group. When only subjects with

Table 2 Daily alcohol consumption (mean ± S.D.; grams of pure alcohol) in a 2-week baseline period, weekly in a 4-week medication period, and in a 2-week postmedication period in subjects treated with citalopram (n = 16) and placebo (n = 17)

Citalopram Placebo

Baseline period

Medication period

2 weeks

Week 1

Week 2

Week 3

Week 4

Postmedication period 2 weeks

96 ± 42 92 ± 46

72 ± 46 91 ± 41

69 ± 44 92 ± 44

79 ± 55 91 ± 55

87 ± 80 80 ± 49

79 ± 58 97 ± 45

No significant differences were observed between the two groups during the study period.

20

M. Eriksson et al. / Alcohol 24 (2001) 15–23

Table 3 Prolactin serum concentrations (milliunits per liter) during d-fenfluramine challenge tests performed before the medication period in the citalopram and the placebo groups. d-Fenfluramine hydrochloride (Isomeride) was administered orally in a dose of 30 mg at time 0 (baseline). Time (minutes) 0

60

120

180

240

300

Citalopram 158 ± 42 116 ± 57 105 ± 44 125 ± 54 174 ± 68 167 ± 66 Placebo 116 ± 63 95 ± 55 89 ± 52 133 ± 77 164 ± 94 161 ± 70 Blood samples for determination of prolactin levels were collected at the time-point 0 and every 60 min thereafter for 4 h. Comparison of serum prolactin levels between the two treatment groups showed only a significant main effect for time, regardless of groups [ F (1, 110) = 15, 86; P < .0001; repeated measurement with analysis of variance]. Data are presented as mean ± S.D.

difference only between baseline and week 4 (t = 2.31, P < .05). There were no differences in platelet MAO-B activities or DPRL, as calculated in two different ways (see Section 2.4.), between the citalopram group and the placebo group. Neither were there any correlations between MAO-B activities or DPRL and changes in alcohol consumption in either group. Concerning liver values and CDT, there were significant differences only for AST at the screening visit (placebo, 1.23 ± 1.05; citalopram, 0.54 ± 0.14 mkat/l; t = 2.24, P < .05) and for GGT at end of the postmedication period (placebo, 1.74 ± 1.13; citalopram, 0.88 ± 0.40 mkat/l; t = 2.13, P < .05). 3.6. Follow-up

the genotype DRD2 A2/A2 were included in the statistical evaluation of the effect of medication on alcohol consumption, repeated measurement with ANOVA revealed no significant effect of group
time. However, in comparisons of the citalopram group with the placebo group each week of the medication period, there was a tendency toward a reduction of alcohol consumption in the citalopram group during week 1 (t = 2.08, P = .06), and there was a significant reduction during week 2 (t = 3.76, P < .01; Fig. 2). No significant differences between the treatment groups were found during baseline, treatment weeks 3 and 4 and the 2week postmedication period. Within-group comparisons for the citalopram group comparing baseline with medicationperiod week 1 showed a trend toward reduced alcohol consumption (t = 2.05, P = .07) and a significant reduction in week 2 (t = 2.71, P < .02). There were no differences when comparing baseline with weeks 3 and 4 and the postmedication period. In the placebo group, there was a

The subjects were invited to a follow-up visit 8 to 12 months after the end of the study period. Only 23 subjects returned (citalopram, n = 11; placebo, n = 12). No differences were found in background data, demographics, baseline alcohol consumption, or levels of liver parameters between the follow-up group and the drop-out group (n = 14). The subjects who attended the follow-up visit had to retrospectively estimate their alcohol consumption for the 2 weeks preceding their follow-up visits according to TLFB. A significant positive correlation between the TLFB estimates of alcohol consumption at the screening and the follow-up visits was found (r = 0.48, P < .05). Likewise, there were significant positive correlations for values of liver parameters and CDT between these two visits (AST, r = 0.63, P < .01; ALT, r = 0.60, P < .01; GGT, r = 0.90, P < .01; CDT, r = 0.90, P < .01). No differences were seen between the citalopram - and placebo - treated groups.

Fig. 2. Daily alcohol consumption (mean ± S.D.; grams of pure alcohol) during the baseline period, each week of the 4-week medication period, and the 2-week postmedication period in the citalopram group and the placebo group. Only subjects with the genotype DRD2 A2/A2 are included. (*) P = .06; ** P < .01 (Student t test).

M. Eriksson et al. / Alcohol 24 (2001) 15–23

4. Discussion In the present study, we could not replicate the finding in our earlier study (Balldin, 1994b), in which subjects, who regularly consumed as much as about 100 g of pure alcohol daily, reduced their alcohol intake by taking the SSRI citalopram. The figures for mean daily alcohol consumption were indeed reduced by 19% during the 4-week citalopram medication period compared with only 6% in the placebo group, although without statistically significant differences. The reason for this lack of effect of citalopram may be the larger variance in baseline levels of alcohol intake compared with the findings for our earlier study (Balldin, 1994b). For the present study, a power analysis (Colton, 1974) was based on figures for baseline mean ± S.D. from our earlier study (Balldin, 1994b). Because the figure for variance during baseline was found to be about two times as large in the present study, the possibility of finding the effects of citalopram may have been limited. In the present study, as well as in our earlier study (Balldin, 1994b) and in other earlier studies (Naranjo et al., 1987, 1995), we found a wide interindividual response pattern after medication with placebo as well as with citalopram. These different response patterns should therefore be analyzed in more detail. In this study, 27% of the subjects given citalopram and 38% given placebo increased their alcohol consumption during the medication period, although a statistical significance was found only in the citalopram group. It could therefore be argued that citalopram could in some subjects even stimulate a higher consumption of alcohol. This possibility led us to reevalute data from our earlier citalopram study (Balldin, 1994b). In that study, 6 of 27 subjects (22%) in the citalopram group increased their alcohol consumption during the first 5week medication period (from baseline 88 ± 40 to 109 ± 39 g of pure alcohol during the medication weeks; P < .05). In the placebo group, 10 of 29 subjects (34%) increased their alcohol consumption significantly from 85 ± 39 to 103 ± 33 g of pure alcohol daily ( P < .01). Taken together, findings obtained from these two studies indicate that citalopram, as well as placebo, may, in some people, increase alcohol consumption. Furthermore, it seems notable that, in some people, citalopram does not even counteract an increase in alcohol consumption. Neither of the two indices of central neurotransmission — the PRL response to d-fenfluramine or the MAO-B activity — was found to predict any changes in alcohol consumption either in the group given citalopram or in those receiving placebo. A conclusion based on these data should therefore be that these indices, whatever type neurotransmission they might represent, are not associated with changes in drinking behavior. That the reduction of alcohol consumption after citalopram could be related to PRL responses was found in one of our studies in which DPRL values after the administration of dl-fenfluramine were found to correlate with a decrease in alcohol intake

21

(Berggren et al., in press). The fact that, in the present study, PRL levels decreased transiently in the first part of the test and only thereafter increased to maximum levels may indicate that the dose of d-fenfluramine could have been too small. When determing the alleles for the DRD2 genotypes, we found that 22% of this sample of subjects were carriers of the A1 allele. This percentage is in line with that for controls in a meta-analysis conducted by Noble (1998) of 15.7% carrying the DRD2 A1 allele and with that of a Swedish study by Geijer et al. (1994) of about 20% (after control for abuse or dependence or both as well as other psychiatric diagnoses). Inasmuch as a high frequency of the DRD2 A1 allele is associated with severe somatic complications (Noble, 1998), the present study population could be expected to be without such complications. This expectation is also confirmed by the fact that the subjects in the present study had about 10 years of harmful levels of alcohol intake but were without signs of somatic or psychiatric complications. After exclusion of the four subjects with the DRD2 A1 allele in each medication group, we found statistical evidence for a treatment effect of citalopram on alcohol consumption but not for those given placebo. The transient effect of citalopram was strengthened by the significant correlations for alcohol consumption, liver parameters, and CDT between the start of the baseline period and the followup visit. Similar transient treatment effects of SSRIs have been reported for citalopram (Naranjo et al., 1995) and for fluoxetine (Gorelick & Paredes, 1992). The present results could be used to argue for a hypothesis that treatment effects, although transient, with the SSRI type of medication on high consumption of alcohol are found only in people having the A2/A2 genotype. Such a prerequisite for a treatment effect might be a more general phenomenon, because carriers of the A1 allele seem to have more severe medical complications (Noble, 1998). The A1 group of subjects could therefore hypothetically be more resistant to different treatment interventions. On the other hand, Lawford et al. (1995) showed that inpatients with the A1 allele are more prone to reduce craving and anxiety after treatment with the DRD2 agonist bromocriptine. Concerning our previous results showing that citalopram is effective in reducing intake in those who consume between 60 and 100 g of pure alcohol daily (Balldin, 1994b), one may speculate whether that random sample included a larger proportion of subjects having the DRD2 A2/A2 genotype than did the present study. Such determinations were, however, not performed in that study. Subjects who are carriers of the A1 allele (A1/A1 or, alternatively, A1/A2) may have a reduction in the number of DRD2 receptors in comparison with those who possess the A2/A2 genotype of the DRD2 receptor gene (Noble, 1998). The finding in the present study that only subjects with the A2/A2 genotype showed reduction, although transient, in alcohol consumption may therefore indicate that unaltered central dopamine neurotransmission is a prerequisite for the

22

M. Eriksson et al. / Alcohol 24 (2001) 15–23

alcohol-reducing effect of citalopram. It should in this context be noted that, in animal experiments, pretreatment with the serotonin synthesis inhibitor parachlorophenylalanine or the serotonin neurotoxin 5,7-dihydroxytryptamine does not counteract the alcohol-reducing effects of SSRIs. These findings have led some investigators to suggest that SSRIs decrease alcohol intake through nonserotonergic mechanisms (LeMarquand et al., 1994). It should be noted that levels of alcohol consumption in the placebo group were almost stable and comparable to the baseline levels during the first 3 weeks of the medication period. This lack of placebo effect seems surprising but is followed by a late (week 4) and transient (the postmedication period was similar to the other periods and weeks) decrease in alcohol consumption. This decrease late in the medication period seems difficult to explain but may have reduced the possibility of detecting the treatment effects of citalopram in the present study. In conclusion, this study could not replicate our earlier finding (Balldin, 1994b) of a treatment effect of citalopram in a group of heavy drinkers. However, we found a responsiveness possibly linked to the DRD2 genotypes. Thus, subjects possessing the DRD2 A2/A2 genotype showed a slight (about 20%) and transient reduction in ongoing alcohol consumption during treatment with citalopram. This finding may be of only minor clinical significance but could, on the other hand, indicate that another treatment schedule with, for example, intermittent medication of SSRI might be of value in reducing, stepby-step, regular and harmful alcohol consumption by heavy drinkers.

Acknowledgments This study was supported by grants from the Swedish Council for Research in Humanities and Social Sciences (HSFR - F0416-1999).

References ˚ kefeldt, A., & Ma˚nsson, J. E. (1998). Is monoamine oxidase activity A elevated in Prader – Willi syndrome? Eur Child Adolesc Psychiatry 7, 163 – 165. American Psychiatric Association. (1994). Diagnostic and Statistical Manual of Mental Disorders (4th ed.). Washington, DC: American Psychiatric Association Press. Babor, T. F., Hofmann, M., DelBoca, F. K., Hesselbrock, V., Meyer, R. E., Dolinsky, Z. S., & Rounsaville, B. (1992). Types of alcoholics, I: evidence for an empirically derived typology based on indicators of vulnerability and severity. Arch Gen Psychiatry 49, 599 – 608. Balldin, J., Berggren, U., Engel, J., & Eriksson, M. (1994a). Neuroendocrine evidence for reduced serotonergic neurotransmission during heavy drinking. Alcohol Clin Exp Res 18, 822 – 825. Balldin, J., Berggren, U., Engel, J., Eriksson, M., Ha˚rd, E., & So¨derpalm, B. (1994b). Effect of citalopram on alcohol intake in heavy drinkers. Alcohol Clin Exp Res 18, 1133 – 1136.

Ballenger, J. C., Goodwin, F. K., Major, L. F., & Brown, G. L. (1979). Alcohol and central serotonin metabolism in man. Arch Gen Psychiatry 36, 224 – 227. Banki, C. M. (1981). Factors influencing monoamine metabolites and tryptophan in patients with alcohol dependence. J Neural Transm 50, 89 – 101. Berggren, U., Eriksson, M., Fahlke, C., & Balldin, J. (In press). Relationship between central serotonergic neurotransmission and reduction in alcohol intake by citalopram. Drug and Alcohol Dependence. Borg, S., Kvande, H., Liljeberg, P., Mossberg, D., & Valverius, P. (1985). 5-Hydroxyindoleacetic acid in cerebrospinal fluid in alcoholic patients under different clinical conditions. Alcohol 2, 415 – 418. Buydens-Branchey, L., Branchey, M., Fergeson, P., Hudson, J., & McKernin, C. (1997). Hormonal, psychological, and alcohol craving changes after m-chlorophenylpiperazine administration in alcoholics. Alcohol Clin Exp Res 21, 220 – 226. Cloninger, C. R., Bohman, M., & Sigvardsson, S. (1981). Inheritance of alcohol abuse. Cross-fostering analysis of adopted women. Arch Gen Psychiatry 38, 861 – 868. Colton, T. (1974.). Statistics in Medicine. Boston: Little, Brown. Engel, J. A., Enerback, C., Fahlke, C., Hulthe, P., Ha˚rd, E., Johannessen, K., Svensson, L., & So¨derpalm, B. (1992). Serotonergic and dopaminergic involvement in ethanol intake. In C. A. Naranjo, & E. M. Sellers (Eds.), Novel Pharmacological Interventions for Alcoholism ( pp. 68 – 82). New York: Springer-Verlag. Fils-Aime, M. L., Eckardt, M. J., George, D. T., Brown, G. L., Mefford, I., & Linnoila, M. (1996). Early-onset alcoholics have lower cerebrospinal fluid 5-hydroxyindoleacetic acid levels than late-onset alcoholics. Arch Gen Psychiatry 53, 211 – 216. Geijer, T., Neiman, J., Rydberg, U., Gyllander, A., Jo¨nsson, E., Sedvall, G., Valverius, P., & Terenius, L. (1994). Dopamine D2-receptor gene polymorphisms in Scandinavian chronic alcoholics. Eur Arch Psychiatry Clin Neurosci 244, 26 – 32. Gorelick, D. A., & Paredes, A. (1992). Effect of fluoxetine on alcohol consumption in male alcoholics. Alcohol Clin Exp Res 16, 261 – 265. Grandy, D. K., Zhang, Y., & Civelli, O. (1993). PCR detection of the TaqA RFLP at the DRD2 locus. Hum Mol Genet 2, 2197. Hamilton, M. (1959). The assessment of anxiety states by rating. Br J Psychol 32, 50 – 55. Hamilton, M. (1967). Development of a rating scale for primary depressive illness. Br J Soc Clin Psychol 6, 278 – 296. Hasin, D., & Paykin, A. (1999). Dependence symptoms but no diagnosis: diagnostic ‘‘orphans’’ in a 1992 national sample. Drug Alcohol Depend 53, 215 – 222. Higley, J. D., & Bennett, A. J. (1999). Central nervous system serotonin and personality as variables contributing to excessive alcohol consumption in non-human primates. Alcohol Alcohol 34, 402 – 418. Kabel, D. I., & Petty, F. (1996). A placebo-controlled, double-blind study of fluoxetine in severe alcohol dependence: adjunctive pharmacotherapy during and after inpatient treatment. Alcohol Clin Exp Res 20, 780 – 784. Kranzler, H. R., Burleson, J. A., Brown, J., & Babor, T. F. (1996). Fluoxetine treatment seems to reduce the beneficial effects of cognitive – behavioral therapy in type B alcoholics. Alcohol Clin Exp Res 20, 1534 – 1541. Kranzler, H. R., Burleson, J. A., Korner, P., Del Boca, F. K., Bohn, M. J., Brown, J., & Liebowitz, N. (1995). Placebo-controlled trial of fluoxetine as an adjunct to relapse prevention in alcoholics. Am J Psychiatry 152, 391 – 397. Lawford, B. R., Young, R. M., Rowell, J. A., Qualichefski, J., Fletcher, B. H., Syndulko, K., Ritchie, T., & Noble, E. P. (1995). Bromocriptine in the treatment of alcoholics with the D2 dopamine receptor A1 allele. Nat Med 1, 337 – 341. Lee, M. A., & Melzer, H. Y. (1991). Neuroendocrine responses to serotonergic agents in alcoholics. Biol Psychiatry 30, 1017 – 1030. LeMarquand, D., Pihl, R. O., & Benkelfat, C. (1994). Serotonin and alcohol intake, abuse, and dependence: clinical evidence. Biol Psychiatry 36, 326 – 337.

M. Eriksson et al. / Alcohol 24 (2001) 15–23 Maurel, S., De Vry, J., & Schreiber, R. (1999). Comparison of the effects of the selective serotonin-reuptake inhibitors fluoxetine, paroxetine, citalopram and fluvoxamine in alcohol-preferring cAA rats. Alcohol 17, 195 – 201. Naranjo, C. A., Bremner, K. E., & Lanctoˆt, K. L. (1995). Effects of citalopram and a brief psycho-social intervention on alcohol intake, dependence and problems. Addiction 90, 87 – 99. Naranjo, C. A., Kadlec, K. E., Sanhueza, P., Woodley-Remus, D., & Sellers, E. M. (1990). Fluoxetine differentially alters alcohol intake and other consummatory behaviors in problem drinkers. Clin Pharmacol Ther 47, 490 – 498. Naranjo, C. A., Poulos, C. X., Bremner, K. E., & Lanctoˆt, K. L. (1992). Citalopram decreases desirability, liking, and consumption of alcohol in alcohol-dependent drinkers. Clin Pharmacol Ther 51, 729 – 739. Naranjo, C. A., & Sellers, E. M. (1989). Serotonin uptake inhibitors attenuate ethanol intake in problem drinkers. In M. Galanter (Ed.), Recent Developments in Alcoholism (Vol. 7, pp. 255 – 266). New York: Plenum. Naranjo, C. A., Sellers, E. M., Roach, C. A., Woodley, D. V., SanchezCraig, M., & Sykora, K. (1984). Zimelidine-induced variations in alcohol intake by nondepressed heavy drinkers. Clin Pharmacol Ther 35, 374 – 381. Naranjo, C. A., Sellers, E. M., Sullivan, J. T., Woodley, D. V., Kadlec, K.,

23

& Sykora, K. (1987). The serotonin uptake inhibitor citalopram attenuates ethanol intake. Clin Pharmacol Ther 41, 266 – 274. Naranjo, C. A., Sullivan, J. T., Kadlec, K. E., Woodley-Remus, D. V., Kennedy, G., & Sellers, E. M. (1989). Differential effects of viqualine on alcohol intake and other consummatory behaviors. Clin Pharmacol Ther 46, 301 – 309. Noble, E. P. (1998). The D2 dopamine receptor gene: a review of association studies in alcoholism and phenotypes. Alcohol 16, 33 – 45. Pollock, N. K., & Martin, C. S. (1999). Diagnostic orphans: adolescents with alcohol symptoms who do not qualify for DSM-IV abuse or dependence diagnoses. Am J Psychiatry 156, 897 – 901. Sellers, E. M., Higgins, G. A., & Sobel, M. B. (1992). 5-HT and alcohol abuse. Trends Pharmacol Sci 13, 69 – 75. Sobell, L. C., Sobell, M. B., Leo, G. I., & Cancilla, A. (1988). Reliability of a timeline method: assessing normal drinkers’ reports of recent drinking and a comparative evaluation across several populations. Br J Addict 83, 393 – 402. Tiihonen, J., Ryyna¨nen, O. P., Kauhanen, J., Hakola, H. P. A., & Salaspuro, M. (1996). Citalopram in the treatment of alcoholism: a double-blind placebo-controlled study. Pharmacopsychiatry 29, 27 – 29. Virkkunen, M., & Linnoila, M. (1990). Serotonin in early onset, male alcoholics with violent behaviour. Ann Med 22, 327 – 331.