Fusion of the Fc part of human IgG1 to CD14 enhances its binding to Gram-negative bacteria and mediates phagocytosis by Fc receptors of neutrophils

Immunology Letters 146 (2012) 31–39

Contents lists available at SciVerse ScienceDirect

Immunology Letters journal homepage: www.elsevier.com/locate/immlet

Fusion of the Fc part of human IgG1 to CD14 enhances its binding to Gram-negative bacteria and mediates phagocytosis by Fc receptors of neutrophils András Vida a , Bart Bardoel b , Fin Milder b , László Majoros c , Andrea Sümegi d , Attila Bácsi e , György Vereb f , Kok P.M. van Kessel b , Jos A.G. van Strijp b , Péter Antal-Szalmás a,∗ a

Department of Laboratory Medicine, Medical and Health Science Center, University of Debrecen, Debrecen, Hungary Department of Medical Microbiology, University Medical Center Utrecht, Utrecht, The Netherlands c Department of Medical Microbiology, Medical and Health Science Center, University of Debrecen, Debrecen, Hungary d Vascular Biology, Thrombosis and Hemostasis Research Group, Hungarian Academy of Sciences, Debrecen, Hungary e Department of Immunology, Medical and Health Science Center, University of Debrecen, Debrecen, Hungary f Department of Biophysics and Cell Biology, Medical and Health Science Center, University of Debrecen, Debrecen, Hungary b

a r t i c l e

i n f o

Article history: Received 9 December 2011 Received in revised form 11 April 2012 Accepted 13 April 2012 Available online 2 May 2012 Keywords: CD14 Fc Gram-negative bacteria Opsonization Phagocytosis

a b s t r a c t Microbial resistance to antimicrobial drugs is promoting a search for new antimicrobial agents that target highly conservative structures of pathogens. Human CD14 – a known pattern recognition receptor (PRR) which recognizes multiple ligands from different microbes might be a worthy candidate. The aim of our work was to create a CD14/Fc dimer protein and evaluate its whole bacteria binding and opsonizing capabilities. Fusion of CD14 with the fragment crystallisable (Fc) part of human IgG1 could not only lead to an artificial opsonin but the dimerization through the Fc part might also increase its affinity to different ligands. Human CD14 and the Fc part of human IgG1 was fused and expressed in HEK293 cells. A histidine tagged CD14 (CD14/His) was also expressed as control. Using flow cytometry we could prove that CD14/Fc bound to whole Gram-negative bacteria, especially to short lipopolysaccharide (Ra and Re) mutants, and weak interaction was observed between the fusion protein and Listeria monocytogenes. Other Gram-positive bacteria and fungi did not show any association with CD14/Fc. CD14/His showed about 50-times less potent binding to Gram-negative bacteria. CD14/Fc acted as an opsonin and enhanced phagocytosis of these bacteria by neutrophil granulocytes, monocyte-derived macrophages and dendritic cells. Internalization of bacteria was confirmed by trypan blue quenching and confocal microscopy. On neutrophils the Fc part of the fusion protein was recognized by Fc receptors (CD16, CD32), as determined by blocking experiments. CD14/Fc enhanced the killing of bacteria in an ex vivo whole blood assay. Our experiments confirm that PRR/Fc fusion proteins can give a boost to FcR dependent phagocytosis and killing provided the antimicrobial part binds efficiently to microbes. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Pathogens developing resistance to currently used antibiotics pose a growing threat especially to patients with compromised immune system such as infants, hosts with - inherited or acquired immunodeficiency or hematological malignancy [1]. During the last decade the discovery rate of new antibiotics slowed down forcing antimicrobial research into new directions [1,2]. Several hundreds of novel antimicrobial molecules have been tested so far – including human cationic proteins, pentraxins, RNases, phospholypases, peptidoglycan recognition proteins, collectins, serpocidins, defensins

∗ Corresponding author at: Department of Laboratory Medicine, Medical and Health Science Center, University of Debrecen, Hungary, Debrecen-4032, Nagyerdei str. 98, Hungary. Tel.: +36 52 340006; fax: +36 52 417631. E-mail address: [email protected] (P. Antal-Szalmás). 0165-2478/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.imlet.2012.04.008

etc. – and smaller peptides based on these proteins/oligopeptides. Antimicrobial molecules of plants, vertebrates and other animals – e.g. bombinins – also showed promising results; furthermore, several bacterial molecules – e.g. endolysins or lantibiotics – might potentially be used for the elimination of other microbes [3,4]. An important component of the human innate immune system – CD14 – plays a crucial role in lipopolysaccharide (LPS) recognition and signaling which also involves LPS-binding protein (LBP) and the Toll-like receptor 4 (TLR4)/MD2 receptor complex [5–7]. CD14 is a 356 amino acid glycoprotein encoded on chromosome 5q2331 that is mainly expressed by myeloid cells and exists both in a membrane bound (mCD14) and soluble (55 kDa or 49 kDa sCD14) forms [5,8–10]. It is well established that both mCD14 and sCD14 binds lipopolysacharide – the major common and conserved structure of Gram-negative bacteria – especially in the presence of LBP [5,11,12]. Beside its interaction with LPS it has been reported that

32

A. Vida et al. / Immunology Letters 146 (2012) 31–39

CD14 is able to bind – though with lower affinity – different strains of Gram-negative bacteria [13,14], and this interaction also requires the presence of LBP [5,15]. On the other hand, the majority of these studies have shown only the mCD14-dependent phagocytosis of these bacteria and only one group proves directly the binding of this pattern recognition receptor (PRR) to whole microbes [13,14,16,17]. A recent tendency in antimicrobial research is the combination of effector functions of one antimicrobial molecule with another component of the immune system. Examples are the fusion of cationic proteins such as CAP18 or BPI23 to the fragment crystallisable (Fc) part of human IgG1 [18,19]. The advantage of coupling proteins to the Fc part of human IgG1 is their prolonged in vivo half-life time, decrease in renal toxicity and possible opsonizing properties which may lead to activation of the complement system and Fc receptors [20,21]. The use of cationic proteins as a part of such an antimicrobial fusion molecule seems to be very effective [18,19,21–23]. CD14 as a key LPS binding molecule seems like a worthy candidate being an antimicrobial partner in a combined molecule. Fusion of CD14 with the Fc part of human IgG1 could not only lead to an artificial opsonin recognizing a wide range of microbes but the dimerization through the Fc part might also increase its affinity to different ligands as it has been described earlier for affibody/Fc chimeras [24]. Based on these we created a CD14/Fc fusion protein, and a His tagged CD14 (CD14/His) as control, to evaluate the possible opsonizing properties thereof and describe the effect of the Fc fusion and dimerization on whole bacteria binding. 2. Materials and methods 2.1. LPS, bacteria and fungi For functional testing of CD14/Fc and CD14/His S. minnesota Re (#595) LPS (Sigma, St. Louis, MO) was used. For binding and phagocytosis studies the following bacteria and fungi were tested: Escherichia coli (ATCC 25922), Salmonella hartford (Hungarian National Center of Epidemiology 100063), Lysteria monocytogenes (Hungarian National Center of Epidemiology 130001), Streptococcus pneumoniae (ATCC 49619), Salmonella typhimurium wild type (#657), S. typhimurium Ra (#656), S. typhimurium Re (#658), S. minnesota Re (#595), Candida albicans (#10231), C. tropicalis (#555) (clinical isolates). 2.2. Cloning and expression of the CD14/Fc and CD14/His proteins The cDNA of CD14 obtained from the cDNA library of Medical Microbiology, University Medical Center, Utrecht was amplified with the following primers, which introduced BamHI and NotI restriction sites to the 5 and 3 ends of the PCR product, respectively: P1-5 TCGGATCCACCACGCCAGAACCTTG3 , P2-5 CAGCGGCCGCCAGCACCAGGGTTCCCGA3 . Cloning was performed as instructed by the manual of TOPO TA Cloning® kit for sequencing (Invitrogen, Carlsbad, CA). Briefly, the PCR product was incubated in the presence of Taq polymerase to obtain 3 A overhangs. Subsequently, the CD14 cDNA was cloned into a linearized pCR® 4-TOPO® vector with 3 T overhangs (Invitrogen, Carlsbad, CA). One Shot® TOP10 cells (Invitrogen, Carlsbad, CA) were transformed with the vector containing the CD14 insert and cultured on LB plates containing carbenicillin (Invitrogen, San Diego, CA). Bacteria colonies were further grown overnight in liquid LB medium containing carbenicillin. Bacteria were collected via centrifugation and plasmid was isolated with QIAprep Miniprep Kit (Qiagen, Hilden, Germany) as instructed by the kit manual. Isolated plasmids were screened for the correct insert by BamHI/NotI (New

England Biolabs, Ipswich, MA) restriction digestion and the inserts were sequence verified. The verified insert was sub-cloned into the two expression vectors pABC-CMV-cystatin-dE-dH-FcC-TEV and pABC-CMV-dE-dH-optimal-hisN-TEV (U-protein Express, Utrecht, NL) containing the sequence of the Fc part of human IgG and the sequence of the His tag, respectively, as described before [25]. Expression was performed at U-Protein Express B.V. (Utrecht, NL) in HEK293 cells. CD14/Fc protein was purified with a Protein G column while CD14/His protein was purified with a nickel column (GE Healthcare, Little Chalfont, Buckinghamshire, UK) according to the manufacturers’ instructions. Protein purity was verified by SDS-PAGE, under both reducing and non-reducing conditions and western blotting as described before [25]. 2.3. Binding of CD14/Fc and CD14/His to LPS The LPS binding property of the fusion protein and the His tagged control protein was verified by ELISA. ELISA plates (Invitrogen, San Diego, CA) were coated with 30 ␮g/ml of S. typhimurium Re (#595) LPS and 1 ␮g/ml CD14/Fc or CD14/His was added with 100 ng/ml LBP (R&D systems, Minneapolis, MN, USA) after blocking. Bound CD14/Fc was detected using a peroxidase conjugated anti-human IgG antibody (1:6000 dilution, DAKO, Copenhagen, Denmark) while bound CD14/His was detected by a biotinylated polyclonal anti-CD14 antibody (dilution: 1:100) and streptavidin-horseradish peroxidase (dilution: 1:250; R&D systems, Minneapolis, MN). Tetra-methyl benzidine/H2 O2 substrate system (Sigma, St. Louis, MO) was used as chromogen and substrate for detection and the absorbance was measured at 405 nm using a Labsystem Multiscan MS ELISA reader (Labsystems, Helsinki, FI) 2.4. Normal human serum, cell isolation and cell cultures Normal human serum: blood was drawn from healthy volunteers after informed consent and normal human serum (NHS) was obtained after pooling the sera of 10 donors and stored at −70 ◦ C until further use. PMN cells: Polymorphonuclear (PMN) cells were isolated from peripheral blood obtained from healthy human volunteers after informed consent. Blood was collected into heparin tubes (BD Vacutainer, Franklin Lakes, NJ) and diluted 1:1 with phosphatebuffered saline (PBS) (pH 7.4), and layered on a discontinuous Ficoll gradient (1077/1119 g/l Sigma–Aldrich, St. Louis, MO). After centrifugation for 30 min at 700 g at room temperature the PMN cell ring was collected and remaining red blood cells were lysed with distilled water. After 30 s the isotonic osmolarity was rapidly restored by adding 1/10 volume of 10× PBS. Subsequently isolated cells were washed twice and resuspended in PBS at 5 × 106 cells/ml. The viability of the cells, judged by trypan blue or propidium iodide exclusion, exceeded 95%. Purity of the cell fraction was checked by microscopy of cytospin slides and was over 98%. Monocyte-derived macrophages and dendritic cells: Human monocytes were isolated from heparinized leukocyte-enriched buffy coats of healthy blood donors drawn at the Regional Blood Center of Hungarian National Blood Transfusion Service (Debrecen, Hungary), with the written approval of the Director of the National Blood Transfusion Service and the Regional and Institutional Ethics Committee of the University of Debrecen, Medical and Health Science Center (Debrecen, Hungary). Written informed consent was obtained from donors prior to blood donation, and their data were processed and stored according to the directives of the European Union. PBMCs were isolated by centrifugation on a Ficoll-Paque (1077 g/l; GE Healthcare, Uppsala, Sweden) density gradient, and monocytes were

A. Vida et al. / Immunology Letters 146 (2012) 31–39

separated from PBMCs using magnetic anti-CD14 microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany), according to the manufacturer’s instructions. Purity of the monocyte fraction was ≥97%, as determined by flow cytometric analysis. For monocyte-derived macrophages monocytes were cultured in 24-well tissue culture plates at a density of 1 × 106 cells/ml in RPMI (Sigma–Aldrich) supplemented with 2 mM L-glutamine (Sigma–Aldrich), 100 U/ml penicillin, 100 ng/ml streptomycin, and 10% heat-inactivated FCS (Invitrogen). To obtain macrophages, monocytes were cultured in the presence of 50 ng/mL M-CSF (Peprotech EC, London, UK) for 5 days. For monocyte-derived dendritic cells monocytes were cultured in 24-well tissue culture plates at a density of 2 × 106 cells/ml in RPMI (Sigma–Aldrich) supplemented with 2 mM L-glutamine (Sigma–Aldrich), 100 U/ml penicillin, 100 ng/ml streptomycin, and 10% heat-inactivated FCS (Invitrogen). Cells were stimulated with 80 ng/ml GM-CSF (Gentaur Molecular Products, Brussels, Belgium) and 100 ng/ml IL-4 (Peprotech EC) immediately and on day 2. Cells were used for experiments on day 5, at which point ≥90% expressed immature DC phenotype (DC-SIGN/CD209+, CD14low) and ≥85% were CD1a positive. SKBr-3 cells: The SKBr-3 human breast carcinoma cell-line was obtained from ATCC and was cultured in DMEM supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 ng/ml streptomycin, and 10% heat-inactivated FCS. 2.5. Fluorescent labeling of bacteria and fungi Bacteria were heat inactivated (80 ◦ C for 2 h) and killing was confirmed by culturing on blood agar plates (Oxoid, Cambridge, UK) for 3 days. Fungi were heat inactivated at 65 ◦ C for 2 h, and heat killing was confirmed by culturing on Sabouraud plates (Oxoid, Cambridge, UK) for 3 days. After killing bacteria and fungi were suspended in PBS and labeled with fluorescein-isothiocyanate (FITC, 40 ␮g/ml for 45 min at 4 ◦ C for bacteria and 0.2 ␮g/ml for 45 min at 4 ◦ C for fungi). Microbes were washed twice with PBS to remove excess FITC and subsequently resuspended in PBS. Labeling and absolute bacteria count was verified by flow cytometry. Labeled bacteria and fungi were aliquoted and stored at −20 ◦ C until further use. 2.6. Binding of CD14/Fc and CD14/His to bacteria and fungi FITC labeled bacteria (5 × 107 ml–1 ) and fungi (5 × 107 ml–1 ) were incubated with or without LBP (100 ng/ml–1 ) and CD14/Fc or CD14/His (5 ␮g/ml–1 ). Two-hour (short LPS strains) and 24h (wild type bacteria and fungi) incubations at 37 ◦ C were used. After incubation microbes were washed twice with PBS containing 0.1% BSA. Bound CD14/Fc was labeled by incubating with Cy5-goat-anti-human IgG (heavy + light chain) antibody (Jackson Laboratory, Sacramento, CA; dilution: 1:100) at 4 ◦ C for 45 min. For detection of bound CD14/His an anti-His-phycoerythrein antibody was used (Miltenyi Biotec, dilution 1:100). After washing bacteria were re-suspended in PBS containing 1% PFA and measured by a flow cytometer (FACSCalibur, BD, Franklin Lakes, NJ). Bacteria were gated based on their forward and side scatter properties. The mean Cy5 intensity for CD14/Fc or the mean phycoerythrein (PE) intensity for CD14/His of FITC positive events was calculated. For LPS competition and blocking experiments CD14/Fc was preincubated with LPS (two-fold dilutions ranging from 20 to 0.2 ␮g/ml) or an anti-CD14 blocking antibody (two-fold dilutions ranging from 40 to 0.6 ␮g/ml; purified from the supernatant of the myeloma cell line “60bca” obtained from ATCC by a Protein G column). After 1 h these mixtures were added to bacteria and the binding of CD14/Fc was evaluated as described above. For CD14/Fc

33

and CD14/His competition experiments 1 ␮g/ml CD14/Fc was mixed with different concentrations (two-fold dilutions ranging from 350 to 0.7 ␮g/ml) of CD14/His and immediately added to S. typhimurium Re in the presence of 100 ng/ml LBP. After 2 h of incubation samples were evaluated as described above and percentage of blocking compared to samples without CD14/His was calculated. 2.7. Phagocytosis of CD14/Fc opsonized bacteria FITC-labeled bacteria opsonized with CD14/Fc were preincubated with 5 ␮l PBS or 10% serum at 37 ◦ C for 15 min. Subsequently 35 ␮l PMN, macrophage, dendritic cell or SKBr-3 cell suspension (1.7 × 105 cells) was added and samples were further incubated at 37 ◦ C for another 30 min. Cells were washed twice, resuspended in PBS or PFA 1% and were measured by flow cytometry (FACSCalibur, BD, Franklin Lakes, NJ). Cells were gated based on their forward and side scatter properties while the percentage of FITC positive cells was measured. Samples were prepared in triplicate or quadruplicate in the case of macrophages and dendritic cells. For phagocytosis blocking experiments PMN cells were preincubated for 45 min with an anti-CD16 (3G8, Abcam, Cambridge, UK) and/or anti-CD32 (purified from the supernatant of the myeloma cell line “IV-3” obtained from ATCC by a Protein G column) blocking antibodies (20 ␮g/ml) at 4 ◦ C. Trypan blue (TB) quenching was used to evaluate whether the fluorescent signal of PMN cells resulted from bacteria attached to the surface of the cells or from bacteria internalized. Therefore, after determining the total fluorescent signal, 5 ␮l of TB (5 mg/ml, Merck, Darmstadt, Germany) was added to 125 ␮l sample and incubated for 1 min. These samples were evaluated by flow cytometry. Confocal laser scanning microscopy (Zeiss LSM 510, Carl Zeiss AG, Jena Germany) was used to determine the cellular localization of bacteria. After reacting to FITC-labeled bacteria, AlexaFluor647-conjugated anti-MHC-I (clone W6/32) and propidium iodide (PI; Sigma) labeled and formaldehyde-fixed cells were mounted under glass coverslips. FITC was excited at 488 nm, PI at 543 nm, and AlexaFluor647 at 633 nm. Fluorescence emission was detected through 505 to 550 nm, 560 to 615 nm and 650 to 710 nm band-pass filters, respectively. Excitation and emission were separated by a UV/488/543/633 quad dichroic mirror. Images were taken in multi track mode to prevent channel cross-talk. Image stacks of 512 × 512-pixel, 1 ␮m thick optical sections were obtained with a 40× C-Apochromat water immersion objective (NA = 1.2). 2.8. Ex vivo killing of CD14/Fc opsonized bacteria In the killing assay 3 × 103 CFU S. typhimurium wt. or Re bacteria were added to 1 ml heparin-anticoagulated whole blood with or without 5 ␮g/ml CD14/Fc. After mixing the samples were incubated for 60 min at 37 ◦ C while gently shaken and then 100 ␮l blood sample was spread on pre-warmed blood agar plates and cultured for 24 h at 37 ◦ C. Following the 24-h incubation colonies on blood agar plates were counted and compared to the appropriate controls. 2.9. Statistical analysis The differences in CD14/Fc and CD14/His binding to different bacteria or fungi between the samples with and without CD14/Fc or CD14/His were evaluated using the Wilcoxon matched pair test. The Wilcoxon test was applied in the evaluation of the phagocytosis and killing assay experiments and in the inhibition studies. The statistical analysis was performed with the Statistics for Windows software. The differences were considered significant at p < 0.05.

34

A. Vida et al. / Immunology Letters 146 (2012) 31–39

3. Results 3.1. Expression and characterization of human recombinant CD14/Fc and CD14/His proteins

Fig. 1. SDS-PAGE analysis of the purified CD14/Fc fusion protein and CD14/His protein. CD14/Fc under non-reducing (NR, lane 2) and reducing (R, lane 3) conditions. The observed molecular weights correspond to an Fc-mediated dimerized form of ∼160 kDa (lane 2) and the monomeric form of ∼80 kDa (lane 3). CD14/His has an observed molecular weight of ∼50 kDa both under reducing and non-reducing conditions (NR, lane 4; R lane 5).

A CD14/Fc fusion protein and a CD14/His protein were expressed in HEK293 cells and purified on a Protein G and nickel column respectively. After purification a total of 35 mg CD14/Fc was obtained. Size and purity was determined by reducing and nonreducing SDS-PAGE. The molecular weight of the cloned CD14 was approximately 50 kDa, while the Fc part was approximately 30 kDa, resulting in a fusion protein of 80 kDa. As CD14/Fc forms a dimer via its Fc part its size on a non-reducing gel was approximately 160 kDa (Fig. 1, lane 2), while upon reducing conditions the 80 kDa monomers were observed (Fig. 1, lane 3). CD14/His was purified on a nickel column resulting in a total of 8 mg protein. Size (approximately 50 kDa) and purity was determined by SDS-PAGE (Fig. 1, lanes 4 and 5). Biological activity of the expressed proteins was confirmed by their LBP dependent binding to an LPS coated ELISA plate as described in the Section 2. The OD for 1 ␮g/ml CD14/Fc and CD14/His was 0.75 ± 0.16 and 0.38 ± 0.03 while background was 0.03 ± 0.02 and 0.04 ± 0.02, respectively (data not shown).

Fig. 2. Binding of CD14/Fc and CD14/His to different bacteria. CD14/Fc and CD14/His bound to different bacteria was detected by a Cy5-anti-human-IgG or PE-anti-His antibody respectively, and the median Cy5 and PE intensities were measured. In panel C the fluorescence intensity of Cy5 or PE measured in the presence of the secondary antibody only were set as 1 and the corresponding CD14/Fc or CD14/His samples were depicted based on that. CD14/Fc bound weakly to wild type S. typhimurium and strongly to the short LPS mutant S. typhimurium Re (A). CD14/His did not bind to wild type S. typhimurium and bound S. typhimurium Re only weakly (B). Comparing the binding capabilities of both recombinant proteins we found that CD14/Fc bound very strongly to short LPS mutants and to a much lesser extent to other Gram-negative bacteria while CD14/His showed only weak binding capabilities to Re type mutants and none to other microbes (C). In part A and B one representative experiment, in part C mean ± SD of three independent determinations are presented. The differences in binding to bacteria compared to the buffer controls were evaluated by the Wilcoxon paired test (*p < 0.05, **p < 0.01).

A. Vida et al. / Immunology Letters 146 (2012) 31–39

35

Fig. 3. Binding of CD14/Fc to bacteria is dependent on both incubation time and CD14/Fc concentration and requires presence of LBP. S. typhimurium wt. (A and B) and Re (C and D) labeled by FITC were incubated with or without 100 ng/ml LBP for different times (0, 0.5, 2, 4, 6, 8, 10 h; A and C) with different concentrations of CD14/Fc (0, 1.25, 2.5, 5, 10, 20 ␮g/ml; B and D). Bound CD14/Fc was detected by anti-human-IgG conjugated with Cy5. The figure shows the median Cy5 intensities. Results presented are mean ± SD of three independent determinations. At each time point and CD14/Fc concentration the binding of CD14/Fc to bacteria measured in the presence and absence of LBP was compared by the Wilcoxon paired test. (*p < 0.05, **p < 0.01).

3.2. CD14/Fc and CD14/His binds to Gram negative bacteria To assess the capabilities of CD14/Fc to bind bacteria and fungi, we utilized a flow cytometric assay in which bacteria and fungi labeled with FITC were incubated with CD14/Fc or CD14/His. CD14/Fc bound to both wild type Gram-negative bacteria and short LPS (Ra & Re) mutants (Fig. 2A and C). Binding of CD14/Fc to these bacteria was dependent on incubation time and CD14/Fc concentration (Fig. 3A–D). Maximal binding for wild type bacteria was reached after 4 h of incubation time at 5–10 ␮g/ml CD14/Fc concentration (Fig. 3A and B). Binding to Ra and Re mutants was especially strong, 5 ␮g/ml CD14/Fc concentration and 2 h of incubation was enough to obtain extremely high signals (data not shown and Fig. 3C and D). The fusion protein showed slight binding to a Gram positive bacterium – L. monocytogenes –, too. For all tested microbes – except for L. monocytogenes – the binding of CD14/Fc was LBP dependent (data not shown and Fig. 3A–D). CD14/His showed inferior binding capabilities to tested microbes compared to the CD14/Fc dimer. It bound only short LPS (Re) mutants and even in these cases only a small increase in fluorescence could be detected (Fig. 2B and C). None of the two recombinant proteins bound to the tested fungi (Fig. 2C). Inhibition experiments confirmed that binding of CD14/Fc to whole bacteria is a result of CD14 and LPS interaction. These experiments indicated that binding of CD14/Fc to bacteria (S. typhimurium

wild type and S. typhymurium Re) can be dose dependently inhibited up to 80–100% by pre-incubating CD14/Fc with LPS (Fig. 4A) or anti-CD14 blocking antibody (Fig. 4B). To compare the avidity differences of the CD14/Fc dimer and CD14/His a mix of both recombinant proteins were added to FITC labeled S. typhimurium Re. We found that approximately a 50-fold molar excess of CD14/His was needed to reduce the binding of CD14/Fc by 50% (1 ␮g/ml CD14/Fc vs. 10–20 ␮g/ml CD14/His, 160 kDa vs. 50 kDa, Fig. 4C). 3.3. CD14/Fc enhances the phagocytosis of Re and Ra type Gram-negative bacteria To show that CD14/Fc not only binds to bacteria but also acts as an opsonin and enhances phagocytosis of professional phagocytes – neutrophil granulocytes, monocyte derived macrophages and dendritic cells – we utilized a flow cytometry based phagocytosis assay. FITC labeled bacteria with the highest CD14/Fc binding properties (S. typhimurium Ra, S. typhimurium Re, S. minnesota Re) were opsonized by 5 ␮g/ml CD14/Fc and, after washing, mixed with isolated human PMN cells, macrophages, dendritic cells or with the FcR-negative breast cancer SKBr-3 cells as negative control. In case of PMN cells CD14/Fc enhanced phagocytosis compared to the control both in the presence and absence of pooled human serum. While in the absence of serum this enhancing effect was strong (percent of positive cells with and without

36

A. Vida et al. / Immunology Letters 146 (2012) 31–39

20.46 ± 0.88%, p < 0.01, Fig. 5A). We found no association of bacteria and SKBr-3 cells used as negative control. Trypan blue quenching showed that most of the cell-associated bacteria (50–70%) were internalized (data not shown). In order to further prove the intracellular localization of bacteria taken up by neutrophils a 3-color-labeling phagocytosis experiment was used in combination with confocal microscopy. The cell membrane of PMN cells was visualized by an AlexaFluor647-conjugated antiMHC-I antibody (blue), the nucleus was stained by propidium iodide (red) while the bacteria were FITC labeled (green). Our data clearly showed that the majority of bacteria associated with PMN in the presence of NHS (Fig. 6A) or CD14/Fc (Fig. 6B and C) were intracellular. 3.4. Uptake of CD14/Fc-opsonized Gram-negative bacteria to neutrophils is mediated via FcRII and FcRIII As the fusion protein contains the Fc portion of human immunoglobulin IgG1 we presumed that this part is responsible for the interaction of opsonized bacteria with phagocytes. To assess the mechanism of internalization we blocked surface-expressed CD16 and CD32 on PMN cells using specific blocking monoclonal antibodies. We found that internalization of S. typhymurium Re could be partially inhibited both by anti-CD16 (61.64 ± 24.16% inhibition, p < 0.05) and by anti-CD32 (42.76 ± 20.52% inhibition, p = 0.07) blocking antibodies (Fig. 5B). When both blocking antibodies were used at the same time a complete blocking could be observed (91.65 ± 3.54% inhibition, p < 0.01; Fig. 5B). Similar inhibition rates were found for S. minnesota Re, too (anti-CD16: 69.54 ± 6.62% inhibition, p < 0.01; anti-CD32: 32.24 ± 4.31% inhibition, p < 0.05; both mAbs: 89.12 ± 1.42% inhibition, p < 0.05; data not shown). 3.5. CD14/Fc enhances the bacterial killing properties of whole blood

Fig. 4. Binding of CD14/Fc was LPS and CD14 specific as it could be dose dependently inhibited by pre-incubating CD14/Fc with LPS (A), anti-CD14 blocking antibody (B) or CD14/His (C). CD14/Fc (5 ␮g/ml in case of LPS and anti-CD14 blocking antibody, and 1 ␮g/ml in case of CD14/His) mixed with LPS (two-fold dilutions ranging from 20 to 0.2 ␮g/ml), anti-CD14 blocking antibody (two-fold dilutions ranging from 40 to 0.6 ␮g/ml), or CD14/His (two-fold dilutions ranging from 350 to 0.7 ␮g/ml) or buffer was incubated for 2 h with FITC labeled S. typhimurium Re in the presence of 100 ng/ml LBP. Bound CD14/Fc was detected by a Cy5 conjugated anti-human-IgG. This figure shows median Cy5 intensities. Results presented are mean ± SD of three independent determinations.

CD14/Fc: S. minnesota Re – 10.65 ± 0.97 versus 3.72 ± 0.45, p < 0.05; S. typhymurium Re – 12.60 ± 3.03 versus 1.57 ± 0.37, p < 0.05; S. typhymurium Ra – 13.85 ± 1.64 versus 5.47 ± 0.42, p < 0.05) there was only a slight but consequent effect in the presence of serum (percent of positive cells with and without CD14/Fc: S.minnesota Re – 13.04 ± 0.54 versus 12.2 ± 1.59, p = 0.54; S. typhymurium Re – 14.92 ± 0.87 versus 11.66 ± 2.42, p = 0.10, S. typhymurium Ra – 15.88 ± 2.97 versus 11.51 ± 0.70, p = 0.09; Fig. 5A, and data not shown). In the case of monocyte-derived macrophages CD14/Fc increased bacterial uptake by 17% as compared to the control samples thus resulting in an equal opsonizing capability as human serum (percent of FITC-positive cells without and with CD14/Fc: 52.54 ± 1.33% versus 69.01 ± 2.99%, p < 0.01, Fig. 5A). Experiments performed with monocyte-derived dendritic cells showed a lesser phagocytosis enhancing effect of CD14/Fc than human serum but even in this case a slight and significant elevation in phagocytosis could be observed as compared to the control samples (percent of FITC-positive cells without and with CD14/Fc: 15.36 ± 4.40% versus

In order to prove that bacteria pre-opsonized by CD14/Fc are not just internalized by different leukocytes but are also effectively inactivated in the circulation, we performed an ex vivo bacterial killing assay. S. typhimurium wt. and Re were added to whole blood containing either buffer or 5 ␮g/ml CD14/Fc and after 60 min of incubation at 37 ◦ C 100 ␮l of whole blood was spread on blood agar plates. After culturing bacteria for 24 h colonies were counted to assess the bacterial killing abilities of CD14/Fc. We found no significant differences between control and CD14/Fc containing samples for wild type bacteria. Untreated whole blood reduced S. typhimurium CFU count to 853 ± 199 ml–1 ; similarly whole blood containing 5 ␮g/ml CD14/Fc had the same killing potential by reducing CFU count to 830 ± 72 ml–1 after 1 h incubation (data not shown). However, for S. typhimurium Re we found that after 1 h incubation in whole blood significantly less bacteria survived when blood was pre-treated with CD14/Fc. CFU count was reduced to 550 ± 40 ml–1 by untreated blood sample whereas whole blood containing CD14/Fc reduced CFU count to 337 ± 84 ml–1 (p < 0.05, n = 3, data not shown). 4. Discussion CD14 is well known to interact with LBP in LPS binding and with TLR4/MD2 in LPS signaling, however it remains still unclear how and if CD14 interacts with whole bacteria. There are only very few publications proving that soluble CD14 binds to whole Gram negative bacteria [13,14]. On the other hand many authors describe a membrane-expressed CD14 dependent mechanism of phagocytosis albeit these publications do not support direct evidence of CD14 – bacteria binding [15–17]. Most probably the soluble form of CD14 displays a lower affinity to Gram-negative bacteria while

A. Vida et al. / Immunology Letters 146 (2012) 31–39

37

Fig. 5. CD14/Fc increased the uptake of S. typhimurium Re by isolated neutrophils, monocyte derived macrophages and dendritic cells but had no effect on FcR negative SKBr-3 cells (A). Phagocytosis enhancing effect could be partially blocked by preincubating isolated neutrophils with blocking anti-CD16 or anti-CD32 antibodies (B). With both Fc receptors blocked the effect of CD14/Fc could be completely countered (B). Results presented are mean ± SD of three independent determinations for PMN cells and one representative experiment out of three for macrophages and dendritic cells. The binding of bacteria to phagocytes in the absence and presence of CD14/Fc or NHS or both was statistically compared by the Wilcoxon paired test (“PBS” bars; *p < 0.05, **p < 0.01). In the case of samples containing inhibitory mAbs (“anti-CD16”, “anti-CD32” and “anti-CD16 & CD32” bars) the rate of phagocytosis was compared to the corresponding samples without any inhibition (“PBS” bars) using the Wilcoxon paired test (*p < 0.05, **p < 0.01).

in the cytoplasm membrane altered conformation or the presence of additional molecules might promote the CD14-microbe interaction. Fusion of an antimicrobial molecule to the Fc part of IgG1 results in a molecule with different properties than the components alone [26,27]. One important feature is dimerization that may enhance the avidity of an antimicrobial fusion partner to its original ligand as it has been described for affibody-Fc chimeras in one publication, so far [24]. We anticipated a similar effect in the case of CD14 so we created a CD14/Fc fusion protein – and a CD14/His protein as control – to evaluate their binding properties to whole microbes. We hoped that a CD14/Fc dimer has not only a higher affinity to whole bacteria but also an opsonizing effect via the Fc part as it has been described for similar fusion proteins [18,19,21–23,28,29]. The presence of the Fc part may confer additional effector functions like complement activation or binding to FcRs on phagocytes [27].

In addition to a possible opsonizing effect the coupling of antimicrobial proteins to the Fc part of human IgG1 has other numerous advantages like increased in vivo half-lifetime and decreased renal toxicity [3]. An Fc-tag can promote the expression of certain “difficult” molecules [30], can be used for the purification of the product [31], and can help the entrance of the molecule to human body via an intestinal or lung epithelial route mediated by FcRn receptors [27]. Our experiments showed that the CD14/Fc fusion protein interacts with free LPS and whole bacteria in an LBP dependent manner. This interaction between bacteria and CD14 could be inhibited both by an excess of LPS and an LPS-blocking anti-CD14 monoclonal antibody, showing that the CD14 part of the molecule and its LPS-binding region is responsible for the binding. We found that CD14/Fc bound to all tested Gram-negative bacteria at concentrations similar to level of sCD14 in normal

38

A. Vida et al. / Immunology Letters 146 (2012) 31–39

Fig. 6. Bacteria (S. typhymurium Re) opsonized by human serum (A) or CD14/Fc (B) are internalized by PMN cells as determined by confocal microscopy. Threedimensional reconstructed images show that the majority of bacteria opsonized by CD14/Fc are located intracellularly in PMN cells (C). The cell membrane of PMN cells was visualized by an anti-HLA-I AlexaFluor647-labeled antibody (blue), the nucleus was stained by propidium iodide (red) while the bacteria were FITC labeled (green). Images are from 130 × 100 ␮m fields of view in (A) and (B), and 22.5 × 22.5 ␮m in (C). The top and right pane of part C shows the images in the 3rd (z) dimension reconstructed along the green and red lines on the center (x–y) plane of part C. Z reconstructions are 9 ␮m high, the blue line indicating the position of the z plane visualized in the central x–y plane. Figures show representative fields of two similar, independent experiments. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

human serum. CD14/Fc showed extreme high affinity to the Rtype mutants. This phenomenon might be a result of the missing O-antigen which might make it easier for CD14 to access the lipidA region that is the major functional group of LPS known to be involved in CD14 binding. A similar phenomenon is the reduced binding of lipid A-specific monoclonal antibodies to O-chain containing endotoxin molecules [32]. In contrast CD14/His did only bind to short LPS mutants and binding was approximately 50-fold weaker. Though there are some doubts now, few other CD14 ligands from both Gram positive bacteria and fungi have been suggested. These include lipoarabinomannan of Mycobacteria, soluble peptidoglycan, WI-1 antigen of Blastomyces dermatitidis, cell wall of S. aureus, and polyuronic acids of Pseudomonas [33]. Despite the many possible ligands and postulated wide species-specificity, the CD14/Fc fusion molecule bound only to Gram-negative bacteria and not to the tested fungi. Only weak binding to one of the tested Grampositive bacteria – Listeria monocytogenes – could be observed which is in agreement of the findings of Janot et al. who described an important role of CD14 in overcoming L. monocytogenes infections. This observation might imply the presence of a CD14 ligand

produced by this microorganism [34]. Most likely the described molecules interacting with CD14 are not located on the surface of these bacteria and fungi, which limits their interaction with sCD14. Phagocytosis experiments showed that in the case of bacteria bearing short LPS (Ra, Re) CD14/Fc had not only enhanced Gramnegative bacteria binding capabilities but acted as an opsonin and an increased bacterial uptake by professional phagocytes – isolated human PMN cells, monocyte-derived macrophages and dendritic cells – was observed. In addition to phagocytosis enhancing effect, CD14/Fc increased bacteria killing potential of whole blood compared to samples without CD14/Fc. Unfortunately we were not able to see either a phagocytosis enhancing effect, or an increased killing effect of whole blood samples treated with CD14/Fc for the tested wild type bacteria. Presumably, the lower number of CD14/Fc molecules bound to the surface of wild-type bacteria was not sufficient to cross-link FcRs on phagocytes that seems to be crucial in induction of endocytosis and cellular activation [35]. Blocking experiments suggested that the enhanced phagocytosis of CD14/Fc-opsonized R strain bacteria was a result of interactions between the protein’s Fc part and FcR␥III/FcR␥II (CD16/CD32) receptors on PMN cells. The fact that in the presence of CD14/Fc phagocytosis was completely blocked by the combination of anti-FcR␥III and anti-FcR␥II antibodies suggested that beside the Fc-FcR interaction other mechanisms – like complement activation – had no important role in CD14/Fc-mediated uptake of bacteria. In the case of NHS alone the combined block of FcRs did not result in a 100% inhibition while after CD14/Fc + NHS opsonization only FcRmediated phagocytosis occurred. The replacement of the normal complement-fixing antibodies of NHS by CD14/Fc on the surface of bacteria might explain this observation. Three important antimicrobial Fc fusion proteins have been described in literature so far that might be useful to combat Gram negative infections. Warren and his co-workers conjugated chemically the LPS-binding domain of CAP18 – a cationic antibacterial protein – and whole human IgG [18,21,28]. An and his co-workers coupled bactericidal permeability increasing protein (BPI) to the Fc part of human IgG on DNA level and expressed the construct both in vitro and in vivo [19,22,23]. In a recent report, Falk and co-workers created an LPS-Trap-Fc fusion protein, that consisted of the extracellular domain of TLR4 and MD2 fused to Fc portion of human IgG [29]. Each of these compounds could bind to and neutralize LPS and different types of Gram-negative bacteria including wild types, too. Furthermore, the first two fusion proteins could prove their efficacy in in vivo mouse sepsis model systems, too. Our experiments confirm that PRR/Fc fusion proteins can indeed give a boost to FcR dependent phagocytosis and killing provided the antimicrobial part binds efficiently to microbes. In addition the resulting dimer can have even an approximately 50-fold higher affinity to whole bacteria than the monomer. We conclude that similar fusion proteins with wide antimicrobial spectra – possibly including Gram positive bacteria and fungi – might act as effective antimicrobial agents that can be used against microbes that are resistant to commonly used antibiotics.

Acknowledgments This work has been supported by the National Scientific Research Programs of the Hungarian Ministry of Social Welfare (OTKA; T046694), by the EU 6th Framework program (512093AMIS) and by the TÁMOP 4.2.1./B-09/1/KONV-2010-0007 project. The latter project is implemented through the New Hungary Development Plan, co-financed by the European Social Fund. The authors are grateful to Dr. Bhattoa Harjit Pal for the grammatical correction of the manuscript.

A. Vida et al. / Immunology Letters 146 (2012) 31–39

References [1] Song JH. What is new on the antimicrobial horizon? Int J Antimicrob Agents 2008;32(Suppl. 4):S207–13. [2] Taylor PL, Wright GD. Novel approaches to discovery of antibacterial agents. Anim Health Res Rev 2008;9:237–46. [3] Oyston PC, Fox MA, Richards SJ, Clark GC. Novel peptide therapeutics for treatment of infections. J Med Microbiol 2009;58:977–87. [4] Shai Y, Makovitzky A, Avrahami D. Host defense peptides and lipopeptides: modes of action and potential candidates for the treatment of bacterial and fungal infections. Curr Protein Pept Sci 2006;7:479–86. [5] Antal-Szalmas P. Evaluation of CD14 in host defence. Eur J Clin Invest 2000;30:167–79. [6] Guha M, Mackman N. LPS induction of gene expression in human monocytes. Cell Signal 2001;13:85–94. [7] Triantafilou M, Triantafilou K. Lipopolysaccharide recognition: CD14, TLRs and the LPS-activation cluster. Trends Immunol 2002;23:301–4. [8] Landmann R, Reber AM, Sansano S, Zimmerli W. Function of soluble CD14 in serum from patients with septic shock. J Infect Dis 1996;173:661–8. [9] Cauwels A, Frei K, Sansano S, Fearns C, Ulevitch R, Zimmerli W, Landmann R. The origin and function of soluble CD14 in experimental bacterial meningitis. J Immunol 1999;162:4762–72. [10] Bazil V, Baudys M, Hilgert I, Stefanova I, Low MG, Zbrozek J, Horejsi V. Structural relationship between the soluble and membrane-bound forms of human monocyte surface glycoprotein CD14. Mol Immunol 1989;26:657–62. [11] Troelstra A, Antal-Szalmas P, de Graaf-Miltenburg LA, Weersink AJ, Verhoef J, Van Kessel KP, Van Strijp JA. Saturable CD14-dependent binding of fluorescein-labeled lipopolysaccharide to human monocytes. Infect Immun 1997;65:2272–7. [12] Antal-Szalmas P, Poppelier MJ, Sumegi A, van der Bruggen T, Verhoef J, van Kessel KP, van Strijp JA. Spare CD14 molecules on human monocytes enhance the sensitivity for low LPS concentrations. Immunol Lett 2004;93:11–5. [13] Jack RS, Grunwald U, Stelter F, Workalemahu G, Schutt C. Both membranebound and soluble forms of CD14 bind to gram-negative bacteria. Eur J Immunol 1995;25:1436–41. [14] Grunwald U, Fan X, Jack RS, Workalemahu G, Kallies A, Stelter F, Schutt C. Monocytes can phagocytose Gram-negative bacteria by a CD14-dependent mechanism. J Immunol 1996;157:4119–25. [15] Fan X, Stelter F, Menzel R, Jack R, Spreitzer I, Hartung T, Schutt C. Structures in Bacillus subtilis are recognized by CD14 in a lipopolysaccharide binding proteindependent reaction. Infect Immun 1999;67:2964–8. [16] Stelter F, Bernheiden M, Menzel R, Jack RS, Witt S, Fan X, Pfister M, Schutt C. Mutation of amino acids 39-44 of human CD14 abrogates binding of lipopolysaccharide and Escherichia coli. Eur J Biochem 1997;243:100–9. [17] Schiff DE, Kline L, Soldau K, Lee JD, Pugin J, Tobias PS, Ulevitch RJ. Phagocytosis of gram-negative bacteria by a unique CD14-dependent mechanism. J Leukoc Biol 1997;62:786–94. [18] Warren HS, Matyal R, Allaire JE, Yarmush D, Loiselle P, Hellman J, Paton BG, Fink MP. Protective efficacy of CAP18106-138-immunoglobulin G in sepsis. J Infect Dis 2003;188:1382–93.

39

[19] Chen J, Li C, Guan Y, Kong Q, Li C, Guo X, Chen Q, Jing X, Lv Z, An Y. Protection of mice from lethal Escherichia coli infection by chimeric human bactericidal/permeability-increasing protein and immunoglobulin G1 Fc gene delivery. Antimicrob Agents Chemother 2007;51:724–31. [20] Lee TY, Tjin Tham Sjin RM, Movahedi S, Ahmed B, Pravda EA, Lo KM, Gillies SD, Folkman J, Javaherian K. Linking antibody Fc domain to endostatin significantly improves endostatin half-life and efficacy. Clin Cancer Res 2008;14:1487–93. [21] Fletcher MA, Kloczewiak MA, Loiselle PM, Ogata M, Vermeulen MW, Zanzot EM, Warren HS. A novel peptide-IgG conjugate, CAP18(106-138)-IgG, that binds and neutralizes endotoxin and kills gram-negative bacteria. J Infect Dis 1997;175:621–32. [22] Li J, Kong Q, Lv Z, Guan Y, Qiu Y, Li C, Sun M, Liu Z, An Y. Protection of immunocompromised mice from lethal infection of Klebsiella pneumonia by rAAV2BPI23-Fcgamma1 gene transfer. Cell Mol Immunol 2008;5:439–45. [23] Li C, Li J, Lv Z, Guo X, Chen Q, Kong Q, An Y. Protection of mice from lethal endotoxemia by chimeric human BPI-Fcgamma1 gene delivery. Cell Mol Immunol 2006;3:221–5. [24] Ronnmark J, Hansson M, Nguyen T, Uhlen M, Robert A, Stahl S, Nygren PA. Construction and characterization of affibody-Fc chimeras produced in Escherichia coli. J Immunol Methods 2002;261:199–211. [25] Walenkamp AM, Boer IG, Bestebroer J, Rozeveld D, Timmer-Bosscha H, Hemrika W, van Strijp JA, de Haas CJ. Staphylococcal superantigen-like 10 inhibits CXCL12-induced human tumor cell migration. Neoplasia 2009;11:333–44. [26] Strohl WR. Optimization of Fc-mediated effector functions of monoclonal antibodies. Curr Opin Biotechnol 2009;20:685–91. [27] Dumont JA, Low SC, Peters RT, Bitonti AJ. Monomeric Fc fusions: impact on pharmacokinetic and biological activity of protein therapeutics. BioDrugs 2006;20:151–60. [28] Ogata M, Fletcher MF, Kloczewiak M, Loiselle PM, Zanzot EM, Vermeulen MW, Warren HS. Effect of anticoagulants on binding and neutralization of lipopolysaccharide by the peptide immunoglobulin conjugate CAP18(106138)-immunoglobulin G in whole blood. Infect Immun 1997;65:2160–7. [29] Gross P, Brandl K, Dierkes C, Scholmerich J, Salzberger B, Gluck T, Falk W. Lipopolysaccharide-trap-Fc, a multifunctional agent to battle gram-negative bacteria. Infect Immun 2009;77:2925–31. [30] Zhang J, Carter J, Siu S, O’Neill JW, Gates AH, Delaney J, Mehlin C. Fusion partners as a tool for the expression of difficult proteins in mammalian cells. Curr Pharm Biotechnol 2010;11:241–5. [31] Jazayeri JA, Carroll GJ. Fc-based cytokines: prospects for engineering superior therapeutics. BioDrugs 2008;22:11–26. [32] Warren HS, Amato SF, Fitting C, Black KM, Loiselle PM, Pasternack MS, Cavaillon JM. Assessment of ability of murine and human anti-lipid A monoclonal antibodies to bind and neutralize lipopolysaccharide. J Exp Med 1993;177:89–97. [33] Landmann R, Muller B, Zimmerli W. CD14, new aspects of ligand and signal diversity. Microbes Infect 2000;2:295–304. [34] Janot L, Secher T, Torres D, Maillet I, Pfeilschifter J, Quesniaux VF, Landmann R, Ryffel B, Erard F. CD14 works with toll-like receptor 2 to contribute to recognition and control of Listeria monocytogenes infection. J Infect Dis 2008;198:115–24. [35] Ravetch JV, Bolland S. IgG Fc receptors. Annu Rev Immunol 2001;19:275–90.