- Email: [email protected]
Fusion of carbohydrate binding module to mutant alkaline phosphatase for immobilization on cellulose
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
Contents lists available at ScienceDirect
Biocatalysis and Agricultural Biotechnology journal homepage: www.elsevier.com/locate/bab
Fusion of carbohydrate binding module to mutant alkaline phosphatase for immobilization on cellulose Sangita Singha, Troy Hinkleyb, Sam R. Nugenb, Joey N. Talberta, a b
T
⁎
Department of Food Science and Human Nutrition, Iowa State University, Ames, IA, United States Department of Food Science, Cornell University, Ithaca, NY, United States
A B S T R A C T Immobilized alkaline phosphatase (AP) has the potential to be utilized in biotechnology applications including molecular cloning, inhibitor screening, and the production of phosphorylated compounds. Traditional immobilization methods are limited by specificity and reproducibility, and can require multiple steps to modify the support or the enzyme. In this study, a double mutant alkaline phosphatase (D153G/D330N AP*) was expressed with a carbohydrate binding module (CBM 2a) fused to the N- or C-terminal to enable immobilization of the enzyme to cellulose microparticles. The modified enzyme was characterized in both free and immobilized states. Immobilization was achievable with a maximum loading of 0.33 µmole/g of cellulose for the N-tagged enzyme (CBM-AP*) and 0.26 µmole/g of cellulose for the C-tagged enzyme (AP*-CBM). Fusion of the CBM tag to either the N- or C-terminal resulted in catalytically active enzymes, with modification of the C-terminal retaining the highest catalytic efficiency (52%) relative to the unmodified mutant. The immobilized conjugates retained 83.7% and 80% catalytic efficiency for N-terminal and C-terminal tagged AP*, respectively, when compared to their free enzyme counterparts, and could be washed ten times without a significant loss in catalytic activity. These results suggest that immobilized CBM-tagged alkaline phosphatase may be a viable form for the pragmatic utilization of the enzyme in biotechnology applications.
1. Introduction The immobilization of enzymes onto material supports has been studied as a means to increase the stability and activity of enzymes, promote recovery and reusability, as well as reduce the operational cost of enzymes (Mateo et al., 2007). While a number of strategies for enzyme immobilization are utilized, many of these strategies are limited by the specificity of the attachment or require extensive modification of the material or the enzyme. Proteins and peptides having a specific affinity for a material such as natural and synthetic polymers, metals, and minerals have been employed to immobilize enzymes, directly, to a support (Lu et al., 2012; Naal et al., 2002; Lee and Swaisgood, 1998). This immobilization is accomplished by genetically fusing a sequence encoding the binding protein to the gene encoding for the enzyme of interest. When expressed, the resulting fusion tagged-enzyme is capable of binding to the desired material. The advantages of fusion-tag immobilization directly to materials include reproducible orientation of the bound enzyme, specific binding, and no chemical modification of the enzyme or the support. Alkaline phosphatase (AP; EC 3.1.3.1), a hydrolase that catalyzes
⁎
the hydrolysis of phosphoric esters, is widely used in a conjugated form as an indicator enzyme in enzyme-linked immunosorbent assays and western blots (Alissandratos and Halling, 2012). The enzyme is also employed in free and immobilized forms in molecular biology to remove phosphate groups from DNA and RNA to prevent re-ligation and facilitate labeling (Zubriene et al., 2002). Moreover, alkaline phosphatase has been utilized in immobilized forms to screen for inhibitors of the enzyme, enable the production of phosphorylated compounds, and promote bone formation (Wang et al., 2013; Osathanon et al., 2009; Babich et al., 2013). Mammalian and bacterial alkaline phosphatases are used in these applied technologies, with mammalian alkaline phosphatase being employed in applications that require higher turnover or stability at higher pH values, while bacterial alkaline phosphatase is utilized when the application requires higher thermostability. In its native form, AP is dimeric and contains two zinc ions and one magnesium ion per monomer. Mutation of the active site residue Asp 153 to glycine has produced mutants with increased activity and decreased magnesium affinity (Dealwis et al., 1995). Similarly, a double mutant version of E. coli (D153G/D330N) alkaline phosphatase has been developed that combines the beneficial properties of
Corresponding author. E-mail address: [email protected] (J.N. Talbert).
https://doi.org/10.1016/j.bcab.2018.01.003 Received 8 November 2017; Received in revised form 14 December 2017; Accepted 4 January 2018 Available online 06 January 2018 1878-8181/ © 2018 Elsevier Ltd. All rights reserved.
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Table 1 List of primers used for cloning of AP* and its variants in pET 20b (+). Gene
Restriction site for cloning
Forward primer
Reverse primer
AP*
NcoI-XhoI
AP*-CBMCex
NcoI-XhoI
CBMCenA-AP*
NcoI-XhoI
SG-003 TAAGCACCATGGCTCGTACACCGGAAATGCCGG SG003 TAAGCACCATGGCTCGTACACCGGAAATGCCGG SG-12TAAGCACCATGGCTATGTCCACGCGCCGTACTG
SG-010 TAAGCACCATGGCTACACCGGAAATGCCGG SG005 TGCTTACTCGAGACCAACGGTACACGGGGTGCC SG-13 TGCTTACTCGAGTTTCAATCCTAAGGCAGC
thiogalactoside (IPTG) was from IBI Scientific, Commercial E. coli AP (P 5931), phenylmethylsulfonyl fluoride (PMSF) and microcrystalline cellulose (Avicel; 50 µm) were purchased from Sigma.
mammalian and bacterial alkaline phosphatase—displaying a turnover similar to that of bovine alkaline phosphatase along with the thermostability of E. coli alkaline phosphatase (Muller et al., 2001). This double mutant can also be expressed in E. coli using standard techniques, which is beneficial for laboratory and commercial applications. Cellulosic materials including films, filter membranes, particles, and fibers have been applied as immobilization matrices for a number of biomolecules due to the abundance of the raw material, biocompatibility, susceptibility to modification, and ease of fabrication. Alkaline phosphatase has been immobilized to cellulosic materials by covalent attachment, adsorption (Greenwood et al., 1994) and ionic binding (Khan and Garnier, 2013; Tzanavaras and Themelis, 2002; Cao et al., 2015; Zubriene et al., 2002). Other materials such as chitosan have also been used to immobilize AP as an effort to improve its properties (Jafary et al., 2016). Though these methods are effective, immobilization methods that are more direct, specific, and reproducible would be desirable. Carbohydrate binding modules (CBMs) are a class of proteins that have an affinity for cellulose. Depending on the sequence of the CBM, a reversible or irreversible attachment to cellulose can be achieved. Proteins that are members of CBM 2 bind to cellulose in an apparently irreversibly manner (Tomme et al., 1994; Greenwood et al., 1994; Boraston et al., 2004). Due to this property, CBM 2 fusion tags have been applied to immobilize enzymes, including alkaline phosphatase, for industrial applications (Greenwood et al., 1994; Myung et al., 2011). While alkaline phosphatase has been fused with CBM tags to promote purification of the enzyme as well as to enable screening of CBMs for the development of cellulose-degrading enzymes, there have been no studies characterizing the effects of CBM tags on the properties of the free and immobilized enzyme (Greenwood et al., 1989; Kim et al., 2013). In this article, we explore the use of CBM tags for the immobilization of a double mutant AP to cellulosic materials, and describe the resulting properties of the immobilized conjugates.
Plasmids used in the study were synthesized by Invitrogen (USA). The following amino acid mutations (D153G/D330N) were introduced to the phoA gene of E. coli strain RM191F (GenBank accession nos. M29664.1). A double mutant (D135G/D330N) of AP (referred as AP*) was used in this study due to the similar kcat relative to mammalian AP. All genes were codon optimized and synthesized by Invitrogen. Two CBM genes were fused to AP* and synthesized in a pMK- vector—AP*CBMCex (AP* with CBM of exoglucanase (Cex) from Cellulomonas fimi at C-terminus) and CBMCenA-AP* (AP* with CBM of endoglucanase A (CenA) from Cellulomonas fimi at N-terminus). AP* was cloned from Pmk- AP*-CBMCex plasmid. CBMCex and CBMCenA belong to the family of CBM 2 with GenBank accession nos. M15824.1 and M15823.1, respectively. The genes were amplified by polymerase chain reaction (PCR) using primers listed in Table 1. The amplified PCR products along with an empty pET-20b(+) vector were digested with restriction endonucleases NcoI and XhoI. The digested PCR product and vector were further digested with DpnI and Shrimp Alkaline Phosphatase, respectively. The digested PCR product and vector from these reactions were ligated together using T4 DNA ligase and transformed into NEB 5-alpha cells to generate pET-20b(+)-AP*, pET-20b(+)-CBMCenA-AP*, and pET-20b (+)-AP*-CBMCex plasmids. The sequences of the generated constructs were confirmed using Sanger DNA sequencing performed at the Iowa State University DNA Facility. Following sequence and restriction digestion confirmation, the resulting plasmids were transformed into E. coli expression strain T7 Express lysY/Iq.
2. Materials and methods
2.3. Expression of AP* and CBM-fused AP*
2.1. Materials
All inoculations and E coli cell growth were performed in sterilized culture media of LB (Luria–Bertani 1% tryptone, 0.5% yeast extract, 1% NaCl). Ampicillin (100 µg/mL) was used as a selection antibiotic. An overnight culture was started from a fresh plate streaked with cells expressing target enzyme at 37 °C. The next day 10 mL of an overnight culture was diluted into 1000 mL of LB media and grown for 5 h at 37 °C until reaching an OD of 0.7. For slow induction, prior to induction, cells were chilled at 4 °C for 30 min. Subsequently, cells were induced with a sterile filtered solution of IPTG (200 µM), and then grown another 18 h at 20 °C, shaking at 150 rpm. Cells (1 L) were harvested by centrifuging for 45 min at 5000 rpm in Sorvall RC 3B Plus centrifuge. Medium and cell lysate were analyzed for protein expression as well as activity using SDS-PAGE and pNPP assay, respectively.
2.2. Plasmid construction
pET 20b(+) was a kind gift from Professor Robert S. Haltiwanger at Complex Carbohydrate Research Center, The University of Georgia. Hispur Ni-NTA (Nickel-nitrilotriacetic acid) superflow agarose, diethanolamine, imidazole, Bugbuster 10× protein extraction reagent, p-nitrophenyl phosphate (p-NPP), Coomassie (Bradford) dye, casein, Whatman paper 1001-090, and 1-Step™ NBT/BCIP (nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate) substrate solution were purchased from ThermoFisher Scientific. Fast digest restriction endonucleases (NcoI, XhoI) and T4 DNA ligase enzymes were also from ThermoFisher Scientific. Q5 Hot start high-fidelity DNA polymerase, deoxynucleotide (dNTP) solution mix, shrimp alkaline phosphatase, NEB® 5-alpha competent E. coli (Subcloning Efficiency), and T7 Express lysY/Iq competent E. coli (high efficiency) were purchased from New England BioLabs. Oligonucleotides were synthesized in DNA Facility at Iowa State University. 10% precast polyacrylamide gels for use with Mini-PROTEAN electrophoresis cells, econo-column, 1.5 × 10 cm, glass chromatography column (maximum volume 18 mL), and precision plus protein dual Color Standards were from Bio-Rad. Isopropyl-β-D-
2.4. Paper-based assay for CBM -fused AP* Induced cells expressing AP* and CBM-fused AP* in the growth media were also analyzed for expression using a paper-based assay. Strips (3 cm × 1 cm) of Whatman filter paper were pre-incubated with 5% casein (to prevent non-specific binding of proteins) for 20 min at 266
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
linear regression using the Langmuir-type isotherm. The influence of process parameters on immobilization were determined by varying the pH of the binding buffer and the NaCl concentration followed by determination of binding as described, previously. For pH dependent experiments, the following buffers containing 100 mM NaCl were employed: 50 mM sodium phosphate, pH 6.0 and 7.0, 50 mM Tris-HCl, pH 8.0 and 9.0, and 50 mM DEA pH 10.0. NaCl was varied from 50 to 500 mM in 50 mM Tris-HCl pH 8.0 for evaluating effect of salt on the adsorption efficiency.
room temperature (ca. 21 °C) then washed with 50 mM Tris-HCl buffer (pH 8.0; 0.5 M NaCl) Harvested medium 300 µL was incubated with the strips for 20 min, washed three times, and then incubated with NBT/ BCIP. Color change from the resulting reaction of bound AP* on filter paper with NBT/BCIP was monitored visually to determine the presence/expression of CBM-tagged alkaline phosphatase. 2.5. Purification of AP* and CBM-fused AP* A cell pellet (10 g) was obtained from 3 L culture that was frozen at − 80 °C for a minimum of one day. Cell pellets were thawed and then resuspended in 30 mL of 1× Bugbuster solution diluted in Buffer #1 (50 mM sodium phosphate buffer; pH 8.0; 300 mM NaCl) containing 10 mM imidazole, 10 μg/mL DNAase and 1 mM PMSF. The cell suspension was shaken at room temperature for 30 min to promote lysis. The cell lysate (~ 45 mL) was centrifuged in a swing bucket centrifuge at 5000 rpm for 45 min at 4 °C. The resulting supernatant was filtered using a 0.45 µm PVDF filter, diluted with Buffer #1 containing 10 mM imidazole, and loaded on a Ni-NTA column to purify the His-tagged variants of AP*. The Ni-NTA resin was packed in a Bio-rad Econo column and pre-equilibrated with Buffer #1 containing 10 mM imidazole. Columns were washed with Buffer #1 containing 30 mM of imidazole until no more protein was detected in the wash fractions. An imidazole gradient (50–250 mM) in Buffer #1 was employed to elute enzyme fractions. The fractions with AP* activity were pooled together, buffer-exchanged with storage buffer (50 mM Tris, pH 8.0 containing 10 mM MgCl2), concentrated, and stored at − 80 °C until further use. Since phosphate is a competitive inhibitor of AP*, buffer was exchanged from sodium phosphate to Tris buffer after purifications.
2.8. Determination of immobilized enzyme activity Immobilized enzyme was washed twice with 50 mM Tris-HCl (pH 8.0; 100 mM NaCl) and then diluted with 50 mM Tris-HCl, pH 8.0 and 10 mM MgCl2 for activity analysis. Activity of that immobilized conjugates was determined using pNPP as described, previously, for the free enzyme. Thermostability of free and immobilized enzyme was determined as described in Janeway et al. (1993). Samples were diluted in TMZP buffer (50 mM Tris; 100 mM MgC12; 100 µM NaH2PO4; 10 µM ZnSO4 adjusted to pH 7.4), and incubated in a range of 30–95 °C for 15 min. Activity assays were conducted in 50 mM Tris-HCl buffer (pH 8.0;100 mM MgCl2) using 25 mM pNPP. 2.9. Stability of immobilized enzyme attachment Cellulose slurry containing CBM-fused AP* was washed repeatedly (up to 10 washes) with 7 mL of 50 mM Tris-HCl buffer (pH 8.0; 100 mM NaCl; 10 mM MgCl2) at room temperature (ca. 21 °C) for 5 min under end-to-end rotation using a tube rotator, followed by centrifugation at 5000 rpm for 5 min. After the designated number of washes, the slurry was suspended in up to 25 mL of the same buffer and 25 μL sample was withdrawn for the activity assay as described, previously.
2.6. Determination of free enzyme activity using pNPP assay Alkaline phosphatase activity was measured using p-nitrophenyl phosphate (pNPP; 0.05–30 mM) as a substrate under optimum conditions. For wild type E. coli AP, activity was determined in 1 M Tris-HCl (pH 8.0; 10 mM MgCl2) at 25 °C. The activities of all variants of AP* were evaluated in 1 M DEA Buffer (pH 10.0; 10 mM MgCl2; 20 µM ZnCl2) at 37 °C. Prior to the activity assays, AP* variants were incubated at 25 °C for 2 h in 50 mM Tris buffer (pH 8.0; 10 mM MgCl2). The progress of the hydrolysis was monitored spectrophotometrically at 410 nm. An extinction coefficient of 16,200 M−1 cm −1 was used to determine rates of product formation. The substrate-versus-velocity graphs were plotted and fitted to the Michaelis-Menten equation by a non-linear regression using Prism software (Graph Pad, USA) to determine Michaelis constant (Km) and maximum velocity (Vmax). To calculate the turnover number (kcat), Vmax was divided by the initial enzyme concentration assuming a molecular weight of 96, 130 and 118 kDa for dimeric form of AP*, CBMCenA-AP*, and AP*-CBMCex respectively.
3. Results and discussion 3.1. Plasmid construction Untagged as well as CBM-tagged AP* (Fig. 1) were cloned using primers described in Table 1. For all constructs, a pelB signal sequence was introduced at the N-terminal to promote periplasmic localization, and a His-tag sequence was introduced at the C-terminal for purification using affinity chromatography. Based on the strategy adapted from Greenwood et al. (1994), the CBMCenA-AP* construct consisted of a CBM sequence of endonuclease (CenA) from C. fimi followed by a linker consisting of primarily proline-threonine (PT) repeats (PT box) and the Factor Xa recognition sequence, and then the mature AP* sequence (D153G/D330N AP). CBMCenA and CBMCex have been used extensively as fusion tag for the purification and characterization of various proteins (Tomme et al., 1998). The C-terminal AP* fusion, AP*-CBMCex, was developed using a CBM sequence of exonuclease (Cex) from C. fimi at the C-terminal of AP* and was separated by a flexible GSGP linker sequence (Abouhmad et al., 2016).
2.7. Immobilization of CBM-fused AP* onto microcrystalline cellulose Purified CBM fused AP* (0.1–3 mg/mL) was mixed with 2 mg microcrystalline cellulose (50 µm) in 100 µL of total volume at room temperature (ca. 21 °C) under end-to-end rotation using a mini-tube rotator. All adsorption measurements were carried out in 50 mM TrisHCl buffer (pH 8.0; 300 mM NaCl) for one hour. Control tubes contained identical concentrations of enzyme, but no cellulose. The samples were centrifuged at 13,000 rpm for 10 min to separate the cellulose-bound protein from unbound protein. The concentration of bound protein was determined from the difference between the protein concentration in the control incubated without cellulose (total protein) and the unbound protein in the supernatant after incubation with cellulose using Bradford assay. A depletion isotherm of [Bound] (μmol/g of cellulose) vs [Free protein] (μM) was generated. Binding capacity (i.e. density of binding sites per gram of cellulose) was obtained by non-
3.2. Expression and purification of AP* in E. coli Protein expression in soluble fractions (medium and cell lysate) was analyzed using SDS-PAGE as well as a pNPP-based activity assay. All cell cultures were induced with an optimum concentration of 200 µM IPTG for expression of the protein. As seen in Fig. 2, all AP* variants in this study were expressed in the medium and cell lysate, showing distinct bands at ~ 48 and ~ 59 and 65 kDa for the AP*, AP*-CBMCex and CBMCenA-AP*, respectively. Based on the visual analysis of the gel for medium and cell lysate, the expression of AP* was significantly higher than the CBM-tagged AP*. Following affinity purification, approximately 4 mg of both CBM-fused AP* variants and 8 mg of AP* could be recovered from the cell pellet of a 1 L culture. For sake of convenience 267
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Fig. 1. Details of recombinant enzymes cloned and purified. AP* refers to the double mutant D153G/D330N of mature E coli alkaline phosphatase (AP). The first box with small grids represent pelB leader sequence. CBMCenA and CBMCex are cellulose binding modules of endoglucanase and exonuclease from C. fimi, respectively. The grey shaded box represents AP* and vertical lines/ shaded boxes represent CBM domains fused at N- or C-terminal of AP*. Unfilled boxes in each construct represent linker region, extra sequences between the AP* and CBM domain, and/or a His tag.
and consistency, purification of all AP* variants were carried out using cell pellets. Table 2 provides a summary of the expression characteristics of the untagged and tagged variants in the medium and cell lysate. pNPP assays using the crude extract of cell lysate as well as the medium AP*showed higher specific activity for AP* compared to the CBMtagged variants (this was verified using pure protein). In addition to SDS-PAGE and standard enzymatic assay procedures, a cellulose Whatman filter paper assay was developed to quickly screen for the presence of active CBM-tagged enzyme in the expression medium. The assay was based on the assumption that enzyme carrying the CBM fusion tag would bind to the cellulosic filter paper. Following the addition of a precipitating substrate (NBT/BCIP), the presence of the enzyme could be readily observed by the resulting color of the filter paper. As shown in Fig. 3, only the CBM-fused AP* variants showed an intense black-purple precipitate, confirming binding of CBM to cellulose on the filter paper and validating a functional cloning and expression of CBM-fused AP*.
Table 2 Summary of expression and activity of recombinant AP* in medium and cell lysate.
AP* CBMCenA-AP* AP*-CBMCex
Activity in medium
Activity in cell lysate
Band in gel in medium
Band in gel in cell lysate
Activity on cellulose filter paper from medium
++ + +
++ + +
++ + +
++ + +
– + +
Fig. 3. Filter-paper based assay of CBM fused AP*. For each recombinant protein, filter paper was pre-incubated with 5% casein, washed, incubated with untagged or CBM-fused AP*, washed again and then incubated with NBT/BCIP to qualitatively identify active AP* as denoted by the presence of the purple color.
3.3. Immobilization of CBM-fused AP* onto cellulose Conditions for immobilization were optimized using AP*-CBMCex and then applied in subsequent experiments to AP*-CBMCex as well as CBMCenA-AP*. A crude experiment showed maximal binding of CBM-
Fig. 2. SDS-PAGE analysis in soluble fractions. A and B denotes expression of AP*, AP*-CBMCex and CBMCenA-AP* in cell lysate and medium, respectively. 10 μg of cell lysate and medium protein were loaded on a 10% SDS-PAGE gel.
268
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Fig. 4. Effect of pH (a) and salt concentration (b) on the adsorption of AP*-CBMCex onto cellulose (n = 3).
3.4. Kinetic characterization of free and immobilized enzymes
tagged protein to cellulose at 60 min, hence all the immobilization reactions were carried out at least for 60 min. For optimization experiments, aliquots of AP*-CBMCex incubated with cellulose in different conditions were removed and analyzed for bound protein. The effect of pH was evaluated by carrying out the adsorption reaction in different buffers. As indicated in Fig. 4, a minor decrease in protein immobilization was seen with pH above 8.0. With respect to effect of salt concentration on the adsorption efficiency, altering NaCl concentration did not significantly change the extent of enzyme immobilization. From the above optimization experiments, all subsequent adsorption experiments were performed at pH 8.0 and 300 mM NaCl for one hour. Relative adsorption was defined as the fraction of binding capacity at a given point compared to the maximum binding capacity for Avicel determined in this study. Loading of the recombinant enzymes was evaluated to determine the maximum amount of enzymes that could be immobilized on the cellulose microparticles. Cumulative isotherm data derived from depletion assay of binding of CBM-fused AP* to cellulose (Fig. 5) indicated a maximum loading (binding capacity) of 0.33 µmole of enzyme/g of cellulose for CBMCenA-AP* and 0.26 µmole of enzyme/g of cellulose for AP*-CBMCex could be achieved using the defined methods. The determination of the binding capacity of CBM 2 to Avicel has not been previously reported, however, the binding capacity of CBM17 and CBM28 has been reported to vary from 0.08 to 5 µmole/g of cellulose (Boraston et al., 2003).
Steady-state kinetic parameters were obtained for wild-type AP, AP*and CBM-fused AP* variants (Table 3). Compared to the wild-type enzyme, the double mutation (D153G/D330N) of the bacterial alkaline phosphatase resulted in an increase in the turnover number (kcat) from 29 s−1 to 1540 s−1. This result confirms previous reports that this mutation enhances the kcat by 40-fold (Muller et al., 2001). The specific activity of AP from Sigma in our study was 18.3 U/mg, which is lower than its reported specific activity (30–60 U/mg of protein). This could be due to the difference in pH and temperature used in our study (1 M Tris-HCl Buffer, pH 8.0, 10 mM MgCl2 at 25 °C) compared to the reported condition of glycine buffer at pH 10.4 at 37 °C. In this study, we followed the optimal condition for assaying wild-type AP and AP* as reported by Muller et. al (Muller et al., 2001). However, in our study the kcat for AP* was determined to be approximately two-fold lower than reported by Muller et al., this could be due to some residual phosphate despite extensive buffer exchange after the purification in sodium phosphate buffer. The addition of a CBM tag resulted in a decrease in kcat for both CBMCenA-AP* (767 s−1) and AP*-CBMCex (918 s−1) when compared to the unmodified mutant enzyme AP* (1540 s−1). This result suggests that modification with the CBM tag alters the turnover of the mutant enzyme, and that the extent of the activity change occurs irrespective of the position of the tag (i.e at the N or C-terminal). Compared to the wild-type enzyme, the double mutant enzyme had a higher Km (390 µM vs 40 µM for the wild-type) consistent with other reported literature (Le Du et al., 2002; Muller et al., 2001). Introduction of the CBM-tag did not significantly alter the Km of AP*-
Fig. 5. Adsorption isotherms for binding of CBMCenA-AP* (a) and AP*-CBMCex (b) to cellulose in 50 mM Tris pH 8.0 and 300 mM NaCl at room temperature (n = 2).
269
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Table 3 Kinetic parameters of E. coli wild type alkaline phosphatase (AP), double mutant alkaline phosphatase (AP*), and CBM-fused AP*. 1Assay was conducted in 1 M Tris-HCl Buffer, pH 8.0, 10 mM MgCl2 at 25 °C, all other assays were performed in 1 M DEA Buffer, pH 10.0, 10 mM MgCl2 and 40 μM ZnCl2 at 37 °C. 2The kcat values were computed from the Vmax values by assuming a dimer molecular mass for each enzyme (n = 3).
kcat, s−1 Km, mM kcat-fold difference compared to E. coli AP
2
AP1
AP*
CBMCenA-AP*
Immobilized CBMCenA-AP*
AP*-CBMCex
Immobilized AP*-CBMCex
29.3 ± 0.8 0.04 ± 0.01 1.0
1510 ± 65 0.39 ± 0.07 52.5
767 ± 28 0.86 ± 0.11 26.1
620 ± 32 1.98 ± 0.46 21.1
918 ± 33 0.46 ± 0.06 31.3
770 ± 65 4.90 ± 1.10 26.2
enzyme was measured after a 2 h pre-incubation in TMZP buffer (Fig. 7). The Tm for AP* was determined to be 84 °C compared to 87 °C for AP* as reported by Muller et al. (2001). The Tm of CBMCenA-AP* and AP*-CBMCex was determined to be 85 °C and 84 °C, respectively. This result suggests that fusing the CBM tag to the AP* did not significantly perturb thermal stability of AP*. However, the Tm for both the immobilized CBMCenA-AP* and AP*-CBMCex was reduced to 70 and 77 °C, respectively. The reduced thermostability of the immobilized AP* variants could be due to some conformational change or reduced entropy due to immobilization that disrupts the stability conferred by the free enzyme. Fig. 6. Effect on washing cellulose immobilized with CBM-fused AP* on the retained activity. Activity was determined before washing, then after the 4th and 10th wash (n = 3).
4. Conclusion In summary, we have successfully expressed and purified N- and Cterminal CBM fused AP*from E. coli and characterized the enzymes in their free and immobilized states. Under optimal conditions, binding of a CBM fusion tag to either terminal yields considerable retention of catalytic efficiency in both free and immobilized states when compared to the untagged enzyme. The tagged enzymes can be readily immobilized to microcrystalline cellulose and can be repeatedly washed without loss of catalytic activity. These results suggest that immobilized CBM-tagged AP* may be a viable form for the pragmatic utilization of alkaline phosphatase in biotechnology applications. References Abouhmad, A., Mamo, G., Dishisha, T., Amin, M.A., Hatti-Kaul, R., 2016. T4 lysozyme fused with cellulose-binding module for antimicrobial cellulosic wound dressing materials. J. Appl. Microbiol. 121 (1), 115–125. Alissandratos, A., Halling, P.J., 2012. Enzymatic acylation of starch. Bioresour. Technol. 115, 41–47. Babich, L., Peralta, J., Hartog, A., Wever, R., 2013. Phosphorylation by alkaline phosphatase: immobilization and synthetic potential. Int. J. Chem. 5 (3), 82–98. Boraston, A.B., Bolam, D.N., Gilbert, H.J., Davies, G.J., 2004. Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J. 382, 769–781. Boraston, A.B., Kwan, E., Chiu, P., Warren, R.A.J., Kilburn, D.G., 2003. Recognition and hydrolysis of noncrystalline cellulose. J. Biol. Chem. 278 (8), 6120–6127. Cao, R., Guan, L., Li, M., Tian, J., Shen, W., 2015. A zero-step functionalization on paperbased biosensing platform for covalent biomolecule immobilization. Sens. Bio-Sens. Research 6, 13–18. Dealwis, C.G., Chen, L.Q., Brennan, C., Mandecki, W., Abadzapatero, C., 1995. 3-d structure of the d153g mutant of Escherichia coli alkaline phosphatase: an enzyme with weaker magnesium binding and increased catalytic activity. Protein Eng. 8 (9), 865–871. Greenwood, J.M., Gilkes, N.R., Kilburn, D.G., Miller, R.C., Warren, R.A.J., 1989. Fusion to an endoglucanase allows alkaline-phosphatase to bind to cellulose. FEBS Lett. 244 (1), 127–131. Greenwood, J.M., Gilkes, N.R., Miller, R.C., Kilburn, D.G., Warren, R. a.J., 1994. Purification and processing of cellulose-binding domain-alkaline phosphatase fusion proteins. Biotechnol. Bioeng. 44 (11), 1295–1305. Jafary, F., Panjehpour, M., Varshosaz, J., Yaghmaei, P., 2016. Stability improvement of immobilized alkaline phosphatase using chitosan nanoparticles. Braz. J. Chem. Eng. 33 (2), 243–250. Janeway, C.M.L., Xu, X., Murphy, J.E., Chaidaroglou, A., Kantrowitz, E.R., 1993. Magnesium in the active-site of escherichia-coli alkaline-phosphatase is important for both structural stabilization and catalysis. Biochemistry 32 (6), 1601–1609. Khan, M.S., Garnier, G., 2013. Direct measurement of alkaline phosphatase kinetics on bioactive paper. Chem. Eng. Sci. 87, 91–99. Kim, H.D., Choi, S.L., Kim, H., Sohn, J.H., Lee, S.G., 2013. Enzyme-linked assay of cellulose-binding domain functions from cellulomonas fimi on multi-well microtiter plate. Biotechnol. Bioprocess Eng. 18 (3), 575–580. Le Du, M.H., Lamoure, C., Muller, B.H., Bulgakov, O.V., Lajeunesse, E., Menez, A., Boulain, J.C., 2002. Artificial evolution of an enzyme active site: structural studies of
Fig. 7. Heat stability of AP*, CBMCenA-AP* and AP*-CBMCex. The enzyme was diluted 100-fold into TMZP buffer. The enzyme sample was heated at the indicated temperature for 15 min. The samples were then quenched on ice and the activity was measured in 50 mM Tris-HCl, pH 8.0 and 100 mM MgCl2 (n = 3).
CBMCex, but led to 2.2-fold increase in the Km for CBMCenA-AP* compared to AP*. Immobilization of the CBM-fused AP* variants onto 50 µm microcrystalline cellulose particles did not significantly (p ≤ 0.05) alter the turnover of the enzyme—indicating that the enzyme retains catalytic activity when attached to cellulose particles. As seen in Table 3, the Km of the immobilized conjugate significantly increased compared to the unbound counterparts indicating the possibility of diffusion limitations or conformational changes following immobilization. 3.5. Stability of immobilized CBM-fused AP* CBM proteins belonging to family 2 are known to bind, irreversibly, to cellulose under conditions of nominal salt and in the absence of elution compounds such as pure water, ethylene glycol and guanidinium hydrochloride (Tomme et al., 1994; Ong et al., 1989).. Under conditions of washing in 50 mM Tris pH 8.0, 10 mM MgCl2 and 100 mM NaCl involving multiple centrifugation steps, AP* activity was not lost for up to 10 washes (Fig. 6). This is in agreement with minimum leaching of proteins fused to CenA/Cex (Ong et al., 1989). To assess if fusing CBM to AP* and immobilization of CBM-fused AP* to cellulose altered its thermal stability, the denaturation temperature of each 270
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Ong, E., Gilkes, N.R., Warren, R.A.J., Miller, R.C., Kilburn, D.G., 1989. Enzyme immobilization using the cellulose-binding domain of a cellulomonas-fimi exoglucanase. Bio-Technology 7 (6), 604–607. Osathanon, T., Giachelli, C.M., Somerman, M.J., 2009. Immobilization of alkaline phosphatase on microporous nanofibrous fibrin scaffolds for bone tissue engineering. Biomaterials 30 (27), 4513–4521. Tomme, P., Boraston, A., Mclean, B., Kormos, J., Creagh, A.L., Sturch, K., Gilkes, N.R., Haynes, C.A., Warren, R.A.J., Kilburn, D.G., 1998. Characterization and affinity applications of cellulose-binding domains. J. Chromatogr. B 715 (1), 283–296. Tomme, P., Gilkes, N.R., Miller, R.C., Warren, A.J., Kilburn, D.G., 1994. An internal cellulose-binding domain mediates adsorption of an engineered bifunctional xylanase cellulase. Protein Eng. 7 (1), 117–123. Tzanavaras, P.D., Themelis, D.G., 2002. Simultaneous flow-injection determination of fluoride, monofluorophosphate and orthophosphate ions using alkaline phosphatase immobilized on a cellulose nitrate membrane and an open-circulation approach. Anal. Chim. Acta 467 (1–2), 83–89. Wang, S.M., Su, P., Huang, J., Wu, J.W., Yang, Y., 2013. Magnetic nanoparticles coated with immobilized alkaline phosphatase for enzymolysis and enzyme inhibition assays. J. Mater. Chem. B 1 (12), 1749–1754. Zubriene, A., Budriene, S., Lubiene, J., Dienys, G., 2002. Immobilized alkaline phosphatase for molecular cloning. Biocatal. Biotransformation 20 (6), 423–427.
three highly active mutants of escherichia coli alkaline phosphatase. J. Mol. Biol. 316 (4), 941–953. Lee, P., Swaisgood, H.E., 1998. Cloning and expression of a streptavidin-lipase fusion gene in Escherichia coli and characterization of the immobilized fusion protein. Enzym. Microb. Technol. 22 (4), 246–254. Lu, L., Xu, S., Zhao, R., Zhang, D., Li, Z., Li, Y., Xiao, M., 2012. Synthesis of galactooligosaccharides by cbd fusion beta-galactosidase immobilized on cellulose. Bioresour. Technol. 116, 327–333. Mateo, C., Palomo, J.M., Fernandez-Lorente, G., Guisan, J.M., Fernandez-Lafuente, R., 2007. Improvement of enzyme activity, stability and selectivity via immobilization techniques. Enzym. Microb. Technol. 40 (6), 1451–1463. Muller, B.H., Lamoure, C., Le Du, M.H., Cattolico, L., Lajeunesse, E., Lemaitre, F., Pearson, A., Ducancel, F., Menez, A., Boulain, J.C., 2001. Improving Escherichia coli alkaline phosphatase efficacy by additional mutations inside and outside the catalytic pocket. Chembiochem 2, 517–523. Myung, S., Zhang, X.-Z., Zhang, Y.H.P., 2011. Ultra-stable phosphoglucose isomerase through immobilization of cellulose-binding module-tagged thermophilic enzyme on low-cost high-capacity cellulosic adsorbent. Biotechnol. Prog. 27 (4), 969–975. Naal, Z., Park, J.H., Bernhard, S., Shapleigh, J.P., Batt, C.A., Abruna, H.D., 2002. Amperometric tnt biosensor based on the oriented immobilization of a nitroreductase maltose binding protein fusion. Anal. Chem. 74 (1), 140–148.
271
Contents lists available at ScienceDirect
Biocatalysis and Agricultural Biotechnology journal homepage: www.elsevier.com/locate/bab
Fusion of carbohydrate binding module to mutant alkaline phosphatase for immobilization on cellulose Sangita Singha, Troy Hinkleyb, Sam R. Nugenb, Joey N. Talberta, a b
T
⁎
Department of Food Science and Human Nutrition, Iowa State University, Ames, IA, United States Department of Food Science, Cornell University, Ithaca, NY, United States
A B S T R A C T Immobilized alkaline phosphatase (AP) has the potential to be utilized in biotechnology applications including molecular cloning, inhibitor screening, and the production of phosphorylated compounds. Traditional immobilization methods are limited by specificity and reproducibility, and can require multiple steps to modify the support or the enzyme. In this study, a double mutant alkaline phosphatase (D153G/D330N AP*) was expressed with a carbohydrate binding module (CBM 2a) fused to the N- or C-terminal to enable immobilization of the enzyme to cellulose microparticles. The modified enzyme was characterized in both free and immobilized states. Immobilization was achievable with a maximum loading of 0.33 µmole/g of cellulose for the N-tagged enzyme (CBM-AP*) and 0.26 µmole/g of cellulose for the C-tagged enzyme (AP*-CBM). Fusion of the CBM tag to either the N- or C-terminal resulted in catalytically active enzymes, with modification of the C-terminal retaining the highest catalytic efficiency (52%) relative to the unmodified mutant. The immobilized conjugates retained 83.7% and 80% catalytic efficiency for N-terminal and C-terminal tagged AP*, respectively, when compared to their free enzyme counterparts, and could be washed ten times without a significant loss in catalytic activity. These results suggest that immobilized CBM-tagged alkaline phosphatase may be a viable form for the pragmatic utilization of the enzyme in biotechnology applications.
1. Introduction The immobilization of enzymes onto material supports has been studied as a means to increase the stability and activity of enzymes, promote recovery and reusability, as well as reduce the operational cost of enzymes (Mateo et al., 2007). While a number of strategies for enzyme immobilization are utilized, many of these strategies are limited by the specificity of the attachment or require extensive modification of the material or the enzyme. Proteins and peptides having a specific affinity for a material such as natural and synthetic polymers, metals, and minerals have been employed to immobilize enzymes, directly, to a support (Lu et al., 2012; Naal et al., 2002; Lee and Swaisgood, 1998). This immobilization is accomplished by genetically fusing a sequence encoding the binding protein to the gene encoding for the enzyme of interest. When expressed, the resulting fusion tagged-enzyme is capable of binding to the desired material. The advantages of fusion-tag immobilization directly to materials include reproducible orientation of the bound enzyme, specific binding, and no chemical modification of the enzyme or the support. Alkaline phosphatase (AP; EC 3.1.3.1), a hydrolase that catalyzes
⁎
the hydrolysis of phosphoric esters, is widely used in a conjugated form as an indicator enzyme in enzyme-linked immunosorbent assays and western blots (Alissandratos and Halling, 2012). The enzyme is also employed in free and immobilized forms in molecular biology to remove phosphate groups from DNA and RNA to prevent re-ligation and facilitate labeling (Zubriene et al., 2002). Moreover, alkaline phosphatase has been utilized in immobilized forms to screen for inhibitors of the enzyme, enable the production of phosphorylated compounds, and promote bone formation (Wang et al., 2013; Osathanon et al., 2009; Babich et al., 2013). Mammalian and bacterial alkaline phosphatases are used in these applied technologies, with mammalian alkaline phosphatase being employed in applications that require higher turnover or stability at higher pH values, while bacterial alkaline phosphatase is utilized when the application requires higher thermostability. In its native form, AP is dimeric and contains two zinc ions and one magnesium ion per monomer. Mutation of the active site residue Asp 153 to glycine has produced mutants with increased activity and decreased magnesium affinity (Dealwis et al., 1995). Similarly, a double mutant version of E. coli (D153G/D330N) alkaline phosphatase has been developed that combines the beneficial properties of
Corresponding author. E-mail address: [email protected] (J.N. Talbert).
https://doi.org/10.1016/j.bcab.2018.01.003 Received 8 November 2017; Received in revised form 14 December 2017; Accepted 4 January 2018 Available online 06 January 2018 1878-8181/ © 2018 Elsevier Ltd. All rights reserved.
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Table 1 List of primers used for cloning of AP* and its variants in pET 20b (+). Gene
Restriction site for cloning
Forward primer
Reverse primer
AP*
NcoI-XhoI
AP*-CBMCex
NcoI-XhoI
CBMCenA-AP*
NcoI-XhoI
SG-003 TAAGCACCATGGCTCGTACACCGGAAATGCCGG SG003 TAAGCACCATGGCTCGTACACCGGAAATGCCGG SG-12TAAGCACCATGGCTATGTCCACGCGCCGTACTG
SG-010 TAAGCACCATGGCTACACCGGAAATGCCGG SG005 TGCTTACTCGAGACCAACGGTACACGGGGTGCC SG-13 TGCTTACTCGAGTTTCAATCCTAAGGCAGC
thiogalactoside (IPTG) was from IBI Scientific, Commercial E. coli AP (P 5931), phenylmethylsulfonyl fluoride (PMSF) and microcrystalline cellulose (Avicel; 50 µm) were purchased from Sigma.
mammalian and bacterial alkaline phosphatase—displaying a turnover similar to that of bovine alkaline phosphatase along with the thermostability of E. coli alkaline phosphatase (Muller et al., 2001). This double mutant can also be expressed in E. coli using standard techniques, which is beneficial for laboratory and commercial applications. Cellulosic materials including films, filter membranes, particles, and fibers have been applied as immobilization matrices for a number of biomolecules due to the abundance of the raw material, biocompatibility, susceptibility to modification, and ease of fabrication. Alkaline phosphatase has been immobilized to cellulosic materials by covalent attachment, adsorption (Greenwood et al., 1994) and ionic binding (Khan and Garnier, 2013; Tzanavaras and Themelis, 2002; Cao et al., 2015; Zubriene et al., 2002). Other materials such as chitosan have also been used to immobilize AP as an effort to improve its properties (Jafary et al., 2016). Though these methods are effective, immobilization methods that are more direct, specific, and reproducible would be desirable. Carbohydrate binding modules (CBMs) are a class of proteins that have an affinity for cellulose. Depending on the sequence of the CBM, a reversible or irreversible attachment to cellulose can be achieved. Proteins that are members of CBM 2 bind to cellulose in an apparently irreversibly manner (Tomme et al., 1994; Greenwood et al., 1994; Boraston et al., 2004). Due to this property, CBM 2 fusion tags have been applied to immobilize enzymes, including alkaline phosphatase, for industrial applications (Greenwood et al., 1994; Myung et al., 2011). While alkaline phosphatase has been fused with CBM tags to promote purification of the enzyme as well as to enable screening of CBMs for the development of cellulose-degrading enzymes, there have been no studies characterizing the effects of CBM tags on the properties of the free and immobilized enzyme (Greenwood et al., 1989; Kim et al., 2013). In this article, we explore the use of CBM tags for the immobilization of a double mutant AP to cellulosic materials, and describe the resulting properties of the immobilized conjugates.
Plasmids used in the study were synthesized by Invitrogen (USA). The following amino acid mutations (D153G/D330N) were introduced to the phoA gene of E. coli strain RM191F (GenBank accession nos. M29664.1). A double mutant (D135G/D330N) of AP (referred as AP*) was used in this study due to the similar kcat relative to mammalian AP. All genes were codon optimized and synthesized by Invitrogen. Two CBM genes were fused to AP* and synthesized in a pMK- vector—AP*CBMCex (AP* with CBM of exoglucanase (Cex) from Cellulomonas fimi at C-terminus) and CBMCenA-AP* (AP* with CBM of endoglucanase A (CenA) from Cellulomonas fimi at N-terminus). AP* was cloned from Pmk- AP*-CBMCex plasmid. CBMCex and CBMCenA belong to the family of CBM 2 with GenBank accession nos. M15824.1 and M15823.1, respectively. The genes were amplified by polymerase chain reaction (PCR) using primers listed in Table 1. The amplified PCR products along with an empty pET-20b(+) vector were digested with restriction endonucleases NcoI and XhoI. The digested PCR product and vector were further digested with DpnI and Shrimp Alkaline Phosphatase, respectively. The digested PCR product and vector from these reactions were ligated together using T4 DNA ligase and transformed into NEB 5-alpha cells to generate pET-20b(+)-AP*, pET-20b(+)-CBMCenA-AP*, and pET-20b (+)-AP*-CBMCex plasmids. The sequences of the generated constructs were confirmed using Sanger DNA sequencing performed at the Iowa State University DNA Facility. Following sequence and restriction digestion confirmation, the resulting plasmids were transformed into E. coli expression strain T7 Express lysY/Iq.
2. Materials and methods
2.3. Expression of AP* and CBM-fused AP*
2.1. Materials
All inoculations and E coli cell growth were performed in sterilized culture media of LB (Luria–Bertani 1% tryptone, 0.5% yeast extract, 1% NaCl). Ampicillin (100 µg/mL) was used as a selection antibiotic. An overnight culture was started from a fresh plate streaked with cells expressing target enzyme at 37 °C. The next day 10 mL of an overnight culture was diluted into 1000 mL of LB media and grown for 5 h at 37 °C until reaching an OD of 0.7. For slow induction, prior to induction, cells were chilled at 4 °C for 30 min. Subsequently, cells were induced with a sterile filtered solution of IPTG (200 µM), and then grown another 18 h at 20 °C, shaking at 150 rpm. Cells (1 L) were harvested by centrifuging for 45 min at 5000 rpm in Sorvall RC 3B Plus centrifuge. Medium and cell lysate were analyzed for protein expression as well as activity using SDS-PAGE and pNPP assay, respectively.
2.2. Plasmid construction
pET 20b(+) was a kind gift from Professor Robert S. Haltiwanger at Complex Carbohydrate Research Center, The University of Georgia. Hispur Ni-NTA (Nickel-nitrilotriacetic acid) superflow agarose, diethanolamine, imidazole, Bugbuster 10× protein extraction reagent, p-nitrophenyl phosphate (p-NPP), Coomassie (Bradford) dye, casein, Whatman paper 1001-090, and 1-Step™ NBT/BCIP (nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate) substrate solution were purchased from ThermoFisher Scientific. Fast digest restriction endonucleases (NcoI, XhoI) and T4 DNA ligase enzymes were also from ThermoFisher Scientific. Q5 Hot start high-fidelity DNA polymerase, deoxynucleotide (dNTP) solution mix, shrimp alkaline phosphatase, NEB® 5-alpha competent E. coli (Subcloning Efficiency), and T7 Express lysY/Iq competent E. coli (high efficiency) were purchased from New England BioLabs. Oligonucleotides were synthesized in DNA Facility at Iowa State University. 10% precast polyacrylamide gels for use with Mini-PROTEAN electrophoresis cells, econo-column, 1.5 × 10 cm, glass chromatography column (maximum volume 18 mL), and precision plus protein dual Color Standards were from Bio-Rad. Isopropyl-β-D-
2.4. Paper-based assay for CBM -fused AP* Induced cells expressing AP* and CBM-fused AP* in the growth media were also analyzed for expression using a paper-based assay. Strips (3 cm × 1 cm) of Whatman filter paper were pre-incubated with 5% casein (to prevent non-specific binding of proteins) for 20 min at 266
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
linear regression using the Langmuir-type isotherm. The influence of process parameters on immobilization were determined by varying the pH of the binding buffer and the NaCl concentration followed by determination of binding as described, previously. For pH dependent experiments, the following buffers containing 100 mM NaCl were employed: 50 mM sodium phosphate, pH 6.0 and 7.0, 50 mM Tris-HCl, pH 8.0 and 9.0, and 50 mM DEA pH 10.0. NaCl was varied from 50 to 500 mM in 50 mM Tris-HCl pH 8.0 for evaluating effect of salt on the adsorption efficiency.
room temperature (ca. 21 °C) then washed with 50 mM Tris-HCl buffer (pH 8.0; 0.5 M NaCl) Harvested medium 300 µL was incubated with the strips for 20 min, washed three times, and then incubated with NBT/ BCIP. Color change from the resulting reaction of bound AP* on filter paper with NBT/BCIP was monitored visually to determine the presence/expression of CBM-tagged alkaline phosphatase. 2.5. Purification of AP* and CBM-fused AP* A cell pellet (10 g) was obtained from 3 L culture that was frozen at − 80 °C for a minimum of one day. Cell pellets were thawed and then resuspended in 30 mL of 1× Bugbuster solution diluted in Buffer #1 (50 mM sodium phosphate buffer; pH 8.0; 300 mM NaCl) containing 10 mM imidazole, 10 μg/mL DNAase and 1 mM PMSF. The cell suspension was shaken at room temperature for 30 min to promote lysis. The cell lysate (~ 45 mL) was centrifuged in a swing bucket centrifuge at 5000 rpm for 45 min at 4 °C. The resulting supernatant was filtered using a 0.45 µm PVDF filter, diluted with Buffer #1 containing 10 mM imidazole, and loaded on a Ni-NTA column to purify the His-tagged variants of AP*. The Ni-NTA resin was packed in a Bio-rad Econo column and pre-equilibrated with Buffer #1 containing 10 mM imidazole. Columns were washed with Buffer #1 containing 30 mM of imidazole until no more protein was detected in the wash fractions. An imidazole gradient (50–250 mM) in Buffer #1 was employed to elute enzyme fractions. The fractions with AP* activity were pooled together, buffer-exchanged with storage buffer (50 mM Tris, pH 8.0 containing 10 mM MgCl2), concentrated, and stored at − 80 °C until further use. Since phosphate is a competitive inhibitor of AP*, buffer was exchanged from sodium phosphate to Tris buffer after purifications.
2.8. Determination of immobilized enzyme activity Immobilized enzyme was washed twice with 50 mM Tris-HCl (pH 8.0; 100 mM NaCl) and then diluted with 50 mM Tris-HCl, pH 8.0 and 10 mM MgCl2 for activity analysis. Activity of that immobilized conjugates was determined using pNPP as described, previously, for the free enzyme. Thermostability of free and immobilized enzyme was determined as described in Janeway et al. (1993). Samples were diluted in TMZP buffer (50 mM Tris; 100 mM MgC12; 100 µM NaH2PO4; 10 µM ZnSO4 adjusted to pH 7.4), and incubated in a range of 30–95 °C for 15 min. Activity assays were conducted in 50 mM Tris-HCl buffer (pH 8.0;100 mM MgCl2) using 25 mM pNPP. 2.9. Stability of immobilized enzyme attachment Cellulose slurry containing CBM-fused AP* was washed repeatedly (up to 10 washes) with 7 mL of 50 mM Tris-HCl buffer (pH 8.0; 100 mM NaCl; 10 mM MgCl2) at room temperature (ca. 21 °C) for 5 min under end-to-end rotation using a tube rotator, followed by centrifugation at 5000 rpm for 5 min. After the designated number of washes, the slurry was suspended in up to 25 mL of the same buffer and 25 μL sample was withdrawn for the activity assay as described, previously.
2.6. Determination of free enzyme activity using pNPP assay Alkaline phosphatase activity was measured using p-nitrophenyl phosphate (pNPP; 0.05–30 mM) as a substrate under optimum conditions. For wild type E. coli AP, activity was determined in 1 M Tris-HCl (pH 8.0; 10 mM MgCl2) at 25 °C. The activities of all variants of AP* were evaluated in 1 M DEA Buffer (pH 10.0; 10 mM MgCl2; 20 µM ZnCl2) at 37 °C. Prior to the activity assays, AP* variants were incubated at 25 °C for 2 h in 50 mM Tris buffer (pH 8.0; 10 mM MgCl2). The progress of the hydrolysis was monitored spectrophotometrically at 410 nm. An extinction coefficient of 16,200 M−1 cm −1 was used to determine rates of product formation. The substrate-versus-velocity graphs were plotted and fitted to the Michaelis-Menten equation by a non-linear regression using Prism software (Graph Pad, USA) to determine Michaelis constant (Km) and maximum velocity (Vmax). To calculate the turnover number (kcat), Vmax was divided by the initial enzyme concentration assuming a molecular weight of 96, 130 and 118 kDa for dimeric form of AP*, CBMCenA-AP*, and AP*-CBMCex respectively.
3. Results and discussion 3.1. Plasmid construction Untagged as well as CBM-tagged AP* (Fig. 1) were cloned using primers described in Table 1. For all constructs, a pelB signal sequence was introduced at the N-terminal to promote periplasmic localization, and a His-tag sequence was introduced at the C-terminal for purification using affinity chromatography. Based on the strategy adapted from Greenwood et al. (1994), the CBMCenA-AP* construct consisted of a CBM sequence of endonuclease (CenA) from C. fimi followed by a linker consisting of primarily proline-threonine (PT) repeats (PT box) and the Factor Xa recognition sequence, and then the mature AP* sequence (D153G/D330N AP). CBMCenA and CBMCex have been used extensively as fusion tag for the purification and characterization of various proteins (Tomme et al., 1998). The C-terminal AP* fusion, AP*-CBMCex, was developed using a CBM sequence of exonuclease (Cex) from C. fimi at the C-terminal of AP* and was separated by a flexible GSGP linker sequence (Abouhmad et al., 2016).
2.7. Immobilization of CBM-fused AP* onto microcrystalline cellulose Purified CBM fused AP* (0.1–3 mg/mL) was mixed with 2 mg microcrystalline cellulose (50 µm) in 100 µL of total volume at room temperature (ca. 21 °C) under end-to-end rotation using a mini-tube rotator. All adsorption measurements were carried out in 50 mM TrisHCl buffer (pH 8.0; 300 mM NaCl) for one hour. Control tubes contained identical concentrations of enzyme, but no cellulose. The samples were centrifuged at 13,000 rpm for 10 min to separate the cellulose-bound protein from unbound protein. The concentration of bound protein was determined from the difference between the protein concentration in the control incubated without cellulose (total protein) and the unbound protein in the supernatant after incubation with cellulose using Bradford assay. A depletion isotherm of [Bound] (μmol/g of cellulose) vs [Free protein] (μM) was generated. Binding capacity (i.e. density of binding sites per gram of cellulose) was obtained by non-
3.2. Expression and purification of AP* in E. coli Protein expression in soluble fractions (medium and cell lysate) was analyzed using SDS-PAGE as well as a pNPP-based activity assay. All cell cultures were induced with an optimum concentration of 200 µM IPTG for expression of the protein. As seen in Fig. 2, all AP* variants in this study were expressed in the medium and cell lysate, showing distinct bands at ~ 48 and ~ 59 and 65 kDa for the AP*, AP*-CBMCex and CBMCenA-AP*, respectively. Based on the visual analysis of the gel for medium and cell lysate, the expression of AP* was significantly higher than the CBM-tagged AP*. Following affinity purification, approximately 4 mg of both CBM-fused AP* variants and 8 mg of AP* could be recovered from the cell pellet of a 1 L culture. For sake of convenience 267
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Fig. 1. Details of recombinant enzymes cloned and purified. AP* refers to the double mutant D153G/D330N of mature E coli alkaline phosphatase (AP). The first box with small grids represent pelB leader sequence. CBMCenA and CBMCex are cellulose binding modules of endoglucanase and exonuclease from C. fimi, respectively. The grey shaded box represents AP* and vertical lines/ shaded boxes represent CBM domains fused at N- or C-terminal of AP*. Unfilled boxes in each construct represent linker region, extra sequences between the AP* and CBM domain, and/or a His tag.
and consistency, purification of all AP* variants were carried out using cell pellets. Table 2 provides a summary of the expression characteristics of the untagged and tagged variants in the medium and cell lysate. pNPP assays using the crude extract of cell lysate as well as the medium AP*showed higher specific activity for AP* compared to the CBMtagged variants (this was verified using pure protein). In addition to SDS-PAGE and standard enzymatic assay procedures, a cellulose Whatman filter paper assay was developed to quickly screen for the presence of active CBM-tagged enzyme in the expression medium. The assay was based on the assumption that enzyme carrying the CBM fusion tag would bind to the cellulosic filter paper. Following the addition of a precipitating substrate (NBT/BCIP), the presence of the enzyme could be readily observed by the resulting color of the filter paper. As shown in Fig. 3, only the CBM-fused AP* variants showed an intense black-purple precipitate, confirming binding of CBM to cellulose on the filter paper and validating a functional cloning and expression of CBM-fused AP*.
Table 2 Summary of expression and activity of recombinant AP* in medium and cell lysate.
AP* CBMCenA-AP* AP*-CBMCex
Activity in medium
Activity in cell lysate
Band in gel in medium
Band in gel in cell lysate
Activity on cellulose filter paper from medium
++ + +
++ + +
++ + +
++ + +
– + +
Fig. 3. Filter-paper based assay of CBM fused AP*. For each recombinant protein, filter paper was pre-incubated with 5% casein, washed, incubated with untagged or CBM-fused AP*, washed again and then incubated with NBT/BCIP to qualitatively identify active AP* as denoted by the presence of the purple color.
3.3. Immobilization of CBM-fused AP* onto cellulose Conditions for immobilization were optimized using AP*-CBMCex and then applied in subsequent experiments to AP*-CBMCex as well as CBMCenA-AP*. A crude experiment showed maximal binding of CBM-
Fig. 2. SDS-PAGE analysis in soluble fractions. A and B denotes expression of AP*, AP*-CBMCex and CBMCenA-AP* in cell lysate and medium, respectively. 10 μg of cell lysate and medium protein were loaded on a 10% SDS-PAGE gel.
268
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Fig. 4. Effect of pH (a) and salt concentration (b) on the adsorption of AP*-CBMCex onto cellulose (n = 3).
3.4. Kinetic characterization of free and immobilized enzymes
tagged protein to cellulose at 60 min, hence all the immobilization reactions were carried out at least for 60 min. For optimization experiments, aliquots of AP*-CBMCex incubated with cellulose in different conditions were removed and analyzed for bound protein. The effect of pH was evaluated by carrying out the adsorption reaction in different buffers. As indicated in Fig. 4, a minor decrease in protein immobilization was seen with pH above 8.0. With respect to effect of salt concentration on the adsorption efficiency, altering NaCl concentration did not significantly change the extent of enzyme immobilization. From the above optimization experiments, all subsequent adsorption experiments were performed at pH 8.0 and 300 mM NaCl for one hour. Relative adsorption was defined as the fraction of binding capacity at a given point compared to the maximum binding capacity for Avicel determined in this study. Loading of the recombinant enzymes was evaluated to determine the maximum amount of enzymes that could be immobilized on the cellulose microparticles. Cumulative isotherm data derived from depletion assay of binding of CBM-fused AP* to cellulose (Fig. 5) indicated a maximum loading (binding capacity) of 0.33 µmole of enzyme/g of cellulose for CBMCenA-AP* and 0.26 µmole of enzyme/g of cellulose for AP*-CBMCex could be achieved using the defined methods. The determination of the binding capacity of CBM 2 to Avicel has not been previously reported, however, the binding capacity of CBM17 and CBM28 has been reported to vary from 0.08 to 5 µmole/g of cellulose (Boraston et al., 2003).
Steady-state kinetic parameters were obtained for wild-type AP, AP*and CBM-fused AP* variants (Table 3). Compared to the wild-type enzyme, the double mutation (D153G/D330N) of the bacterial alkaline phosphatase resulted in an increase in the turnover number (kcat) from 29 s−1 to 1540 s−1. This result confirms previous reports that this mutation enhances the kcat by 40-fold (Muller et al., 2001). The specific activity of AP from Sigma in our study was 18.3 U/mg, which is lower than its reported specific activity (30–60 U/mg of protein). This could be due to the difference in pH and temperature used in our study (1 M Tris-HCl Buffer, pH 8.0, 10 mM MgCl2 at 25 °C) compared to the reported condition of glycine buffer at pH 10.4 at 37 °C. In this study, we followed the optimal condition for assaying wild-type AP and AP* as reported by Muller et. al (Muller et al., 2001). However, in our study the kcat for AP* was determined to be approximately two-fold lower than reported by Muller et al., this could be due to some residual phosphate despite extensive buffer exchange after the purification in sodium phosphate buffer. The addition of a CBM tag resulted in a decrease in kcat for both CBMCenA-AP* (767 s−1) and AP*-CBMCex (918 s−1) when compared to the unmodified mutant enzyme AP* (1540 s−1). This result suggests that modification with the CBM tag alters the turnover of the mutant enzyme, and that the extent of the activity change occurs irrespective of the position of the tag (i.e at the N or C-terminal). Compared to the wild-type enzyme, the double mutant enzyme had a higher Km (390 µM vs 40 µM for the wild-type) consistent with other reported literature (Le Du et al., 2002; Muller et al., 2001). Introduction of the CBM-tag did not significantly alter the Km of AP*-
Fig. 5. Adsorption isotherms for binding of CBMCenA-AP* (a) and AP*-CBMCex (b) to cellulose in 50 mM Tris pH 8.0 and 300 mM NaCl at room temperature (n = 2).
269
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Table 3 Kinetic parameters of E. coli wild type alkaline phosphatase (AP), double mutant alkaline phosphatase (AP*), and CBM-fused AP*. 1Assay was conducted in 1 M Tris-HCl Buffer, pH 8.0, 10 mM MgCl2 at 25 °C, all other assays were performed in 1 M DEA Buffer, pH 10.0, 10 mM MgCl2 and 40 μM ZnCl2 at 37 °C. 2The kcat values were computed from the Vmax values by assuming a dimer molecular mass for each enzyme (n = 3).
kcat, s−1 Km, mM kcat-fold difference compared to E. coli AP
2
AP1
AP*
CBMCenA-AP*
Immobilized CBMCenA-AP*
AP*-CBMCex
Immobilized AP*-CBMCex
29.3 ± 0.8 0.04 ± 0.01 1.0
1510 ± 65 0.39 ± 0.07 52.5
767 ± 28 0.86 ± 0.11 26.1
620 ± 32 1.98 ± 0.46 21.1
918 ± 33 0.46 ± 0.06 31.3
770 ± 65 4.90 ± 1.10 26.2
enzyme was measured after a 2 h pre-incubation in TMZP buffer (Fig. 7). The Tm for AP* was determined to be 84 °C compared to 87 °C for AP* as reported by Muller et al. (2001). The Tm of CBMCenA-AP* and AP*-CBMCex was determined to be 85 °C and 84 °C, respectively. This result suggests that fusing the CBM tag to the AP* did not significantly perturb thermal stability of AP*. However, the Tm for both the immobilized CBMCenA-AP* and AP*-CBMCex was reduced to 70 and 77 °C, respectively. The reduced thermostability of the immobilized AP* variants could be due to some conformational change or reduced entropy due to immobilization that disrupts the stability conferred by the free enzyme. Fig. 6. Effect on washing cellulose immobilized with CBM-fused AP* on the retained activity. Activity was determined before washing, then after the 4th and 10th wash (n = 3).
4. Conclusion In summary, we have successfully expressed and purified N- and Cterminal CBM fused AP*from E. coli and characterized the enzymes in their free and immobilized states. Under optimal conditions, binding of a CBM fusion tag to either terminal yields considerable retention of catalytic efficiency in both free and immobilized states when compared to the untagged enzyme. The tagged enzymes can be readily immobilized to microcrystalline cellulose and can be repeatedly washed without loss of catalytic activity. These results suggest that immobilized CBM-tagged AP* may be a viable form for the pragmatic utilization of alkaline phosphatase in biotechnology applications. References Abouhmad, A., Mamo, G., Dishisha, T., Amin, M.A., Hatti-Kaul, R., 2016. T4 lysozyme fused with cellulose-binding module for antimicrobial cellulosic wound dressing materials. J. Appl. Microbiol. 121 (1), 115–125. Alissandratos, A., Halling, P.J., 2012. Enzymatic acylation of starch. Bioresour. Technol. 115, 41–47. Babich, L., Peralta, J., Hartog, A., Wever, R., 2013. Phosphorylation by alkaline phosphatase: immobilization and synthetic potential. Int. J. Chem. 5 (3), 82–98. Boraston, A.B., Bolam, D.N., Gilbert, H.J., Davies, G.J., 2004. Carbohydrate-binding modules: fine-tuning polysaccharide recognition. Biochem. J. 382, 769–781. Boraston, A.B., Kwan, E., Chiu, P., Warren, R.A.J., Kilburn, D.G., 2003. Recognition and hydrolysis of noncrystalline cellulose. J. Biol. Chem. 278 (8), 6120–6127. Cao, R., Guan, L., Li, M., Tian, J., Shen, W., 2015. A zero-step functionalization on paperbased biosensing platform for covalent biomolecule immobilization. Sens. Bio-Sens. Research 6, 13–18. Dealwis, C.G., Chen, L.Q., Brennan, C., Mandecki, W., Abadzapatero, C., 1995. 3-d structure of the d153g mutant of Escherichia coli alkaline phosphatase: an enzyme with weaker magnesium binding and increased catalytic activity. Protein Eng. 8 (9), 865–871. Greenwood, J.M., Gilkes, N.R., Kilburn, D.G., Miller, R.C., Warren, R.A.J., 1989. Fusion to an endoglucanase allows alkaline-phosphatase to bind to cellulose. FEBS Lett. 244 (1), 127–131. Greenwood, J.M., Gilkes, N.R., Miller, R.C., Kilburn, D.G., Warren, R. a.J., 1994. Purification and processing of cellulose-binding domain-alkaline phosphatase fusion proteins. Biotechnol. Bioeng. 44 (11), 1295–1305. Jafary, F., Panjehpour, M., Varshosaz, J., Yaghmaei, P., 2016. Stability improvement of immobilized alkaline phosphatase using chitosan nanoparticles. Braz. J. Chem. Eng. 33 (2), 243–250. Janeway, C.M.L., Xu, X., Murphy, J.E., Chaidaroglou, A., Kantrowitz, E.R., 1993. Magnesium in the active-site of escherichia-coli alkaline-phosphatase is important for both structural stabilization and catalysis. Biochemistry 32 (6), 1601–1609. Khan, M.S., Garnier, G., 2013. Direct measurement of alkaline phosphatase kinetics on bioactive paper. Chem. Eng. Sci. 87, 91–99. Kim, H.D., Choi, S.L., Kim, H., Sohn, J.H., Lee, S.G., 2013. Enzyme-linked assay of cellulose-binding domain functions from cellulomonas fimi on multi-well microtiter plate. Biotechnol. Bioprocess Eng. 18 (3), 575–580. Le Du, M.H., Lamoure, C., Muller, B.H., Bulgakov, O.V., Lajeunesse, E., Menez, A., Boulain, J.C., 2002. Artificial evolution of an enzyme active site: structural studies of
Fig. 7. Heat stability of AP*, CBMCenA-AP* and AP*-CBMCex. The enzyme was diluted 100-fold into TMZP buffer. The enzyme sample was heated at the indicated temperature for 15 min. The samples were then quenched on ice and the activity was measured in 50 mM Tris-HCl, pH 8.0 and 100 mM MgCl2 (n = 3).
CBMCex, but led to 2.2-fold increase in the Km for CBMCenA-AP* compared to AP*. Immobilization of the CBM-fused AP* variants onto 50 µm microcrystalline cellulose particles did not significantly (p ≤ 0.05) alter the turnover of the enzyme—indicating that the enzyme retains catalytic activity when attached to cellulose particles. As seen in Table 3, the Km of the immobilized conjugate significantly increased compared to the unbound counterparts indicating the possibility of diffusion limitations or conformational changes following immobilization. 3.5. Stability of immobilized CBM-fused AP* CBM proteins belonging to family 2 are known to bind, irreversibly, to cellulose under conditions of nominal salt and in the absence of elution compounds such as pure water, ethylene glycol and guanidinium hydrochloride (Tomme et al., 1994; Ong et al., 1989).. Under conditions of washing in 50 mM Tris pH 8.0, 10 mM MgCl2 and 100 mM NaCl involving multiple centrifugation steps, AP* activity was not lost for up to 10 washes (Fig. 6). This is in agreement with minimum leaching of proteins fused to CenA/Cex (Ong et al., 1989). To assess if fusing CBM to AP* and immobilization of CBM-fused AP* to cellulose altered its thermal stability, the denaturation temperature of each 270
Biocatalysis and Agricultural Biotechnology 13 (2018) 265–271
S. Singh et al.
Ong, E., Gilkes, N.R., Warren, R.A.J., Miller, R.C., Kilburn, D.G., 1989. Enzyme immobilization using the cellulose-binding domain of a cellulomonas-fimi exoglucanase. Bio-Technology 7 (6), 604–607. Osathanon, T., Giachelli, C.M., Somerman, M.J., 2009. Immobilization of alkaline phosphatase on microporous nanofibrous fibrin scaffolds for bone tissue engineering. Biomaterials 30 (27), 4513–4521. Tomme, P., Boraston, A., Mclean, B., Kormos, J., Creagh, A.L., Sturch, K., Gilkes, N.R., Haynes, C.A., Warren, R.A.J., Kilburn, D.G., 1998. Characterization and affinity applications of cellulose-binding domains. J. Chromatogr. B 715 (1), 283–296. Tomme, P., Gilkes, N.R., Miller, R.C., Warren, A.J., Kilburn, D.G., 1994. An internal cellulose-binding domain mediates adsorption of an engineered bifunctional xylanase cellulase. Protein Eng. 7 (1), 117–123. Tzanavaras, P.D., Themelis, D.G., 2002. Simultaneous flow-injection determination of fluoride, monofluorophosphate and orthophosphate ions using alkaline phosphatase immobilized on a cellulose nitrate membrane and an open-circulation approach. Anal. Chim. Acta 467 (1–2), 83–89. Wang, S.M., Su, P., Huang, J., Wu, J.W., Yang, Y., 2013. Magnetic nanoparticles coated with immobilized alkaline phosphatase for enzymolysis and enzyme inhibition assays. J. Mater. Chem. B 1 (12), 1749–1754. Zubriene, A., Budriene, S., Lubiene, J., Dienys, G., 2002. Immobilized alkaline phosphatase for molecular cloning. Biocatal. Biotransformation 20 (6), 423–427.
three highly active mutants of escherichia coli alkaline phosphatase. J. Mol. Biol. 316 (4), 941–953. Lee, P., Swaisgood, H.E., 1998. Cloning and expression of a streptavidin-lipase fusion gene in Escherichia coli and characterization of the immobilized fusion protein. Enzym. Microb. Technol. 22 (4), 246–254. Lu, L., Xu, S., Zhao, R., Zhang, D., Li, Z., Li, Y., Xiao, M., 2012. Synthesis of galactooligosaccharides by cbd fusion beta-galactosidase immobilized on cellulose. Bioresour. Technol. 116, 327–333. Mateo, C., Palomo, J.M., Fernandez-Lorente, G., Guisan, J.M., Fernandez-Lafuente, R., 2007. Improvement of enzyme activity, stability and selectivity via immobilization techniques. Enzym. Microb. Technol. 40 (6), 1451–1463. Muller, B.H., Lamoure, C., Le Du, M.H., Cattolico, L., Lajeunesse, E., Lemaitre, F., Pearson, A., Ducancel, F., Menez, A., Boulain, J.C., 2001. Improving Escherichia coli alkaline phosphatase efficacy by additional mutations inside and outside the catalytic pocket. Chembiochem 2, 517–523. Myung, S., Zhang, X.-Z., Zhang, Y.H.P., 2011. Ultra-stable phosphoglucose isomerase through immobilization of cellulose-binding module-tagged thermophilic enzyme on low-cost high-capacity cellulosic adsorbent. Biotechnol. Prog. 27 (4), 969–975. Naal, Z., Park, J.H., Bernhard, S., Shapleigh, J.P., Batt, C.A., Abruna, H.D., 2002. Amperometric tnt biosensor based on the oriented immobilization of a nitroreductase maltose binding protein fusion. Anal. Chem. 74 (1), 140–148.
271