Fushen Granule, A Traditional Chinese Medicine, ameliorates intestinal mucosal dysfunction in peritoneal dialysis rat model by regulating p38MAPK signaling pathway

Journal Pre-proof Fushen Granule, A Traditional Chinese Medicine, ameliorates intestinal mucosal dysfunction in peritoneal dialysis rat model by regulating p38MAPK signaling pathway Chen Jiang, Wei Lin, Lingyun Wang, Yang Lv, Yu Song, Xin Chen, Hongtao Yang PII:

S0378-8741(19)32889-2

DOI:

https://doi.org/10.1016/j.jep.2019.112501

Reference:

JEP 112501

To appear in:

Journal of Ethnopharmacology

Received Date: 19 July 2019 Revised Date:

12 November 2019

Accepted Date: 22 December 2019

Please cite this article as: Jiang, C., Lin, W., Wang, L., Lv, Y., Song, Y., Chen, X., Yang, H., Fushen Granule, A Traditional Chinese Medicine, ameliorates intestinal mucosal dysfunction in peritoneal dialysis rat model by regulating p38MAPK signaling pathway, Journal of Ethnopharmacology (2020), doi: https://doi.org/10.1016/j.jep.2019.112501. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.

Fushen Granule, A Traditional Chinese Medicine, Ameliorates Intestinal Mucosal Dysfunction in Peritoneal Dialysis Rat Model by Regulating p38MAPK Signaling Pathway Chen Jiang1, Wei Lin1, Lingyun Wang2, Yang Lv1, Yu Song1, Xin Chen1 and Hongtao Yang1* 1

Department of Nephrology, First Teaching Hospital of Tianjin University of

Traditional Chinese Medicine, Tianjin, P. R. China 2

Division of Nephrology, Department of Medicine, Nephrology Research and

Training Center, University of Alabama at Birmingham, Birmingham, AL ,U.S.A.

*Correspondence to Hongtao Yang, M.D., Chief Physician, Department of Nephrology, First Teaching Hospital of Tianjin University of Traditional Chinese Medicine, 88 Changling Road, Xi Qing District, Tianjin 300384, P.R. China. Tel: 86-22-27986565, Fax: 86-22-27986079, E-mail: [email protected]

List of all authors’ email addresses Chen Jiang: [email protected] Wei Lin: [email protected] Lingyun Wang: [email protected] Yang Lv: [email protected] Yu Song: [email protected] Xin Chen: [email protected] Hongtao Yang: [email protected]

1

ABSTRACT Ethnopharmacological relevance: Fushen Granule (FSG) is a Chinese medicinal formular prepared in hospital to treat intestinal mucosal dysfunction induced by peritoneal dialysis (PD). However, the mechanisms of this formular has not been studied yet. Aim of the study: The present study was designed to investigate the effect of FSG against intestinal dysfunction during PD treatment and explore the potential mechanisms using a rat PD model. Methods and Methods: In the present study, the effect of FSG on improving intestinal mucosal architecture injury was intuitively shown by hematoxylin-eosin staining, the serum levels of DAO and D-lactate were measured to evaluate the intestinal permeability by the DAO Assay Kit and D-Lactic Acid ELISA Kit. The expression of the intestinal mucosal barrier related inflammation factor by real-time PCR. The main effective constituents of FSG were characterized by UPLC/Q-TOF analysis, and the targets and pathways of the constituents were predicted via TCMSP database and IPA. the activation of p38MAPK signaling pathway by western blotting. Results: HE staining results showed that FSG protected against intestinal mucosal injury in pathology in PD rats. FSG decreased the intestinal mucosal permeability by increasing the transepithelial electrical resistance (TER) level and decreasing the intestinal clearance of fluorescein-isothiocyanate dextran (FD4) and the level of D-lactate and diamine oxidase (DAO). FSG significantly dencreased the expression of ICAM-1, IL-1β, iNOS and TNF-α, and further inhibited the activation of p38MAPK 2

signalling pathway via down-regulating the expression of P-p38MAPK and up-regulating the expression of DUSP1, occludin, and ZO-1. Conclusion: This study demonstrates that FSG ameliorated intestinal mucosal dysfunction in PD by decreasing expression of pro-inflammatory cytokines and inhibiting the activation of p38MAPK signalling pathway. The results provide a promising basis for the alternative medicine treatment of intestinal mucosal dysfunction in PD. Keywords: Intestinal mucosal dysfunction; Peritoneal dialysis; Chinese herbal medicine; p38MAPK.

3

Introduction Chronic kidney disease (CKD) is becoming a global epidemic disease that could result from kidney injury and resultant end-stage renal disease (ESRD) would be the eventual outcome. Peritoneal dialysis (PD) is an important cost-effective and high

quality renal replacement therapy for patients with ESRD (Wong et al., 2017). PD was usually performed by hyper-osmolarity fluid into the peritoneal cavity (Jeffs et al., 2017), and the PD effluent could remove the net solutes and water from the ESRD patient (Vaziri et al., 2013). Due to long-term PD treatment, the abdominal cavity is always in a high pressure and high glucose environment. These factors accompanied with the uremic microinflammatory in ESRD result in intestinal dysfunction and mucosal injury. The intestinal injury leads to a series of complications including endogenous peritonitis, abdominal infection, malnutrition, gastrointestinal disorders, and inadequate dialysis (Kahvecioglu et al., 2005; Mizuno et al., 2014; Naini et al., 2016). The destroied barrier function and increaseing intestinal permeability are the important gut alterations under the pathophysiological status of ESRD. Because of the intestinal permeability increaseing, some macromolecular substances (e.g. Diamine oxidase (DAO), endotoxin and D-lactate) could pass through the intestinal mucosal barrier into the circulation, and then induce a series of inflammation (Terpstra et al., 2016;Vaziri et al., 2016). During the intestinal mucosal injury, the expression of inflammatory factors (e.g. Tumor necrosis factor-β (TNF-β) and interleukin-1 (IL-1)) would increase in intestinal mucosal tissue. Moreover, the destruction of tight junction between intestinal mucosal epithelial cells 4

also reflects the injury of intestinal mucosal barrier. Nevertheless, the underlying mechanisms of intestinal mucosal dysfunction in PD patients remain unclear. Intestinal dysfunction can be characterized by constipation, diarrhea, abdominal distension and even abdominal pain. Nowadays, probiotics and gastroprokinetic agents are always used to regulate intestinal dysfunction. However, the effects of these drugs on preventing peritonitis and regulating intestinal function of PD patients have not been demonstrated. Treatment strategies which effectively attenuate the intestinal mucosal barrier dysfunction are in great request. Intestinal mucosal injury can be characterized by mucosal epithelial mechanical barrier injury resulting in increased mucosal permeability. The activation of inflammatory factor can destroy the tight junction, thus damage the mucosal mechanical barrier. The p38 mitogen-activated protein kinase (MAPK), as an intracellular signal transducer, plays an important role in cell differentiation, apoptosis, migration, proliferation and inflammation (Maher, 1999; Welsh et al., 2005; Zhu et al., 2016). Recent research indicates that the activation of MAPK signaling pathway is related to intestinal mucosal barrier dysfunction(Ouyang et al., 2016). The activation of p38MAPK signaling pathway in intestinal epithelial cells could active the inducible nitric oxide synthase (iNOS) and nitric oxide (NO) signals, and then affects the expression and rearrangement of tight junction protein, which leads to the increase of intestinal barrier permeability. Nevertheless, rare study was conducted in improvements of intestinal mucosal dysfunction induced by PD. Natural medicine products played an important role in treatment of 5

gastrointestinal dysfunction in China. As an important form of complementary alternative therapy, Chinese herb combinations have been used for thousands of years. Due to the lack of effective and safe treatment strategies for the PD patients with intestinal mucosal barrier destroyed, treatment with combination of Chinese herbal aqueous extracts is feasible. Chinese herbal concoctions have been used to treat intestinal diseases for years with primarily anecdotal evidence of success. Fushen Granule (FSG, composed of salviae miltiorrhizae radix et rhizoma (Danshen in Chinese, 30g), citri reticulatae pericarpium (Chenpi in Chinese, 10g), Astragali radix (Huangqi in Chinese, 15g), pinelliae rhizoma (Banxia in Chinese, 15g), et al.), was approved as a hospital preparations in the first affiliated hospital of tianjin university of TCM for the treatment of PD related to intestinal dysfunction in ESRD patients. Our previous clinical trials demonstrated that FSG significantly improved the nutritional status and intestinal dysfunction of PD patients with intestinal dysfunction (Meiying et al., 2016; Yang et al., 2012). In addition, FGS can improve peritoneal fibrosis of PD rats by reducing the generation of the peritoneal advanced glycation end-products (AGEs), and regulate the expression of Glo-1 to protect the residual kidney function and delay peritoneal fibrosis (Tang G. et al., 2017; Tang G. et al., 2018). However, the mechanism of this Chinese herbal combination action for treatment of intestinal dysfunction in PD is not clear.

6

Materials and Methods Reagents and drugs Fushen Granule (batch number: 140928) was provided by First Teaching Hospital of Tianjin University of Traditional Chinese Medicine (Tianjin, China) according to the guidelines of Good Manufacturing Practice and Good Laboratory Practice of pharmaceutical factory. FSG was dissolved in distilled water. Then, FSG solution was used for intragastric administration (2.02g FSG/ml). The rats’ dose was calculated as 9ml/kg/d according to the clinical equivalent dose between human and rat within method experimental methodology of TCM pharmacology. 1.5% Lactate peritoneal dialysis solution (1.5% LPDS) and 4.25% Lactate peritoneal dialysis solution (4.25% LPDS) were purchased from Guangzhou Baxter Medical Products Co., Ltd. (Guangzhou, China). 4% paraformaldehyde was obtained from the Shanghai Haling Biological Technology Co., Ltd., (Shanghai, China). Peritoneal dialysis model and drug administration Adult Sprague-Dawley rats (180 ± 20 g) were purchased from Beijing Huafukang Bioscience (Beijing, China). The animal experimental procedures were conducted in accordance with recommendations of the Guidance Suggestions for the Laboratory Animal Ethics Committee of Tianjin University of Traditional Chinese Medicine (Permit Number: TCM-LAEC20170023). The rats were randomly divided into two groups: control group (group A, sham operation, 10 rats) and PD model groups (5/6 nephrectomy, 65 rats). For the PD model groups, the chronic renal failure was induced by 5/6 nephrectomy (Platt Method). The upper and lower 1/3 of the right kidney were 7

ligated to induce infarction, and the left kidney was removed after one week, (Yucel et al., 2014). The rats were housed under controlled environmental conditions for 3 weeks (temperature 22.0 ± 1.5 °C; humidity 55% ± 5%; 12 hourly dark: light cycle with lights on at 7 a.m.) with free access to water and food. After 5/6 nephrectomy or sham operation, a reformative indwelling needle was implanted as a peritoneal catheter connected to peritoneal cavity into each rat. The 60 rats of peritoneal dialysis model group were randomly divided into 6 groups: Group B, PD treated with 1.5%LPDS (15 mL/kg); group C, 1.5%LPDS co-treatment with FSG; group D, PD with 4.25% LPDS (15 mL/kg); group E, 4.25% LPDS

co-treatment with FSG; group F (High dose group), 1.5% LPDS group (25

mL/kg); and group G, co-treatment with FSG and high dose 1.5% LPDS group. The PD rats were treated with different dose and concentrate LPDS (2 hours each time, twice a day). The rats in the control group were treated with normal saline via the same way (Fig.1). Co-treatment rats were given intragastric administration of FSG solution (9ml/kg/d clinical equivalent dose), others were fed with equal amount of water. All groups were treated for 8 weeks. Collection of intestinal tissues and serum sample The rats were respectively sacrificed on the 0th, 8th and 12th weekend of the study. The abdominal cavity was opened and the serum was collected from the abdominal aorta. Then, segments of distal ileum were carefully collected. One-third of each distal ileum tissue was fixed in 4% paraformaldehyde for histologic evaluation, the remaining distal ileum tissue sample was stored at -80˚C for later analysis. 8

Histologic Evaluation The distal ileum tissue was fixed in 4% paraformaldehyde for 24 h, embedded in paraffinand and cut, then 3-µm sections were stained with hematoxylin-eosin (HE). The sections were blinded examined by a pathologist. Five horizons of intestinal mucosa were randomly tested in each HE staining slices. Then, the intestinal mucosa of rats width, height, crypt depth and count within 1 mm fluff number by quantitative measurement. The intestinal mucosal damage was evaluated by using the Chiu score method

(Chiu et al., 1970). Higher scores are interpreted to indicate more severe

damage. Criteria of Chiu grading system consists of 5 subdivisions according to the changes of villus and gland of intestinal mucosa: grade 0, normal mucosa; grade 1, development of subepithelial Gruenhagen's space at the tip of villus; grade 2, extension of the space with moderate epithelial lifting; grade 3, massive epithelial lifting with a few denuded villi; grade 4, denuded villi with exposed capillaries; and grade 5, disintegration of the lamina propria, ulceration and hemorrhage. Determination of intestinal mucosal permeability Diamine oxidase (DAO), an intestinal epithelial cell enzyme marker, is detected as the indicator of mucosal damage (Xue et al., 2017). D-lactate, which is metabolism produced by bacterial, are hardly detected in normal body circulation (Evdokimova et al., 2002; Yu et al., 2016). Therefore, the serum levels of DAO and D-lactate were checked to evaluate the intestinal permeability. In addition, the clearance of fluorescein-isothiocyanate dextran (FD4) of intestinal and the transepithelial electrical resistance (TER) of the intestinal mucosal was also assessed to evaluate the mucosal 9

permeability. The FD4 assay was performed according to previously protocol (Bao et al., 2014). The TER assay was performed as previously described (Li et al., 2017). Analysis of expression of the intestinal mucosal barrier related inflammation factor by real-time PCR Total RNA was extracted by RNA isolation kit (Roche, Basel, Switzerland) from distal ileum tissue sample and total cellular RNA (2.0µg) was reverse transcribed by TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, USA). The expression of intercellular cell adhesion molecule-1 (ICAM-1), TNF-α, IL-1β, and iNOS was assessed by using Real-time PCR. Gene expression were normalized by GAPDH in the same samples. The primers sequences (Table 1) were designed by Sangon Biotech (Shanghai, China). ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, USA) was used in the present study. The 2-∆∆CT method was used to determine the expression of related target genes. Analysis of the activation of p38MAPK signaling pathway by western blotting Total protein extraction kit (Thermo Scientific, MA, USA) was used to extract the distal ileum proteins and the proteins were quantified by using a BCA protein assay kit (Thermo Scientific, MA, USA). And then Western blot analysis was performed as previously described (Zhou, Sun, Tan, Liu, Qian, Ma, Wang, Wang and Gao, 2017). Briefly, proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes. 5% skim milk was used to block the nonspecific antibody binding. And then the PVDF membranes were subsequently incubated with the following antibodies overnight at 4°C: monoclonal 10

rabbit Anti-β-actin (45 kDa,1:1000, Cell Signaling Technology, UK), monoclonal rabbit Anti-P-p38MAPK (phosphor Thr180 and Tyr182, 43 kDa, 1:10000, Abcam, UK), monoclonal rabbit Anti-occludin (63 kDa, 1:10000, Abcam, UK), monoclonal rabbit Anti-ZO-1 (193 kDa, 1:10000, Abcam, UK) and monoclonal sheep Anti-DUSP1 (39 kDa, 1:10000, Abcam, UK). After that the membranes were washed and incubated with the secondary anti-rabbit and anti-sheep IgG antibodies (1:5000, Cell Signaling Technology, UK) for 1.5 hours at room temperature. Finally, the protein bands were checked by chemiluminescence (ECL, Thermo Scientific, MA, USA), and densitometric analyses were performed by using Scion Image software (Scion Corp, Frederick, MD, USA). Ultra Performance Liquid Chromatography (UPLC) analysis of FSG UPLC System (Waters Co., Milford, MA) with a photodiode array detector (PDAD) was emploied to analysis the compoents of FSG. Waters Acquity UPLC BEH C18 column (100mm×2.1mm×1.8um) was used to separate the sample. The column temperature was set at 30 °C, and the flow rate was held at 0.30 mL/min. The UV detection wavelength was 190-400 nm. The mobile phase A was aqueous solution, and B was acetonitrile with 0.1% formic acid. The gradient duration program was: 0-2 min, 25% B; 2-3 min, 25-30% B; 3-17 min, 30-35% B; 17-19 min, 35-25% B; 19-20 min, 25% B (Li et al., 2010). Q-TOF-MS analysis of FSG and targets prediction Waters Q/TOF Premier with an electrospray ionization (ESI) system (Waters MS Technologies, Manchester, UK) was emploied in the present study. The positive (3.0 11

kV) and negative (2.5 kV) mod of ESI-MS spectrume was acquired. the sample cone voltage was set to 30 V. The high-purity nitrogen was set to 600 L/h at 350 °C and the cone gas was 50 L/h. The source temperature was set at 110 °C. The Q-TOF Premier acquisition rate was 0.1 s, and the interscan delay was 0.02 s. Argon was used as the collision gas at a pressure of 5.3 × 10-5 Torr (Zeng et al., 2018). The CAS NO. of the chemical compositions in FSG were entered into the TCMSP database (http://lsp.nwu.edu.cn/tcmsp.php) for target prediction. And the pathways were determined via IPA. Statistical analysis The data are presented as the means ± standard error mean (SEM). All of the statistical analyses were performed using SPSS20.0 software. Statistical significance was assessed by one-way analysis of variance (ANOVA) followed by Tukey’s test. Values of P<0.05 were considered to be statistically significant.

Results Treatment with FSG protected against intestinal mucosal injury in pathology in PD rats The first part of the study was design to assess the effect of different dialysate doses and concentrations to intestinal mucosal injury and the protective effect of FSG. In order to find a model of intestinal injury caused by PD, we set up 1.5%LPDS (15ml/kg) group, 4.25%LPDS (15ml/Kg) group and 1.5%LPDS (25ml/kg) group. HE staining revealed a healthy intestinal mucosal architecture in distal ileum from rats in 12

A group (Fig.2 A1-A2); However, impaired intestinal mucosal architecture in varying degrees in distal ileum from rats in B, D and F group were found, as the intestinal villi were short, thick and even shedding, inflammatory cell infiltration and edema (Fig.2 B1-B2, D1-D2 and F1-F2). As shown in Fig.2 H, compared with the A group, the mucosal injury scores were significantly increased in the rats of B, D and F group (P<0.01), indicating intestinal mucosal injury treated with PD. Especially, compared with group B (1.5%LPDS, 15ml/Kg), the mucosal injury scores showed significantly increased with the increase in concentration and dose of peritoneal dialysate. Compared with baseline, we also found that the mucosal injury increased over time. Co-treatment with FSG significantly alleviated the degree of the impaired intestinal mucosal architecture in distal ileum from rats in C, E and G group, as smooth villus and healthy glands with few inflammatory cells infiltrating in the mucosal epithelial layer (Fig.2 C1-C2, E1-E2 and G1-G2), and the mucosal injury scores were significantly decreased (P<0.01). Based on these results, we obviously observed intestinal mucosal damage in the 1.5%LPDS (15ml/kg) group at 4th week. Meanwhile, to simulate the actual peritoneal dialysis, we chose the 1.5%LPDS (15ml/kg) group for further study. Treatment with FSG ameliorated indicator of intestinal mucosal damage and intestinal mucosal permeability Intestinal dysfunction causes an increased intestinal permeability, which possibly leads to some macromolecular substances such as diamine oxidase (DAO), endotoxin and D-lactate through the intestinal mucosal barrier into the circulation. FD4 and TER 13

are all indicators for evaluating intestinal mucosal permeability. As shown in Fig.3, compared with the control group, the serum levels of D-lactate, DAO and the intestinal clearance of FD4 were significantly increased at the same time of the study (4th week and 8th week) in rats treated with PD groups and those were significantly increased with the prolong of PD treatment (P<0.01); but the level of TER was significantly decreased with the prolong of the PD treatment (P<0.01). Compared with the 1.5%LPDS (15 mL) group, the serum levels of D-lactate, DAO and the calculating intestinal clearance of FD4 were significantly increased and the level of TER was significantly decreased in rats treated with 4.25%LPDS (15 mL) and 1.5%LPDS (25 mL) at the same time of the study (4th week and 8th week) (P<0.01). Co-treatment with FSG significantly decreased the serum levels of D-lactate, DAO and the calculating intestinal clearance of FD4 (P<0.01) and increased the level of TER (P<0.01). UPLC/Q-TOF-MS analysis and targets prediction of FSG In order to explore which components of FSG can protect intestinal mucosa and how to regulate the activation of inflammatory pathway, the composition of FSG was analyzed by UPLC/Q-TOF-MS analysis. After the assay, a total of 55 chemical compounds in FSG were identified or tentatively identified, which concluded 12 species of Huangqi, 11 species of Yinyanghuo, 3 species of Danggui, 6 species of Chenpi, 4 species of Banxia, 8 species of Dahuang, 8 species of Danshen and 2 species of Guijianyu (Fig.4 A). Then, the targets and pathway prediction were done via TCMSP database and IPA. The results showed that 55 ingredients in FSG were 14

predicted to regulate TGF-β2, MAPK1, BCL2, CSF2, IL-1 β, IL-6, JUN, MMP1, NOS2, PLAT, PTGS2, and TNF- α. Among of them, P38 MAPK and DUSP1 have a close relationship to the effect of FSG. Then, through further analysis by IPA (Fig.4 B), 10 compositions of FSG, including Emodin and Epicatechin, could regulate DUSP 1 and P38 MAPK via regulating BCL2, CSF2, IL-1β, IL-6, JUN, MMP1, NOS2, PLAT, PTGS2, TNF-α. FSG repressed high expression of inflammation factor in distal ileum tissue of PD rats The activation of various inflammatory factors in the process of intestinal injury is the main reason for the increase of intestinal permeability. According to the predicted targets and pathway, we detected the mRNA expression of inflammatory factors downstream of p38MAPK, and discussed the possible mechanism of FSG. As shown in Fig.5, compared with the control group, the mRNA expression of ICAM-1, IL-1β, iNOS and TNF-α significantly increased after PD treatment compared with control group (P<0.01); and those were significantly increased with the prolong of the PD treatment (P<0.01). Compared with the 1.5%LPDS (15mL) group, the mRNA expression of ICAM-1, IL-1β, iNOS and TNF-α were significantly increased in rats treated with 4.25%LPDS (15mL) or 1.5%LPDS (25mL) at the same time of the study (4th week and 8th week) (P<0.01). Co-treatment with FSG significantly decreased the mRNA expression of ICAM-1, IL-1β, iNOS and TNF-α (P<0.01). FSG ameliorated tight junction and regulated the activation of p38MAPK signaling pathway in PD rats 15

Tight junction is an important structure to maintain the mechanical barrier and permeability of intestinal mucosal epithelium. To investigate if the activation of inflammation factor results the tight junction damage, we then observed the expression of occludin and ZO-1, which are important components of tight junctions in the intestinal mucosa. As one of the important signaling in intestinal inflammatory, we evaluated the role of p38MAPK pathway in intestinal mucosa injury during PD. Dual-specific phosphatase 1 (DUSP1) is one of negative regulators of p38MAPK signaling at upstream of the MAPK pathway. As shown in Fig.6, compared with the control group, the PD treatment induced a significant increase in protein expression of P-p38MAPK and a significant decrease in protein expression of occludin, ZO-1 and DUSP1 (P<0.01) at the 8th week of the study. Co-treatment with FSG showed a marked decrease in protein expression of P-p38MAPK and a significant increase in protein expression of occludin, ZO-1 and DUSP1 (P<0.01).

Discussion Intestinal mucosal dysfunction is one of important pathogenic factors in disorders such as endogenous peritonitis and abdominal infection during long-term PD treatment (Kuo et al., 2006; Perakis et al., 2009). In this study, using a rat model of PD, we did see the intestinal mucosal injury by histologic evaluation, indicator of intestinal mucosal damage and intestinal mucosal permeability. We also found co-treatment with a novel combination of Chinese herbal medicine (FSG) could ameliorate intestinal mucosal dysfunction during PD treatment. The directly showed 16

that the mucosal injury scores of distal ileums from PD rats were significantly increased, indicating the intestinal mucosal architecture was obviously impaired. After co-treatment in vivo, the impaired intestinal mucosal architecture was significantly alleviated, revealing FSG could prevent intestinal mucosal dysfunction from long-term treatment with PD. The intestinal mucosal permeability is known to be closely related to intestinal mucosal function, which could significantly decrease when diarrhea, endogenous peritonitis, abdominal infection and colitis damage the intestinal epithelium (Balakrishnan and Chakravortty, 2017; Julian et al., 2011; Nagpal et al., 2006; Williams et al., 2016). Both the level of TER and FD4 are indices of intestinal mucosal permeability (Bao et al., 2014; He et al., 2016). TER is directly proportional to intestinal epithelial integrity, and increases in intestinal clearance of FD4 are followed by corresponding increases in intestinal permeability. Our results exhibited co-treatment with FSG significantly promoted the level of TER and inhibited the elevated intestinal clearance of FD4 compared with rats treated with PD, indicating FSG could decrease the intestinal mucosal permeability. In addition, D-lactate and DAO also were detected as indicators of intestinal mucosal permeability (Ji

et al.,

2017). When the permeability of the intestine is increased after bacterial infection, the levels of D-lactate, DAO and endotoxin will significantly increase, penetrate across intestinal barrier, and enter the circulation, resulting in an increased blood level of D-lactate, DAO and endotoxin (Li et al., 2017). In the present study, the levels of D-lactate and DAO in PD rats were significantly increased in a dose-dependent 17

manner. Co-treatment with FSG could significantly decrease levels of D-lactate, and DAO, demonstrating that FSG could progressively inhibit the decrease in intestinal mucosal permeability induced by long-term PD. FSG is consisted of eight herbs: Radix Astragali (Huangqi), Angelica (Danggui), Epimedium sagittatum (Yinyanghuo), Ramulus Euonymi (Guijianyu), Orange peel (Chenpi), Salvia miltiorrhiza (Danshen), Pinellia ternate (Banxia), Chinese rhubarb (Dahuang). These herbs were selected on the basis of their proven anti-inflammatory properties and immunomodulatory effects on the molecular level (Chen et al., 2014; Du et al., 2016; Gao et al., 2018; Hu et al., 2014; Ng et al., 2017; Wang et al., 2017; Xie et al., 2018; Yan et al., 2018; Yoshizaki et al., 2014). In the current study, we used UPLC/Q-TOF-MS to characterize the main components of FSG. The main components of FSG include nobiletin, salvianolic acid, ferulic acid, emodin, neohesperidin, epicatechin and so on. A recent study has been reported reported that nobiletin could inhibit p38 MAPK and JNK phosphorylation in U87 glioma cells, indicating that nobiletin may have antiangiogenic activity in glioma cells (Lien et al., 2016). Salvianolic acid was also observed to induce apoptosis in the osteosarcoma MG63 cell line by activating the expressions of phosphorylated-tumor p38 MAPK in another study (Zeng et al., 2018). Salvianolic acid E, Angelica acid and Neohesperidin had been reported to have preferable anti-inflammatory activities (Choi et al., 2018; Shi et al., 2015; Zhong et al., 2016). In order to explore the mechanism of protecting intestinal mucosa with FSG, we predicted the possible targets and pathways. P38 MAPK and DUSP1 were found a close relationship to the effect of FSG by regulating 18

inflammatory cytokines. Numerous studies have shown that chronic inflammation of the gastrointestinal tract is one of major complications in patients treated long-term for ESRD with PD (Kitamura et al., 2015; Rippe and Oberg, 2016). It has been demonstrated that inflammation of the gastrointestinal tract is closely associated with an increase in pro-inflammatory cytokines such as IL-1β, TNF-α, iNOS and ICAM-1, which may impair intestinal mucosal barrier function (Safdari et al., 2016). Our study demonstrated that mRNA expression of ICAM-1, IL-1β, iNOS and TNF-α all showed a significant increase in dose-dependent and time-dependent manners in PD rats, indicating occurred inflammation. Similarly, previous reports revealed that LPS-induced intestinal epithelial cell injury is associated with an increase in pro-inflammatory cytokines (Guo et al., 2016). Meanwhile co-treatment with FSG significantly resisted inflammation, manifesting as drastically inhibit the elevated mRNA expression of ICAM-1, IL-1β, iNOS and TNF-α. These findings indicated that FSG could ameliorate inflammation during PD treatment. It has been suggested that p38 mitogen-activated protein kinase (p38MAPK) appears to be an important regulator in intestinal barrier integrity, apoptosis, stress responses, and inflammation (Costantini et al., 2009; Wang et al., 1997). Recent studies have shown that pro-inflammatory cytokines increase the expression of phosphorylation of p38MAPK (P-p38MAPK), indicating activate the p38MAPK signaling pathway (Wang et al., 2008). In this study, our results exhibited a significant increase in protein expression of P-p38MAPK in rats long-term treated with PD, FSG 19

significantly attenuated the activation of p38MAPK. In previous studies, the proteins occludin and ZO-1 have been shown to play important roles in maintenance of tight junction structure and epithelial barrier function and be related to the activation of p38MAPK (Aijaz et al., 2017). A recent study has been reported dual-specific phosphatase 1 (DUSP1) is one of negative regulators of p38MAPK signaling (Pest et al., 2015). As shown in our results, the PD treatment led to decrease in protein expression of occludin, ZO-1 and DUSP1. After co-treatment with FSG, the protein expression of occluding, ZO-1 and DUSP1 were significantly increased, indicating FSG could inhibit the down-regulation of proteins occluding, ZO-1 and DUSP1. On the basis of these findings, our data demonstrated that the cause of intestinal mucosal dysfunction induced by PD maybe the activation of the p38MAPK signaling pathway, and FSG could ameliorate intestinal mucosal dysfunction via down-regulating the p38MAPK signaling pathway and ameliorating tight junction of intestinal mucosal . To test this hypothesis, we need to conduct a series of experiments to explore in future. However, we should be aware that compound extract of Chinese herbal medicine contains complex components which include complex mechanisms of action and multi-target signaling pathway crosstalk. The present research may open a new way for future research of this alternative medicine product.

Conclusion This study found that co-treatment with FSG could ameliorate intestinal mucosal 20

dysfunction during PD by decreasing expression of pro-inflammatory cytokines and inhibiting the activation of p38MAPK signaling pathway. These findings indicate FSG is a promising alternative medicine product for preventing the intestinal mucosal dysfunction for patients with long-term PD treatment. We speculate that Chinese herbal medicine would be a promising new direction in the development of alternative medicine therapeutic treatments for intestinal mucosal dysfunction during PD.

Author contributions HTY and CJ designed the study. CJ, HTY and WL participated in editing the manuscript and performed the experiments. CJ and LYW analyzed the data and wrote the manuscript. WL, YS, YL and XC helped with data collection. HTY and CJ were responsible for the conceptualization, funding acquisition, project administration and validation of this article. All the authors read and approved the final manuscript.

Competing interests The authors have no conflicts of interest.

Acknowledgements This work was supported by the National Natural Science Foundation of China (8167150423 and 81302920).

21

References Aijaz S., Balda M. S., Matter K., 2006. Tight junctions: molecular architecture and function. Int. Rev. Cytol. 248, 261-298. Balakrishnan A., Chakravortty D., 2017. Epithelial Cell Damage Activates Bactericidal/Permeability Increasing-Protein (BPI) Expression in Intestinal Epithelium. Front. Microbiol. 8, 1567. Bao J., Tan S., Yu W., Lin Z., Dong Y., Chen Q., Shi J., Duan K., Bai X., Xu L., Li J., Li N., 2014. The effect of peritoneal air exposure on intestinal mucosal barrier. Gastroenterol. Res. Pract. 2014, 674875. Chen W., Zhang Y.Y., Wang Z., Luo X.H., Sun W.C., Wang H.B., 2014. Phenolic derivatives from Radix Astragali and their anti-inflammatory activities. Nat. Prod. Commun. 9, 1577-1580. Chiu C.J., McArdle A.H., Brown R., Scott H.J., Gurd F.N., 1970. Intestinal mucosal lesion in low-flow states. I. A morphological, hemodynamic, and metabolic reappraisal. Arch. Surg. 101, 478-483. Choi H.G., Tran P.T., Lee J.H., Min B.S., Kim J.A., 2018. Anti-inflammatory activity of caffeic acid derivatives isolated from the roots of Salvia miltiorrhiza Bunge. Arch. Pharm. Res. 41, 64-70. Costantini T.W., Peterson C.Y., Kroll L., Loomis W.H., Eliceiri B.P., Baird A., Bansal V., Coimbra R., 2009. Role of p38 MAPK in burn-induced intestinal barrier breakdown. J. Surg. Res. 156, 64-69. Ding C., Cong X., Zhang X.M., Li S.L., Wu L.L. and Yu G.Y., 2017. Decreased 22

interaction between ZO-1 and occludin is involved in alteration of tight junctions in transplanted epiphora submandibular glands. J. Mol. Histol. 48, 225-234. Du W., Su J., Ye D., Wang Y., Huang Q., Gong X., 2016. Pinellia ternata Attenuates Mucus Secretion and Airway Inflammation after Inhaled Corticosteroid Withdrawal in COPD Rats. Am. J. Chin. Med. 44, 1027-1041. Evdokimova E., Taper H. and Calderon P.B., 2002. Effects of bacterial endotoxin (lipopolysaccharides) on survival and metabolism of cultured precision-cut rat liver slices. Toxicol. In. Vitro. 16, 47-54. Gao K., Yang R., Zhang J., Wang Z., Jia C., Zhang F., Li S., Wang J., Murtaza G., Xie H., Zhao H., Wang W., Chen J., 2018. Effects of Qijian mixture on type 2 diabetes

assessed

by

metabonomics,

gut

microbiota

and

network

pharmacology. Pharmacol. Res. 130, 93-109. Guo H., Xu Y., Huang W., Zhou H., Zheng Z., Zhao Y., He B., Zhu T., Tang S., Zhu Q., 2016. Kuwanon G Preserves LPS-Induced Disruption of Gut Epithelial Barrier In Vitro. Molecules. 21, 1-14. He S., Liu F., Xu L., Yin P., Li D., Mei C., Jiang L., Ma Y., Xu J., 2016. Protective Effects of Ferulic Acid against Heat Stress-Induced Intestinal Epithelial Barrier Dysfunction In Vitro and In Vivo. PLoS One. 11, e0145236. Yang H., Lu Y., Deng Y., Fang J., Liu G., Jiang A., Zhao J., Wei F., Luo J., Zhang X., Tong M. and Bian H. , 2012. A Multicentre Clinical Study on Fushen Granules in the Dialectical Treatment of Peritoneal Dialysis Patients. Chinese 23

Journal of Integrated Traditional and Western Nephrolog. 13, 410-412. Hu B., Zhang H., Meng X., Wang F., Wang P., 2014. Aloe-emodin from rhubarb (Rheum rhabarbarum) inhibits lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages. J. Ethnopharmacol. 153, 846-853. Jeffs L., Jain A.K., Man R.H., Onabajo N., Desveaux L., Shaw J., Hensel J., Agarwal P., Saragosa M., Jamieson T., Wong I., Maione M., Bhatia R.S., 2017. Exploring the utility and scalability of a telehomecare intervention for patients with chronic kidney disease undergoing peritoneal dialysis-a study protocol. BMC Nephrol. 18, 155. Ji C.G., Xie X.L., Yin J., Qi W., Chen L., Bai Y., Wang N., Zhao D.Q., Jiang X.Y., Jiang H.Q., 2017. Bile acid receptor TGR5 overexpression is associated with decreased intestinal mucosal injury and epithelial cell proliferation in obstructive jaundice. Transl. Res. 182, 88-102. Julian M.W., Bao S., Knoell D.L., Fahy R.J., Shao G. and Crouser E.D., 2011. Intestinal epithelium is more susceptible to cytopathic injury and altered permeability than the lung epithelium in the context of acute sepsis. Int. J. Exp. Pathol. 92, 366-376. Kahvecioglu S., Akdag I., Kiyici M., Gullulu M., Yavuz M., Ersoy A., Dilek K., Yurtkuran M., 2005. High prevalence of irritable bowel syndrome and upper gastrointestinal symptoms in patients with chronic renal failure. J. Nephrol. 18, 61-66. Kitamura M., Nishino T., Obata Y., Oka S., Abe S., Muta K., Ozono Y., Koji T., 24

Kohno S., 2015. The kampo medicine Daikenchuto inhibits peritoneal fibrosis in mice. Biol. Pharm. Bull. 38, 193-200. Kuo C.W., Lee P.T., Fang H.C., Chou K.J., Chung H.M. and Chen C.L., 2006. Extensive peritoneal calcification as a complication of long-term peritoneal dialysis and secondary hyperparathyroidism: a case report and review of the literature. Perit. Dial. Int. 26, 609-612. Li L., Luo G.A., Liang Q.L., Hu P., Wang Y.M., 2010. Rapid qualitative and quantitative analyses of Asian ginseng in adulterated American ginseng preparations by UPLC/Q-TOF-MS. J. Pharm. Biomed. Anal. 52, 66-72. Li Y., Gao Y., Cui T., Yang T., Liu L., Li T., Chen J., 2017 Retinoic Acid Facilitates Toll-Like Receptor 4 Expression to Improve Intestinal Barrier Function through Retinoic Acid Receptor Beta. Cell Physiol. Biochem. 42, 1390-1406. Li Y., Ren J., Wu X. and Li J., 2017. Intra-Abdominal Infection Combined with Intra-Abdominal Hypertension Aggravates the Intestinal Mucosal Barrier Dysfunction. Biosci Rep. 38, 1-10. Lien L.M., Wang M.J., Chen R.J., Chiu H.C., Wu J.L., Shen M.Y., Chou D.S., Sheu J.R., Lin K.H., Lu W.J., 2016. Nobiletin, a Polymethoxylated Flavone, Inhibits Glioma Cell Growth and Migration via Arresting Cell Cycle and Suppressing MAPK and Akt Pathways. Phytother. Res. 30, 214-221. Maher P., 1999. p38 mitogen-activated protein kinase activation is required for fibroblast growth factor-2-stimulated cell proliferation but not differentiation. J. Biol. Chem. 274, 17491-17498. 25

Meiying L., Chen J., Xin H., Xin C. and Hongtao Y., 2016. The clinical effect of Fushen Granules in the treatment of intestinal dysfunction in peritoneal dialysis. CHINA MEDICAL HERALD. 13, 173-176. Mizuno M., Suzuki Y., Ito Y., 2014 Future expectations of diagnostic approaches for treating endogenous peritonitis in patients on peritoneal dialysis. Intern. Med. 53, 647. Nagpal K., Minocha V.R., Agrawal V. and Kapur S., 2006. Evaluation of intestinal mucosal permeability function in patients with acute pancreatitis. Am. J. Surg. 192, 24-28. Naini A.E., Karbalaie A., Abedini M., Askari G., Moeinzadeh F., 2016. Comparison of malnutrition in hemodialysis and peritoneal dialysis patients and its relationship with echocardiographic findings. J. Res. Med. Sci. 21, 78. Ng M.C., Lau T.Y., Fan K., Xu Q.S., Poon J., Poon S.K., Lam M.K., Chau F.T., Sze D.M., 2017. Prediction of Radix Astragali Immunomodulatory Effect of CD80 Expression

from

Chromatograms

by

Quantitative

Pattern-Activity

Relationship. Biomed. Res. Int. 2017, 3923865. Ouyang J., Zhang Z.H., Zhou Y.X., Niu W.C., Zhou F., Shen C.B., Chen R.G., Li X., 2016. Up-regulation of Tight-Junction Proteins by p38 Mitogen-Activated Protein Kinase/p53 Inhibition Leads to a Reduction of Injury to the Intestinal Mucosal Barrier in Severe Acute Pancreatitis. Pancreas. 45, 1136-1144. Perakis K.E., Stylianou K.G., Kyriazis J.P., Mavroeidi V.N., Katsipi I.G., Vardaki E.A., Petrakis I.G., Stratigis S., Kroustalakis N.G., Alegakis A.K., Daphnis 26

E.K., 2009. Long-term complication rates and survival of peritoneal dialysis catheters: the role of percutaneous versus surgical placement. Semin. Dial. 22, 569-575. Pest M.A., Pest C.A., Bellini M.R., Feng Q., Beier F., 2015. Deletion of Dual Specificity Phosphatase 1 Does Not Predispose Mice to Increased Spontaneous Osteoarthritis. PLoS One. 10, e0142822. Rippe B., Oberg C.M., 2016 Albumin Turnover in Peritoneal and Hemodialysis. Semin. Dial. 29, 458-462. Safdari B.K., Sia T.C., Wattchow D.A. and Smid S.D., 2016. Effects of pro-inflammatory cytokines, lipopolysaccharide and COX-2 mediators on human colonic neuromuscular function and epithelial permeability. Cytokine. 83, 231-238. Shi Q., Song X., Fu J., Su C., Xia X., Song E., Song Y., 2015 Artificial sweetener neohesperidin dihydrochalcone showed antioxidative, anti-inflammatory and anti-apoptosis effects against paraquat-induced liver injury in mice. Int. Immunopharmacol. 29, 722-729. Tang G., Yang H., Lin Y., Lyu Y., Wang C., Guo S. and Yang L., 2018 Study on mechanism of Fushen Granules inhibiting peritoneal fibrosiss of peritoneal dialysis rats by regulating the generation of AGEs. CJTCMP. 33,3052-3055. Tang G., Yang H., Lin Y., Guo S., Bu Y., Mei X., 2017 Molecule Mechanism of Fushen Granules in Improving Peritoneal Ultrafiltration Function. Chinese Journal of Experimental Traditional Medical Formulae. 23,103-108. 27

Terpstra M.L., Singh R., Geerlings S.E. and Bemelman F.J., 2016 Measurement of the intestinal permeability in chronic kidney disease. World J. Nephrol. 5, 378-388. Vaziri N.D., Yuan J., Nazertehrani S., Ni Z., Liu S., 2013 Chronic kidney disease causes disruption of gastric and small intestinal epithelial tight junction. Am. J. Nephrol. 38: 99-103. Vaziri N.D., Zhao Y.Y. and Pahl M.V., 2016 Altered intestinal microbial flora and impaired epithelial barrier structure and function in CKD: the nature, mechanisms, consequences and potential treatment. Nephrol. Dial. Transplant. 31, 737-746. Wang C., Feng L., Su J., Cui L., Dan L., Yan J., Ding C., Tan X., Jia X., 2017 Polysaccharides from Epimedium koreanum Nakai with immunomodulatory activity and inhibitory effect on tumor growth in LLC-bearing mice. J. Ethnopharmacol. 207, 8-18. Wang Q., Guo X.L., Wells-Byrum D., Noel G., Pritts T.A. and Ogle C.K., 2008 Cytokine-induced epithelial permeability changes are regulated by the activation of the p38 mitogen-activated protein kinase pathway in cultured Caco-2 cells. Shock. 29, 531-537. Wang X.S., Diener K., Manthey C.L., Wang S., Rosenzweig B., Bray J., Delaney J., Cole C.N., Chan-Hui P.Y., Mantlo N., Lichenstein H.S., Zukowski M., Yao Z., 1997 Molecular cloning and characterization of a novel p38 mitogen-activated protein kinase. J. Biol. Chem. 272, 23668-23674. 28

Welsh D., Mortimer H., Kirk A. and Peacock A., 2005. The role of p38 mitogen-activated protein kinase in hypoxia-induced vascular cell proliferation: an interspecies comparison. Chest. 128, 573S-574S. Williams K.M., Gokulan K., Cerniglia C.E. and Khare S., 2016. Size and dose dependent effects of silver nanoparticle exposure on intestinal permeability in an in vitro model of the human gut epithelium. J. Nanobiotechnology. 14, 62. Wong B., Venturato L., Oliver M.J., Quinn R.R., Ravani P., Holroyd-Leduc J., 2017. Selection of peritoneal dialysis among older eligible patients with end-stage renal disease. Nephrol. Dial. Transplant. 32, 384-392. Xie Y., Zhang H., Zhang Y., Wang C., Duan D., Wang Z., 2018. Chinese Angelica Polysaccharide (CAP) Alleviates LPS-Induced Inflammation and Apoptosis by Down-Regulating COX-1 in PC12 Cells. Cell Physiol. Biochem. 49, 1380-1388. Xue M., Liu Y., Lyu R., Ge N., Liu M., Ma Y., Liang H., 2017. Protective effect of aplysin on liver tissue and the gut microbiota in alcohol-fed rats. PLoS One. 12, e0178684. Yan N., Wen D.S., Zhao Y.R. and Xu S.J., 2018 Epimedium sagittatum inhibits TLR4/MD-2 mediated NF-kappaB signaling pathway with anti-inflammatory activity. BMC Complement. Altern. Med. 18, 303. Yoshizaki N., Fujii T., Masaki H., Okubo T., Shimada K., Hashizume R., 2014. Orange peel extract, containing high levels of polymethoxyflavonoid, suppressed UVB-induced COX-2 expression and PGE2 production in HaCaT 29

cells through PPAR-gamma activation. Exp. Dermatol. 23 Suppl 1, 18-22. Yu, C., Tan S., Zhou C., Zhu C., Kang X., Liu S., Zhao S., Fan S., Yu Z., Peng A., Wang Z., 2016. Berberine Reduces Uremia-Associated Intestinal Mucosal Barrier Damage. Biol. Pharm. Bull. 39, 1787-1792. Yucel, S.K., Arikan H., Tugtepe H., Cakalagaoglu F., Tuglular S., Akoglu E., Ozener C., 2014. Cysteinyl 1 receptor antagonist montelukast, does not prevent peritoneal membrane damage in experimental chronic peritoneal dialysis model in rats. Kidney Blood Press. Res. 39, 648-657. Zeng, Y., Lu Y., Chen Z., Tan J., Bai J., Li P., Wang Z., Du S., 2018. Rapid Characterization

of

Components

in

Bolbostemma

paniculatum

by

UPLC/LTQ-Orbitrap MS(n) Analysis and Multivariate Statistical Analysis for Herb Discrimination. Molecules. 23, pii: E1155.. Zeng, Z., Zhang H., Wang X., Liu K., Li T., Sun S., Li H., 2018. Salvianolic acid B suppresses cell proliferation and induces apoptosis in osteosarcoma through p38-mediated reactive oxygen species generation. Oncol. Lett. 15, 2679-2685. Zhong, L.J., Hua Y.L., Ji P., Yao W.L., Zhang W.Q., Li J., Wei Y.M., 2016. Evaluation of the anti-inflammatory effects of volatile oils from processed products of Angelica sinensis radix by GC-MS-based metabolomics. J. Ethnopharmacol. 191, 195-205. Zhou, Q., Sun Y., Tan W., Liu X., Qian Y., Ma X., Wang T., Wang X., Gao X., 2017. Effect

of

Shenmai

injection

on

preventing

the

development

of

nitroglycerin-induced tolerance in rats. PLoS One, 12, e0176777. 30

Zhu, Y., Liu J.T., Yang L.Y., Du W.P., Li X.C., Qian X., Yu P.F., Liu J.W., Jiang H., 2016. p38 mitogen-activated protein kinase inhibition modulates nucleus pulposus cell apoptosis in spontaneous resorption of herniated intervertebral discs: An experimental study in rats. Mol. Med. Rep. 13, 4001-4006.

31

Figure captions Figure 1.

Experiment design.

Adult male SD rats were randomly divided into 7 groups: group A (control group), sham operation; Group B, PD treated with 1.5%LPDS (15 mL/kg); group C, 1.5%LPDS co-treatment with FSG; group D, PD with 4.25% LPDS (15 mL/kg); group E, 4.25% LPDS

co-treatment with FSG; group F (High dose group), 1.5%

LPDS group (25 mL/kg); and group G, co-treatment with FSG and high dose 1.5% LPDS group. After completed the PD models, the PD rats were treated with different dose and concentrate LPDS (2 hours each time, twice a day). The rats in the control group were treated with normal saline via the same way. FSG (9ml/kg/d clinical equivalent dose) were given by intragastric administration in co-treatment rats. Other groups were fed with equal amount of water. All groups were treated for 8 weeks, while being fed standard pellet food. Each experimental group included 10 rats.

Figure 2. Treatment with FSG protected against intestinal mucosal injury in PD rats. A-G: Representative HE staining of intestinal mucosal tissue in distal ileum from rats in each group at the 4th week and 8th week. In PD groups (B/D/F), intestinal villi short, thick and even shedding, inflammatory cell infiltration and edema were revealed in intestinal mucosal tissue. The treatment of FSG alleviated these injuries (C/E/G). H: The mucosal injury scores in the groups. In all PD groups, intestinal mucosal injury was significantly increased with time. Compared with 1.5%LPDS (15 mL) group, intestinal injury was more serious in 4.25% LPDS and high dose groups. versus control, week,

▽▽

**

P<0.01 versus the 1.5%LPDS (15 mL) group,

P<0.01 versus 4th week,

△△

##

P<0.01

P<0.01 versus 0

▲▲

P<0.01 versus the 4.25%LPDS (15 mL) group,

▼▼

P<0.01 versus the 1.5%LPDS (25 mL) group.

Fig.3. Treatment with FSG ameliorated intestinal mucosal permeability in PD 32

rats. A: The serum level of D-lactate. B: The serum level of DAO. C: The calculating intestinal clearance of FD4. D: The level of TER.

##

P<0.01 versus control, **P<0.01

versus the 1.5%LPDS (15 mL) group.

Fig.4. UPLC/Q-TOF-MS analysis and pathway perdiction of FSG. A: Chromatograms of FSG in negative and positive ESI mode. A total of 55 chemical compounds in FSG were identified or tentatively identified. B: Targets and pathway prediction of FSG.

Fig.5. Treatment with FSG repressed high expression of inflammation factor in distal ileum tissue of PD rats. A: The mRNA expression of ICAM-1. B: The mRNA expression of IL-1β. C: The mRNA expression of iNOS. D: The mRNA expression of TNF-α.

##

P<0.01 versus

control, **P<0.01 versus the 1.5%LPDS (15 mL) group.

Fig.6. Treatment with FSG regulated the activation of p38MAPK signaling pathway and ameliorated tight junction in PD rats at 8th weekend. A: Protein expression of P-p38MAPK (phosphor Thr180 and Tyr182) in distal ileum tissue. B: Protein expression of occludin in distal ileum tissue. C: Protein expression of ZO-1 in distal ileum tissue. D: Protein expression of DUSP1 in distal ileum tissue. ##

P<0.01 versus control, **P<0.01 versus the 1.5%LPDS (15 mL) group.

33

Table 1. Sequences of the primers specific for the rat genes Name

NO.1

NO.2

NO.3

NO.4

NO.5

Primer Forward

GCGTGTTCATCCGTTCTCTAC

Reverse

CTTCAGCGTCTCGTGTGTTTC

Forward

GCCAACAAGTGGTATTCTCCA

Reverse

CCGTCTTTCATCACACAGGAC

Forward

TATGGACGCTCACCTTTAGCA

Reverse

TCTCCCAGGCATTCTCTTTGA

Forward

ACCTTTATGTTTGTGGCGATG

Reverse

TCAACCTGCTCCTCACTCAAG

Forward

CTGACTTCAACAGCGACACC

Reverse

GTGGTCCAGGGGTCTTACTC

TNF-α

IL-1β

ICAM-1

iNOS

GAPDH