- Email: [email protected]
G-quadruplex deconvolution with physiological mimicry enhances primary screening: Optimizing the FRET Melt2 assay
Journal Pre-proof G-quadruplex deconvolution with physiological mimicry enhances primary screening: Optimizing the FRET Melt2 assay
Rhianna K. Morgan, Alexandra Psaras, Quinea Lassiter, Kelsey Raymer, Tracy A. Brooks PII:
S1874-9399(19)30220-2
DOI:
https://doi.org/10.1016/j.bbagrm.2019.194478
Reference:
BBAGRM 194478
To appear in:
BBA - Gene Regulatory Mechanisms
Received date:
24 May 2019
Revised date:
23 December 2019
Accepted date:
26 December 2019
Please cite this article as: R.K. Morgan, A. Psaras, Q. Lassiter, et al., G-quadruplex deconvolution with physiological mimicry enhances primary screening: Optimizing the FRET Melt2 assay, BBA - Gene Regulatory Mechanisms(2018), https://doi.org/10.1016/ j.bbagrm.2019.194478
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2018 Published by Elsevier.
Journal Pre-proof G-quadruplex deconvolution with physiological mimicry enhances primary screening: optimizing the FRET Melt2 Assay Rhianna K. Morgan1,2, Alexandra Psaras3, Quinea Lassiter2,4, Kelsey Raymer2, and Tracy A. Brooks2,3*
1
School of Veterinary Medicine, Department of Molecular Biosciences, University of California-Davis, Davis, CA 95616 2
School of Pharmacy, Department of BioMolecular Sciences, University of Mississippi, University, MS 38677 3
ro
of
School of Pharmacy and Pharmaceutical Sciences, Department of Pharmaceutical Sciences, Binghamton University, Binghamton, NY 13902 4
re
-p
Department of Microbiology, University of Arizona, Tucson, AZ 85721
lP
*Corresponding Author
Telephone: 607-777-5842
ur
Fax: 607-777-3020
na
Mail address: 96 Corliss Ave, PB-331, Johnson City, NY 13790
Jo
Email: [email protected]
1
Journal Pre-proof Abstract
na
lP
re
-p
ro
of
Non-B-DNA G-quadruplex (G4) structures have shown promise as molecular targets. Modulating G4 stability for oncogenic transcriptional control is a promising avenue for the development of novel therapeutics. Extracellularly, G4 stabilization can be mediated by alkali cations, modifying water content, or with molecular crowding. Intracellularly, G4 formation is mediated by negative superhelicity and transcriptional activity, and can be stabilized with small molecules or oligonucleotides. Numerous G4stabilizing compounds have been identified that impact promoter activity in plasmids. These compounds, however, infrequently show activity in cells, are found to have nonG4-mediated mechanisms of action, or do not demonstrate activity in vivo. The G4 field requires enhanced predictive screening methods to identify compounds with G4mediated in vitro activity and in vivo efficacy. Using the best characterized promoter G4 to date, MYC, we examined the effects of varying annealing conditions (rate of cool down and number of heat/cool cycles), co-solvents (glucose, acetonitrile, polyethylene glycol, dextran sulfate, sucrose, ficoll-70, glycerol) and nucleoplasm on G4 formation and compound screening. We observed a marked decrease in hit rates when shifting from simple buffer conditions to include potassium and glycerol, and utilizing two or more rapid annealing cycles; the difference in hit compounds coincides with previous findings of active, inactive, and non-G4-mediated activity, including NSC338258, Quindoline i, and TMPyP4; with these changes, we describe a modification of the primary FRET Melt screening assay – the FRET Melt2. This understanding of physiological principles governing the above G4 formation will better inform future drug discovery efforts for this and other oncogenic promoters.
Jo
ur
Keywords: G-quadruplex, MYC, FRET melt, physiological conditions, small molecules
2
Journal Pre-proof Introduction
re
-p
ro
of
G-quadruplexes (G4s) are common throughout the genome with enhanced prevalence in promoters and 5’UTRs of oncogenes and tumor suppressor genes[1, 2]. G4s are secondary DNA structures able to form in guanine-rich DNA, wherein four guanines hydrogen bond by Hoogsteen base-pairing to form tetrad arrangements. These planar moieties have increased stability when a monovalent cation (K+ or Na+) is located at their center. Upon tetrad formation, two or more, but most often three, will stack upon one another with the intervening nucleotides forming the connecting loops. G4s are highly polymorphic, both across regions of DNA and within one sequence, and vary in the number of stacked tetrads, as well as in loop directionality. It is suggested that short loop lengths (≤7 or 9) are favorable, but G4s having been characterized harboring longer loops of up to 26 base pairs, such as K-RAS, hTERT, and Bcl-2[3, 4]. These non-canonical DNA structures have been characterized as transcriptional regulators, as either activators or suppressors depending on the gene involved and the endogenous proteins that bind the G-rich sequence. The majority of DNA G4s identified are transcriptional suppressors functioning by hindering RNA polymerase and/or transcription factor binding. Such structures span the hallmarks of cancer, thus, most research focuses on utilizing small G4-stabilizing molecules in order to decrease tumor growth and metastasis.
Jo
ur
na
lP
Several compound classes have been identified that bind to and stabilize G4s. Many of these molecules are pan-G4 stabilizing agents extracellularly, and though some have been shown to impact gene expression intracellularly, few have confirmed G4-mediated mechanisms of action or activity in vivo. It is challenging to classify new chemical scaffolds that are selective G4 stabilizing agents; most screening and secondary assays use single-stranded DNA (ssDNA) and simple buffer conditions. Standard initial protocols for screening G4-stabilizing compounds, such as FRET melt and electronic circular dichroism (ECD), are operated in buffer, perhaps with the addition of a salt (lithium, sodium, or potassium). This allows for G4 structure formation, but it does not necessarily coincide with physiologically relevant conditions or the biologically active G4 isoforms. For the MYC G4, the physiologically relevant G4 is formed from the first four (of six) contiguous runs of continuous guanines within the nuclease hypersensitivity element III1[5, 6], whereas the more commonly identified structure using simple extracellular conditions forms from the second through fifth of these guanine runs[7-9]. Current drug discovery and development programs are hindered by this discrepancy between stable and predominant structures extracellularly formed and those found under supercoiled conditions and in nuclei[10, 11]. It is imperative for successful drug discovery programs that the G4s formed under screening conditions represent the relevant biological isoforms. Physiological mimicry can be accomplished through the use of co-solvents. Biomolecules inhabit a large portion of cellular volume (approximately 20-40%) creating a crowded microenvironment intracellularly[12]. Evidence suggests this molecular 3
Journal Pre-proof crowding is critical in living cells for the function of proteins, polysaccharides, soluble and insoluble molecules, and nucleic acids. The use of co-solvents in extracellular assays has been shown to effect G4 formation[12-14]; their incorporation into compound screening has not been evaluated to date. Dehydrating and molecular crowding agents, specifically acetonitrile (MeCN) and polyethylene glycol (PEG), have been studied previously and were found to increase G4 thermodynamic stability[15]. Modifying water content has also been shown to enhance binding affinity of ligands to DNA6. Hence, the addition of co-solvents to G4 screening protocols, enabling anhydrous molecular crowding and simple dehydration, are likely to mimic intracellular conditions and minimize false positives for compound screening assays.
na
lP
re
-p
ro
of
The proto-oncogene MYC is amplified in approximately 80% of cancer cases (cBioPortal)[16]. Its protein functions as a transcription factor and is responsible for regulating more than 15% of genes within the human genome[17]. It plays a significant role in cell proliferation, growth, differentiation, and apoptosis[18]; its deregulation frequently results in tumorigenesis. The MYC promoter contains a nuclease hypersensitivity element (NHEIII1) upstream from two proximal promoters that initiate close to 100% of gene transcription[19, 20]. This NHE III1 element contains a guanine dense sequence of 31 bases that can form multiple G4 structures6-9. This predominantly parallel G4 can act as a silencer of transcription and has been a popular target for G4 drug discovery programs[3, 20]. However, with many unsuccessful series of G4stabilizing compounds, the current screening approaches need to be optimized by including intracellular, and even intranuclear, conditions. Upon consideration, the conditions can be mimicked outside of a cell and applied within screening assays to best predict the small molecule/G4 DNA interactions occurring in biological systems.
Jo
ur
As described, G4s induced from ssDNA under simple buffer conditions do not always recapitulate the structures formed in more complex conditions, such as in supercoiled and chromosomal DNA. Thus, we sought to optimize extracellular conditions to mirror in vitro and in vivo G4 formations. This is required to best inform biochemical studies (e.g. protein regulation) and drug discovery efforts. Particularly, we examined the effect of varying preparatory techniques in isoform frequency and studied the effects of co-solvents and nucleoplasm on the MYC promoter G4, which led to enhancement of the FRET Melt G4 drug discovery assay. These modifications yielded higher success in identifying confirmed G4-stabilizing agents extracellularly with in vitro activity. The culmination of these screening variations resulted in the FRET Melt 2 assay, with a Z’-factor >0.5. This enhanced assay is more likely to yield “hit” compounds with in vitro and in vivo G4-mediated anti-cancer activity. Materials and Methods Materials All oligonucleotides were synthesized and purchased from Eurofins MWG Operon, LLC (Louisville, KY) (Table 1). Acrylamide/bisacrylamide (29:1) solution and ammonium persulfate were purchased from Bio-Rad laboratories (Hercules, CA), and N,N,N’,N’-
4
Journal Pre-proof tetramethylethylenediamine was purchased through Fisher Scientific (Pittsburgh, PA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO). Table 1. MYC oligonucleotide sequences.
MYCKO
5’
GCGCTTATGTTGAGTGTGTTGAGTGTGTTGAAGGTGTTG
AGGAGAC3’ MYCKO EMSA
5’
[6~FAM]GCGCTTATGTTGAGTGTGTTGAGTGTGTTGAAGG
TGTTGAGGAGAC3’ Pu46
5’
GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAAGGTGG
GGAGGAGAC3’ 5’
[6~FAM]GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAA
of
Pu46 EMSA
Pu46 FRET
5’
ro
GGTGGGGAGGAGAC3’
[6~FAM]GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAA
re
-p
GGTGGGGAGGAGAC[TAMRA]3’
Cellular Nucleoplasm Extraction
Jo
ur
na
lP
MiaPaCa-2 cells were grown to ~90% confluency in 75 mL flasks and collected in a 50 mL conical tube. Cells were resuspended and centrifuged at 4,000 rpm for 5 min in ~5 packed cell volume (pcv) hypotonic buffer solution (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl) after adding 0.2 mM phenylmethylsulfonyl fluoride (PMSF) and 0.5 M dithiothreitol (DTT). The pellet was then resuspended in 3 pcv hypotonic buffer solution, and the cells were allowed to swell on ice for 10 min. Cells were homogenized and spun at 4,000 rpm for 15 min and were then resuspended in ½ packed nuclear volume (pnv) low-salt buffer solution (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, and 0.2 mM EDTA) after adding 0.2 mM PMSF and 0.5 M DTT. Slowly, ½ pnv high-salt buffer solution (add 0.8 M KCl to low-salt buffer stock) was added in a dropwise fashion upon addition of 0.2 mM PMSF and 0.5 M DTT. Cytoplasmic extract was incubated at room temperature for 30 min with continuous mixing and then centrifuged at 14,000 rpm for 30 min. Supernatant was collected as the nuclear extract. Electronic Circular Dichroism (ECD) The G4 oligonucleotides (5 µM) were prepared in 50 mM Tris-HCl (pH 7.4) with varying amounts of KCl and co-solvents (0 - 40%). The co-solvents utilized were (1) osmolytes: acetonitrile (MeCN), glucose, sucrose, dextran sulfate, and ficoll-70 and (2) molecular crowding agents: polyethylene glycol (PEG), glycerol, and extracted nucleoplasm. Preparatory conditions involved heating the G4 to 95 °C for 5 min and either cooling rapidly on ice, or slowly in the turned off heat block; this was either done one, five, or ten times. Spectra were collected with a Jasco J-1500 spectropolarimeter equipped with a Peltier cell holder (Easton, MD). Recordings were made simultaneously at 262 nm 5
Journal Pre-proof from 20-100 °C at every 1 °C, and over the wavelength range 225-350 nm and at increasing temperatures (20-100 °C, every 10 °C), with a 0.5 min. hold at temperature before spectra were recorded in 1 mm quartz cuvette. Annealing after the first, fifth, or tenth melt cycles was measured immediately following the melt profiles, also every 1 or 10 °C, with a 0.5 min. hold at temperature before spectra were recorded. The ordinate is reported as millidegrees normalized to those measured at 20 °C; TM’s were determined from the mdeg at 262 nm every 1 °C with non-linear regression fitting performed with GraphPad Prism software (La Jolla, CA). Electrophoretic Mobility Shift Assay (EMSA)
re
-p
ro
of
FAM-labeled oligonucleotide (1 µM) bearing the 46 bp MYC G4-forming region in WT or KO form was prepared with 10 mM KCl, 50 mM Tris-HCl (pH 7.4), and nucleoplasm or co-solvents, as indicated. The solutions were each denatured by heating to 95 °C for 5 min, rapidly cooled for 5 min, and repeated for up to ten cycles to induce G4 formation. Upon addition of non-denaturing loading dye, the samples were loaded onto a 10% native polyacrylamide gel. After running at 100 V, the gel was visualized under blue light LED using a FotoDyne Incorporated Investigator FX Imager (Hartland, WI). Image was aligned horizontally based on the location of the wells. Fluorescence Resonance Energy Transfer (FRET) Melt
Results
Jo
ur
na
lP
A dual-labeled DNA oligomer probe bearing the 46 nucleic acid G4-forming region of the MYC promoter was used. DNA was diluted to 2 M in 10 mM Sodium Cacodylate (pH 7.4) + 100 mM LiCl, alone, with 10 mM KCl plus or minus 10% glycerol or 20% ficoll-70. G4 DNA was added to a 96-well PCR plate with or without controls and test compounds. Fluorescence was recorded from 20-95 °C, at every degree after a 10 sec hold on a Bio-Rad CFX96 real-time thermocycler (Hercules, CA). For multiple annealing repeats, the temperature was returned from 95 to 20 °C rapidly (within 3 – 5 min) before the next ramp cycle. All compounds examined in the assay were screened at a final concentration of 1 or 10 M.
G4 annealing optimization There is a wide array of preparatory techniques used for in vitro DNA studies that vary in the quantity of heat and cool cycles, the speed of DNA annealing, the presence of co-solvents, and more. In order to optimize these conditions, we did an analysis of the MYC G4 in 10 mM KCl by varying the quantity of heating and annealing conditions (1, 5, or 10) and the annealing speed (slow or rapid). We also analyzed the isoform distribution, as indicated by slope of the thermal behavior, and the absolute T M, as a relationship to stability, while both melting and annealing the G4 (Figure 1, Table 2, Supplemental Figures 1-2). One G4 annealing cycle with slow cooling demonstrated a variable thermal stability through the melting and annealing cycles (79 vs 69 °C, respectively), and showed a 1.5-fold variation in Hill slope, indicating a broader isoform distribution. If rapid cooling was used, the Hill slope and thermal stability were more variable with a 1.7-fold and 13 °C variation, respectively. With five G4 annealing cycles 6
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
and slow cooling, thermal stability varied by 11 °C, and Hill slope varied 1.4-fold. When cooled rapidly, thermal stability varied by only 7 °C (74 versus 67 °C for the melting and annealing processes, respectively), and the Hill slope was the most consistent with only a 1.2-fold change. As the G4 annealing cycles increased to ten, the discrepancy between melting and annealing thermal stability was consistently >10 °C and the slope of the melting profiles varied 1.4-1.6-fold. EMSAs were performed to evaluate possible DNA degradation after a number of cycles under simple buffer and some relevant osmolyte conditions described below. No degradation products were noted (Supplemental Figure 3). It is notable that the annealing cycles measured by ECD at after one, five, or ten melting studies were neither rapid nor slow. They were machine controlled as described in the methods above, taking ~40 minutes. From these data, we concluded that by heating to 95 °C and rapidly annealing the DNA at 4 °C five times, the most consistent thermal stability is reached with the minimal number of isoforms for the MYC promoter G4. For further experiments, five annealing conditions with rapid cooling were used.
7
ro
of
Journal Pre-proof
lP
re
-p
Figure 1. MYC G4 heating and annealing conditions affect stability and isoform distribution. The MYC G4 forming oligonucleotide, Pu46, was subjected to an array of heating and annealing conditions including a variation of number of cycles and of annealing temperatures. Thermal melt profiles were examined by ECD for the melting and re-annealing at one, five, and ten total cycles under slow (left) and rapid (right) cooling conditions; ECD mdeg was normalized to pre-melting values at 20 C. Data were collected every 1 C, all experiments were performed in triplicate. Five cycles of annealing using rapid cooling demonstrated the most consistent thermal profiles under melting and annealing conditions. Table 2. Thermal stability profile with varying annealing conditions.
Slow 76 0.6 64 0.8 1.4
5
10 Rapid 74 0.7 67 0.9 1.2
Slow 75 0.6 64 0.8 1.4
Rapid 76 0.7 64 1 1.6
Jo
ur
na
Number of 1 cycles Cooling Slow Rapid Melt TM (C) 79 0.5 79 0.5 Anneal TM (C) 69 0.8 66 0.8 Hill-slope ratio 1.5 1.7 (slopeM/slopeA)
Using Co-Solvents to Mimic Physiological Conditions for Drug Discovery Screening Through the use of co-solvents, physiological mimicry can be accomplished extracellularly. The nature of a nucleus’s dehydration and density can be achieved with the incorporation of osmolytes and molecular crowding agents. To investigate this use of co-solvents, a small cohort was chosen to add to standard buffers while examining MYC G-rich oligonucleotide sequences prior to G4 induction. Osmolytes acetonitrile (MeCN), glucose, sucrose, and ethylene glycol, along with polymers and molecular crowding agents PEG, dextran sulfate, glycerol, and ficoll-70 were utilized. Initial studies with these co-solutes determined that ethylene glycol prevented stable, inducible, G4 formation as observed with ECD (data not shown); therefore it was not used in future experiments. No other problems arose with co-solvents preventing G4 formation. In addition, we incorporated another way to mimic nuclear conditions more naturally by extracting nucleoplasm from the transformed and immortalized pancreatic cancer cell 8
Journal Pre-proof line, MiaPaCa-2. This extracted nucleoplasm contains all physiologically relevant nuclear co-solutes, with the exception of DNA and histones.
Jo
ur
na
lP
re
-p
ro
of
The incorporation of each of these solutes was first examined for the effects on MYC G4 thermal stability by ECD, as compared to a low (10 mM) salt (KCl) control (Figure 2A-B). Three concentrations (2, 5, and 10%) of extracted nucleoplasm were used to induce MYC G4 formation (Figure 2A); the inherent Cotton effects on ECD found in higher concentrations of nucleoplasm prevented their use. With increasing concentration of nucleoplasm, the hill slope of the thermal melting profile increased; correspondingly, the number of MYC G4 isoforms also increased. 2% nucleoplasm’s melting temperature matched that of the 10 mM KCl control, but its marked increase in hill slope suggest a two-state transition consistent with a single major G4 formed (Figure 2B). In addition, for each osmolyte, we determined the minimum concentration required to achieve maximal G4 formation, as described previously [21] (Supplemental Figure 4); from these studies, 10% dextran sulfate, glycerol, and glucose and 20% MeCN, PEG, ficoll-70, and sucrose were selected and utilized for the remainder of the experiments described. Of these, PEG and MeCN mediated effects that notably varied from both the other co-solvents and from the 10 mM KCl control. PEG led to marked disruption of isoforms, as noted by a change in Hill slope and a lack of a clear transition state between folded and unfolded G4, and MeCN mediated a 14 °C stabilization, both of the MYC G4. Of the remaining co-solvents, 10% glycerol most closely resembled 2% nucleoplasm by spectral profile, thermal stability, and transition state (Hill slope) (Figure 2B). Ficoll-70 also displayed a similar EMSA migration and ECD spectra as both 10% glycerol and 2% nucleoplasm. Notably, each of these co-solvents has been studied in the context of G4s and mimicking intracellular environments, where it was concluded that glycerol mimicked the nucleolus and ficoll-70 mimicked nuclear conditions[22]. Thus, both of these co-solvents were selected for further analysis.
9
na
lP
re
-p
ro
of
Journal Pre-proof
Jo
ur
Figure 2. Co-solvents and nucleoplasm effect on MYC G4 formation and isoform distribution. ECD Spectra (left, measured at room temperature) and thermal stability (right) were determined for the MYC G4 in the presence of saturating co-solvents (A) or increasing nucleoplasm (B). The dashed lined in both A and B compares the TM of the MYC G4 in the presence of 2% nucleoplasm (demonstrating the fewest isoforms) with the co-solvents. (C) G4 formation and isoform density were confirmed by EMSA, as compared to a linear knockout control oligonucleotide. From these studies, 10% glycerol and 20% ficoll70 were determined to be most consistent with nucleoplasm in regards to G4 formation, thermal stability, and isoform distribution.
With the apparent variation in G4 isoforms in solution, the co-solvent’s influence on inter- vs intra-molecular isoforms predominating was evaluated by EMSA; a knockout G-rich oligonucleotide was used as a linear reference (Figure 2C). This sequence contains G>T mutations in each of the first four guanine runs involved in the physiologically relevant G4 formation. Upon KCl, nucleoplasm, or co-solvent addition to the wild-type MYC G4-forming sequence, the structural species existing were intramolecular G4 isoforms based on the lower migration patterns as compared to the linear control. As the intramolecular isoforms being studied are so similar in overall size and vary only in loop lengths and directionality, distinctly migrating bands are not evident. Instead, the overall spread of the band and their migration can be compared. Consistent with fewer isoforms, 2% nucleoplasm in the solution mediated a sharper band with a lower migration pattern, as compared to the 5 and 10% nucleoplasm conditions. Co-solvents at or below the migration pattern of 2% nucleoplasm include 10
Journal Pre-proof dextran sulfate, ficoll70, glycerol, and glucose. Cumulatively from the EMSA and ECD findings, addition of 10% glycerol or 20% ficoll-70 were determined to be the closest and most consistent recapitulation of physiologically relevant MYC G4 isoforms and was used for further assay development and validation.
Jo
ur
na
lP
re
-p
ro
of
FRET Melt2 primary assay The FRET Melt assay used to screen for G4 interactive compounds was first published in 2007[23]. This assay was utilized for the identification of compounds that interact with the MYC G4, and the “hits” identified were ultimately shown to not have intracellular activity related to this structure[24]. Modifications to the assay were recently published wherein the osmolyte PEG was added, which improved agreement between the screening assay and ECD, but a correlation with biological activity related to G4 stabilization was not assessed[25]. Based on our findings described above related to annealing conditions and the effect of osmolytes, we sought to optimize the predictive ability of the FRET Melt for published compounds’ activity in cells. In particular, we incorporated either 10% glycerol or 20% ficoll-70 into the assay and examined a series of negative (TMPyP2, NSC 176327 and Quindoline i[24, 26]) and positive (TMPyP4, Braco-19[27], and NSC338258[28]) control compounds at two concentrations over up to nine melting and annealing cycles (Figure 3). Even in the absence of compounds, the increased stability of the control melting and annealing dynamics with either glycerol or ficoll-70 is evident over the nine cycles as a consistent sigmoidal entity. It is also evident that the first melt and anneal cycle, wherein the G4 is formed alone or in the presence of the compounds does not lend itself to analysis by this assay. Thus, while it is being shown in Figure 3, we did not attempt to derive a T M from the first cycle data.
11
na
lP
re
-p
ro
of
Journal Pre-proof
Jo
ur
Figure 3. Melting profiles of the 5’ FAM and 3’ TAMRA labeled Pu46 FRET probe under varying conditions of co-solvent and melt cycles with 10 M test compounds. Fluorescence as a function of temperature, and as an indirect measure of G4 thermal stability, was measure on a BioRad CFX96 realtime PCR machine in varying control and test conditions, as indicated. RFU was normalized to initial (20 C) and final (100 C) values. Negative test compounds are shown in red and positive test compounds are shown in green; separation of the red and green compounds is most evident in the assay run with 10% glycerol as a co-solvent.
From each buffer condition, each test concentration, and each melt cycle, we calculated a Z’ factor for the FRET Melt assay using the aforementioned three negative and positive controls (Figure 4A). Z’ factor is a measure of the quality and reliability of a screening method, taking into account the statistical effect size of positive and negative controls and each of their inherent variance, a Z’-factor >0.5 indicates a reproducible and reliable method[29]. These controls were particularly chosen because they have either been shown to have ex vivo MYC G4 stabilizing ability with no correlating intracellular activity related to the MYC G4 (e.g. Quindoline i and NSC176327[24, 26]), or the ex vivo stabilization has been affirmatively connected to the compound’s ability to stabilize the MYC G4 in vitro (e.g. NSC338258[28]). While some combinations of conditions, melt cycles and compound concentration had Z’ factors >0, only those with five or fewer melt and anneal cycles that incorporated 10% glycerol had positive Z’ factors. Three conditions reached Z’ factors over 0.5: compounds tested at 1 M 12
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
examined at their third melt cycle (Z’ factor = 0.6), and compounds tested at 10 M examined at their second (Z’ factor = 0.5) or fourth (Z’ factor = 0.5) melt cycle (Figure 4B). These conditions were then used to test lesser-known negative (the glucocorticoid, prednisolone) and positive (DC-34[30] and D-089[31]) compounds (Figure 4C). As expected, a dose-response of changes in melt temperature was observed for the two positive compounds, ranging from neglible changes at 1 M to up to 30 °C at 10 M screened concentration. Both two and four melting cycles demonstrated a lack of thermal stabilization of the MYC G4 by the glucocorticoid, prednisolone, and increased thermal stability of the structure in the presence of DC-34 and D-089. Overall, two melt cycles is the most consistent with sigmoidal and cooperative melting profiles, and demonstrates a clear differentiation from the lesser known negative and positive compounds. Globally, the FRET Melt assay has been optimized to include 90 mM LiCl/10 mM KCl and 10% glycerol in the buffer, to be run at a 5:1 compound:G4 ratio (versus the 20:1 ratio initially described for the assay[23], and to screen compounds at the second melt cycle. Cumulatively, these conditions underlie the modified FRET Melt2 assay herein described.
2
Figure 4. Improved predictability of the FRET Melt assay. The FRET assay was done under varying conditions of up to nine heat and anneal cycles, with buffer conditions in the presence of varying osmolytes, and at either ligand:G4 ratios of 0.5 (1 M) or 5 (10 M). Z’-factors were calculated and
13
Journal Pre-proof consistently improved with the inclusion of glycerol (A and B). The updated FRET Melt assay using conditions with Z’ factors>0.5 was performed with an unrelated glucocorticoid, prednisolone, and with two newer MYC G4 stabilizing compounds, DC-34 and D-089 (C, the inset legends for each graph indicate the TM).
Discussion
ro
of
G4s are found in many regulatory regions of nucleic acids within a cell, including DNA’s centromeres, telomeres, promoters and untranslated regions, as well as RNA’s initiation region, introns and exon borders. Molecularly targeting G4s for cancer is related to their prevalence within oncogenes and tumor suppressor genes that are highly dysregulated across an array of cancer types. Cell-free techniques are generally used as the primary screening assay for compounds that interact with specific G4s; however, structures formed without physiological stressors may differ from those formed within more complex environments such as under supercoiled stress or in cells.
Jo
ur
na
lP
re
-p
Biomolecules influence cellular activities, as they occupy a substantive amount of space within a cell, and particularly within the nucleus; these biomolecules allow for the dehydrated and condensed environment within nuclei. MeCN and PEG are common cosolutes reported in G4 literature; the FRET assay has already gone through first generation of modification with the inclusion of PEG. Of note, some have concluded that PEG positively impacts G4 melting behavior by stabilizing the structure directly, as opposed to altering the environment[13, 32]. Thus, careful consideration needs to be taken when proposing to use PEGs as molecular crowding agents, which led to the selection of alternative agents utilized in the current study – dextran sulfate, ficoll-70, and glycerol. Similar criticism has been made regarding the use of MeCN, although it has since been accepted to not alter G4 conformations, but to enhance G4 stability by manipulating the surroundings[14]. Herein we included other osmolytes – sucrose, glucose, and ethylene glycol – to examine in addition to MeCN. Additionally, extracted nucleoplasm was introduced within these studies as an ideal example of mimicking physiological conditions, which is a practice that has not been performed within the G4 field to date. With this array of co-solutes, we determined the optimal concentrations to be used within MYC in order to understand how biomolecules affect G4 formation in order to improve future drug discovery efforts. We concluded that low amounts of extracted nucleoplasm, MeCN, dextran sulfate, ficoll-70, glycerol, and glucose can limit the number of intramolecular G4 isoforms existing when compared to simple buffer +/KCl controls. In addition to examining the array of co-solvents and nucleoplasm, we sought to perform a systematic evaluation of the number of conditions of G4 heating and annealing conditions. Although this is seemingly a simplistic portion of the G4 field, it is notable that most labs do not use consistent conditions and to our knowledge this was not something previously studied. We observed that more than one heating and annealing cycle, but fewer than eight total, and the use of rapid cooling lead to both the most consistent G4 formed in terms of stability and distribution of isoforms. Cumulatively, the use of heating and annealing conditions and co-solvents was incorporated into a rapid screening method for G4 stabilization – the FRET Melt technique. 14
Journal Pre-proof
of
Most G4 targeting is centralized around small molecules that selectively bind and stabilize specific higher order structures, following the premise that these globular formations are better targets than dsDNA, with a measure of compound selectivity possible. Screening for small molecules that stabilize specific G4s is frequently performed using the FRET melt screen. This procedure is implemented under simple conditions containing buffer and the presence of a monovalent cation like potassium with KCl; the second-generation assay incorporates PEG. The use of this assay has led to the identification of several compound classes that act as G4 stabilizers, but has not yielded high in vitro or in vivo success, or the activity of the agents is unrelated to a G4 mechanism. To date, Quarfloxin and compound CX-5461 are the only G4-stabilizing agents to make it to clinical trials, although neither compound has been directly linked to the MYC promoter G4. Unfortunately, Quarfloxin failed phase II trials due to high albumin binding. CX-5461 is a pan-G4 stabilizing agent that binds RNA and DNA structures and is currently in trial for BRCA mutant cancers[33].
Jo
ur
na
lP
re
-p
ro
There are various factors that come into play for drug screening outside of cells such as affinity, selectivity, and specificity. We were primarily concerned with the imitation of the molecular conditions within a cell, more specifically, in this case, within a cell’s nucleus in order to recapitulate G4s formed in the nucleus. This led to the aforementioned application of co-solvents as mimicry agents of biomolecules within a cell’s nuclear environment. Using the knowledge gained about G4 annealing conditions and the effect of co-solvents on G4 stability, isoform distribution, and similarity to the effects of nucleoplasm, we developed the FRET Melt2 technique. Applying this assay to an array of MYC G4-interactive compounds, we were able to differentiate between those with no interaction (the glucocorticoid prednisolone) and those with well described, pan-G4 stabilization (TMPyP4 and BRACO-19). More notably, this assay was able to tease apart the effects of the previously examined MYC G4-interactive compounds: quindoline I, NSC176327, NSC338258, DC-34 and D-089. Each of these agents were identified through the first-generation FRET Melt assay, and the former two were subsequently shown to downregulate MYC, but in a non-G4-related mechanism. Only NSC33825829, DC-3430 and D-08931 have been shown to downregulate MYC via direct stabilization of the MYC G4 through use of the CA46 exon test; both Quindoline i and NSC176327 failed this test. The CA46 exon test is an isogenic method of measuring compound stabilization of the MYC G4 utilizing the heterogenous chromosome 8:11 translocations in this Burkitt’s cell line wherein exon 1 remains driven by a G4 and exon 2 is moved to regulation by the immunoglobin enhancer element [28]. Remarkably, the FRET Melt2 assay differentiated the former compounds from the latter, with a Z’-factor of >0.5. Notably, while this improved assay is more predictive of cellular activity related to G4s, it is not able to distinguish between compounds that can and cannot enter the cell. All “hits” require follow up with cellular conditions to examine cellular penetration. 5. Conclusions The current study examined annealing and co-solvent conditions in order to improve the recapitulation of biologically relevant G4 structures within the MYC promoter and modified the popular FRET melt assay to improve predictability. Cumulatively, it was found that the inclusion of low (10) millimolar potassium and 10% 15
Journal Pre-proof glycerol, along with at least two total annealing cycles, significantly improved the Z’factor of the FRET Melt for the MYC promoter G4. These studies can be applied to an array of high therapeutic value G4 targets, although it is notable that similar preliminary annealing conditions and co-solvent analyses may be necessary for each unique, physiologically relevant, G4. Acknowledgements
of
This work was supported by the National Institutes of Health/National Cancer Institute grant 1R15CA173667-01A1.
References
Jo
ur
na
lP
re
-p
ro
[1] A. Verma, K. Halder, R. Halder, V.K. Yadav, P. Rawal, R.K. Thakur, F. Mohd, A. Sharma, S. Chowdhury, Genome-wide computational and expression analyses reveal G-quadruplex DNA motifs as conserved cis-regulatory elements in human and related species, J Med Chem, 51 (2008) 5641-5649. [2] V.S. Chambers, G. Marsico, J.M. Boutell, M. Di Antonio, G.P. Smith, S. Balasubramanian, High-throughput sequencing of DNA G-quadruplex structures in the human genome, Nat Biotechnol, 33 (2015) 877-881. [3] T.A. Brooks, L.H. Hurley, Targeting MYC Expression through G-Quadruplexes, Genes Cancer, 1 (2010) 641-649. [4] S. Balasubramanian, L.H. Hurley, S. Neidle, Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?, Nat Rev Drug Discov, 10 (2011) 261-275. [5] T.G. Hao, V.C.; Brooks, T.A., Nucleic Acid clamps engineered to detect and stabilize the MYC G-quadruplex: a new therapeutic approach, Nucleic acids research, (2016). [6] D. Sun, L.H. Hurley, The importance of negative superhelicity in inducing the formation of G-quadruplex and i-motif structures in the c-Myc promoter: implications for drug targeting and control of gene expression, Journal of medicinal chemistry, 52 (2009) 2863–2874. [7] J. Dai, M. Carver, R. Mathad, L.H. Hurley, D. Yang, Structure of 2:1 quindoline–MYC G-quadruplex. Ligand-induced reorientation and insights into drug design, Nature Chemistry, (2011) submitted. [8] T.S. Dexheimer, S.S. Carey, S. Zuohe, V.M. Gokhale, X. Hu, L.B. Murata, E.M. Maes, A. Weichsel, D. Sun, E.J. Meuillet, W.R. Montfort, L.H. Hurley, NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III1, Molecular cancer therapeutics, 8 (2009) 1363–1377. [9] H.T. Le, M.C. Miller, R. Buscaglia, W.L. Dean, P.A. Holt, J.B. Chaires, J.O. Trent, Not all G-quadruplexes are created equally: an investigation of the structural polymorphism of the c-Myc G-quadruplex-forming sequence and its interaction with the porphyrin TMPyP4, Organic & biomolecular chemistry, 10 (2012) 9393-9404. [10] D. Sun, In vitro footprinting of promoter regions within supercoiled plasmid DNA, Methods in molecular biology (Clifton, N.J, 613 (2010) 223-233. 16
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
[11] D. Sun, K. Guo, Y.J. Shin, Evidence of the formation of G-quadruplex structures in the promoter region of the human vascular endothelial growth factor gene, Nucleic Acids Res, 39 (2011) 1256-1265. [12] D. Miyoshi, H. Karimata, N. Sugimoto, Hydration regulates thermodynamics of Gquadruplex formation under molecular crowding conditions, J Am Chem Soc, 128 (2006) 7957-7963. [13] C.H. Spink, J.B. Chaires, Effects of hydration, ion release, and excluded volume on the melting of triplex and duplex DNA, Biochemistry, 38 (1999) 496-508. [14] J. Zhou, H. Tateishi-Karimata, J.L. Mergny, M. Cheng, Z. Feng, D. Miyoshi, N. Sugimoto, C. Li, Reevaluation of the stability of G-quadruplex structures under crowding conditions, Biochimie, 121 (2016) 204-208. [15] M.C. Miller, R. Buscaglia, J.B. Chaires, A.N. Lane, J.O. Trent, Hydration Is a Major Determinant of the G-Quadruplex Stability and Conformation of the Human Telomere 3' Sequence of d(AG(3)(TTAG(3))(3)), J Am Chem Soc, (2010). [16] C.V. Dang, K.A. O'Donnell, K.I. Zeller, T. Nguyen, R.C. Osthus, F. Li, The c-Myc target gene network, Seminars in cancer biology, 16 (2006) 253-264. [17] H.J. Chung, D. Levens, c-myc expression: keep the noise down!, Mol Cells, 20 (2005) 157-166. [18] R.N. Eisenman, Deconstructing myc, Genes Dev, 15 (2001) 2023-2030. [19] T.A. Brooks, L.H. Hurley, The role of supercoiling in transcriptional control of MYC and its importance in molecular therapeutics, Nature reviews, 9 (2009) 849-861. [20] A. Siddiqui-Jain, C.L. Grand, D.J. Bearss, L.H. Hurley, Direct evidence for a Gquadruplex in a promoter region and its targeting with a small molecule to repress cMYC transcription, Proc Natl Acad Sci U S A, 99 (2002) 11593-11598. [21] R.K. Morgan, M.M. Molnar, H. Batra, B. Summerford, R.M. Wadkins, T.A. Brooks, Effects of 5-Hydroxymethylcytosine Epigenetic Modification on the Stability and Molecular Recognition of VEGF i-Motif and G-Quadruplex Structures, Journal of nucleic acids, 2018 (2018) 9281286. [22] S. Takahashi, J. Yamamoto, A. Kitamura, M. Kinjo, N. Sugimoto, Characterization of Intracellular Crowding Environments with Topology-Based DNA Quadruplex Sensors, Analytical chemistry, 91 (2019) 2586-2590. [23] A. De Cian, L. Guittat, M. Kaiser, B. Sacca, S. Amrane, A. Bourdoncle, P. Alberti, M.P. Teulade-Fichou, L. Lacroix, J.L. Mergny, Fluorescence-based melting assays for studying quadruplex ligands, Methods (San Diego, Calif, 42 (2007) 183-195. [24] P.V. Boddupally, S. Hahn, C. Beman, B. De, T.A. Brooks, V. Gokhale, L.H. Hurley, Anticancer activity and cellular repression of c-MYC by the G-quadruplex-stabilizing 11piperazinylquindoline is not dependent on direct targeting of the G-quadruplex in the cMYC promoter, Journal of medicinal chemistry, 55 (2012) 6076-6086. [25] A. De Rache, J.L. Mergny, Assessment of selectivity of G-quadruplex ligands via an optimised FRET melting assay, Biochimie, 115 (2015) 194-202. [26] T.M. Ou, Y.J. Lu, C. Zhang, Z.S. Huang, X.D. Wang, J.H. Tan, Y. Chen, D.L. Ma, K.Y. Wong, J.C. Tang, A.S. Chan, L.Q. Gu, Stabilization of G-quadruplex DNA and down-regulation of oncogene c-myc by quindoline derivatives, Journal of medicinal chemistry, 50 (2007) 1465-1474. [27] G. Zhou, X. Liu, Y. Li, S. Xu, C. Ma, X. Wu, Y. Cheng, Z. Yu, G. Zhao, Y. Chen, Telomere targeting with a novel G-quadruplex-interactive ligand BRACO-19 induces T17
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
loop disassembly and telomerase displacement in human glioblastoma cells, Oncotarget, 7 (2016) 14925-14939. [28] R.V. Brown, F.L. Danford, V. Gokhale, L.H. Hurley, T.A. Brooks, Demonstration that drug-targeted down-regulation of MYC in non-Hodgkins lymphoma is directly mediated through the promoter G-quadruplex, J Biol Chem, 286 (2011) 41018-41027. [29] J.H. Zhang, T.D. Chung, K.R. Oldenburg, A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays, J Biomol Screen, 4 (1999) 67-73. [30] D.R. Calabrese, X. Chen, E.C. Leon, S.M. Gaikwad, Z. Phyo, W.M. Hewitt, S. Alden, T.A. Hilimire, F. He, A.M. Michalowski, J.K. Simmons, L.B. Saunders, S. Zhang, D. Connors, K.J. Walters, B.A. Mock, J.S. Schneekloth, Jr., Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex, Nature communications, 9 (2018) 4229. [31] K.M. Felsenstein, L.B. Saunders, J.K. Simmons, E. Leon, D.R. Calabrese, S. Zhang, A. Michalowski, P. Gareiss, B.A. Mock, J.S. Schneekloth, Jr., Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression, ACS chemical biology, 11 (2016) 139-148. [32] L. Petraccone, A. Malafronte, J. Amato, C. Giancola, G-quadruplexes from human telomeric DNA: how many conformations in PEG containing solutions?, The journal of physical chemistry. B, 116 (2012) 2294-2305. [33] H. Xu, M. Di Antonio, S. McKinney, V. Mathew, B. Ho, N.J. O'Neil, N.D. Santos, J. Silvester, V. Wei, J. Garcia, F. Kabeer, D. Lai, P. Soriano, J. Banath, D.S. Chiu, D. Yap, D.D. Le, F.B. Ye, A. Zhang, K. Thu, J. Soong, S.C. Lin, A.H. Tsai, T. Osako, T. Algara, D.N. Saunders, J. Wong, J. Xian, M.B. Bally, J.D. Brenton, G.W. Brown, S.P. Shah, D. Cescon, T.W. Mak, C. Caldas, P.C. Stirling, P. Hieter, S. Balasubramanian, S. Aparicio, CX-5461 is a DNA G-quadruplex stabilizer with selective lethality in BRCA1/2 deficient tumours, Nature communications, 8 (2017) 14432.
18
Journal Pre-proof Highlights:
of ro -p re lP na
ur
Two or more melting and annealing cycles facilitate select MYC G4 isomer formation Dehydration and molecular crowding mediate physiologically relevant G4 isoforms G4 annealing and co-solvent conditions improve ligand screening in FRET Melt2 assay
Jo
19
Rhianna K. Morgan, Alexandra Psaras, Quinea Lassiter, Kelsey Raymer, Tracy A. Brooks PII:
S1874-9399(19)30220-2
DOI:
https://doi.org/10.1016/j.bbagrm.2019.194478
Reference:
BBAGRM 194478
To appear in:
BBA - Gene Regulatory Mechanisms
Received date:
24 May 2019
Revised date:
23 December 2019
Accepted date:
26 December 2019
Please cite this article as: R.K. Morgan, A. Psaras, Q. Lassiter, et al., G-quadruplex deconvolution with physiological mimicry enhances primary screening: Optimizing the FRET Melt2 assay, BBA - Gene Regulatory Mechanisms(2018), https://doi.org/10.1016/ j.bbagrm.2019.194478
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2018 Published by Elsevier.
Journal Pre-proof G-quadruplex deconvolution with physiological mimicry enhances primary screening: optimizing the FRET Melt2 Assay Rhianna K. Morgan1,2, Alexandra Psaras3, Quinea Lassiter2,4, Kelsey Raymer2, and Tracy A. Brooks2,3*
1
School of Veterinary Medicine, Department of Molecular Biosciences, University of California-Davis, Davis, CA 95616 2
School of Pharmacy, Department of BioMolecular Sciences, University of Mississippi, University, MS 38677 3
ro
of
School of Pharmacy and Pharmaceutical Sciences, Department of Pharmaceutical Sciences, Binghamton University, Binghamton, NY 13902 4
re
-p
Department of Microbiology, University of Arizona, Tucson, AZ 85721
lP
*Corresponding Author
Telephone: 607-777-5842
ur
Fax: 607-777-3020
na
Mail address: 96 Corliss Ave, PB-331, Johnson City, NY 13790
Jo
Email: [email protected]
1
Journal Pre-proof Abstract
na
lP
re
-p
ro
of
Non-B-DNA G-quadruplex (G4) structures have shown promise as molecular targets. Modulating G4 stability for oncogenic transcriptional control is a promising avenue for the development of novel therapeutics. Extracellularly, G4 stabilization can be mediated by alkali cations, modifying water content, or with molecular crowding. Intracellularly, G4 formation is mediated by negative superhelicity and transcriptional activity, and can be stabilized with small molecules or oligonucleotides. Numerous G4stabilizing compounds have been identified that impact promoter activity in plasmids. These compounds, however, infrequently show activity in cells, are found to have nonG4-mediated mechanisms of action, or do not demonstrate activity in vivo. The G4 field requires enhanced predictive screening methods to identify compounds with G4mediated in vitro activity and in vivo efficacy. Using the best characterized promoter G4 to date, MYC, we examined the effects of varying annealing conditions (rate of cool down and number of heat/cool cycles), co-solvents (glucose, acetonitrile, polyethylene glycol, dextran sulfate, sucrose, ficoll-70, glycerol) and nucleoplasm on G4 formation and compound screening. We observed a marked decrease in hit rates when shifting from simple buffer conditions to include potassium and glycerol, and utilizing two or more rapid annealing cycles; the difference in hit compounds coincides with previous findings of active, inactive, and non-G4-mediated activity, including NSC338258, Quindoline i, and TMPyP4; with these changes, we describe a modification of the primary FRET Melt screening assay – the FRET Melt2. This understanding of physiological principles governing the above G4 formation will better inform future drug discovery efforts for this and other oncogenic promoters.
Jo
ur
Keywords: G-quadruplex, MYC, FRET melt, physiological conditions, small molecules
2
Journal Pre-proof Introduction
re
-p
ro
of
G-quadruplexes (G4s) are common throughout the genome with enhanced prevalence in promoters and 5’UTRs of oncogenes and tumor suppressor genes[1, 2]. G4s are secondary DNA structures able to form in guanine-rich DNA, wherein four guanines hydrogen bond by Hoogsteen base-pairing to form tetrad arrangements. These planar moieties have increased stability when a monovalent cation (K+ or Na+) is located at their center. Upon tetrad formation, two or more, but most often three, will stack upon one another with the intervening nucleotides forming the connecting loops. G4s are highly polymorphic, both across regions of DNA and within one sequence, and vary in the number of stacked tetrads, as well as in loop directionality. It is suggested that short loop lengths (≤7 or 9) are favorable, but G4s having been characterized harboring longer loops of up to 26 base pairs, such as K-RAS, hTERT, and Bcl-2[3, 4]. These non-canonical DNA structures have been characterized as transcriptional regulators, as either activators or suppressors depending on the gene involved and the endogenous proteins that bind the G-rich sequence. The majority of DNA G4s identified are transcriptional suppressors functioning by hindering RNA polymerase and/or transcription factor binding. Such structures span the hallmarks of cancer, thus, most research focuses on utilizing small G4-stabilizing molecules in order to decrease tumor growth and metastasis.
Jo
ur
na
lP
Several compound classes have been identified that bind to and stabilize G4s. Many of these molecules are pan-G4 stabilizing agents extracellularly, and though some have been shown to impact gene expression intracellularly, few have confirmed G4-mediated mechanisms of action or activity in vivo. It is challenging to classify new chemical scaffolds that are selective G4 stabilizing agents; most screening and secondary assays use single-stranded DNA (ssDNA) and simple buffer conditions. Standard initial protocols for screening G4-stabilizing compounds, such as FRET melt and electronic circular dichroism (ECD), are operated in buffer, perhaps with the addition of a salt (lithium, sodium, or potassium). This allows for G4 structure formation, but it does not necessarily coincide with physiologically relevant conditions or the biologically active G4 isoforms. For the MYC G4, the physiologically relevant G4 is formed from the first four (of six) contiguous runs of continuous guanines within the nuclease hypersensitivity element III1[5, 6], whereas the more commonly identified structure using simple extracellular conditions forms from the second through fifth of these guanine runs[7-9]. Current drug discovery and development programs are hindered by this discrepancy between stable and predominant structures extracellularly formed and those found under supercoiled conditions and in nuclei[10, 11]. It is imperative for successful drug discovery programs that the G4s formed under screening conditions represent the relevant biological isoforms. Physiological mimicry can be accomplished through the use of co-solvents. Biomolecules inhabit a large portion of cellular volume (approximately 20-40%) creating a crowded microenvironment intracellularly[12]. Evidence suggests this molecular 3
Journal Pre-proof crowding is critical in living cells for the function of proteins, polysaccharides, soluble and insoluble molecules, and nucleic acids. The use of co-solvents in extracellular assays has been shown to effect G4 formation[12-14]; their incorporation into compound screening has not been evaluated to date. Dehydrating and molecular crowding agents, specifically acetonitrile (MeCN) and polyethylene glycol (PEG), have been studied previously and were found to increase G4 thermodynamic stability[15]. Modifying water content has also been shown to enhance binding affinity of ligands to DNA6. Hence, the addition of co-solvents to G4 screening protocols, enabling anhydrous molecular crowding and simple dehydration, are likely to mimic intracellular conditions and minimize false positives for compound screening assays.
na
lP
re
-p
ro
of
The proto-oncogene MYC is amplified in approximately 80% of cancer cases (cBioPortal)[16]. Its protein functions as a transcription factor and is responsible for regulating more than 15% of genes within the human genome[17]. It plays a significant role in cell proliferation, growth, differentiation, and apoptosis[18]; its deregulation frequently results in tumorigenesis. The MYC promoter contains a nuclease hypersensitivity element (NHEIII1) upstream from two proximal promoters that initiate close to 100% of gene transcription[19, 20]. This NHE III1 element contains a guanine dense sequence of 31 bases that can form multiple G4 structures6-9. This predominantly parallel G4 can act as a silencer of transcription and has been a popular target for G4 drug discovery programs[3, 20]. However, with many unsuccessful series of G4stabilizing compounds, the current screening approaches need to be optimized by including intracellular, and even intranuclear, conditions. Upon consideration, the conditions can be mimicked outside of a cell and applied within screening assays to best predict the small molecule/G4 DNA interactions occurring in biological systems.
Jo
ur
As described, G4s induced from ssDNA under simple buffer conditions do not always recapitulate the structures formed in more complex conditions, such as in supercoiled and chromosomal DNA. Thus, we sought to optimize extracellular conditions to mirror in vitro and in vivo G4 formations. This is required to best inform biochemical studies (e.g. protein regulation) and drug discovery efforts. Particularly, we examined the effect of varying preparatory techniques in isoform frequency and studied the effects of co-solvents and nucleoplasm on the MYC promoter G4, which led to enhancement of the FRET Melt G4 drug discovery assay. These modifications yielded higher success in identifying confirmed G4-stabilizing agents extracellularly with in vitro activity. The culmination of these screening variations resulted in the FRET Melt 2 assay, with a Z’-factor >0.5. This enhanced assay is more likely to yield “hit” compounds with in vitro and in vivo G4-mediated anti-cancer activity. Materials and Methods Materials All oligonucleotides were synthesized and purchased from Eurofins MWG Operon, LLC (Louisville, KY) (Table 1). Acrylamide/bisacrylamide (29:1) solution and ammonium persulfate were purchased from Bio-Rad laboratories (Hercules, CA), and N,N,N’,N’-
4
Journal Pre-proof tetramethylethylenediamine was purchased through Fisher Scientific (Pittsburgh, PA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO). Table 1. MYC oligonucleotide sequences.
MYCKO
5’
GCGCTTATGTTGAGTGTGTTGAGTGTGTTGAAGGTGTTG
AGGAGAC3’ MYCKO EMSA
5’
[6~FAM]GCGCTTATGTTGAGTGTGTTGAGTGTGTTGAAGG
TGTTGAGGAGAC3’ Pu46
5’
GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAAGGTGG
GGAGGAGAC3’ 5’
[6~FAM]GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAA
of
Pu46 EMSA
Pu46 FRET
5’
ro
GGTGGGGAGGAGAC3’
[6~FAM]GCGCTTATGGGGAGGGTGGGGAGGGTGGGGAA
re
-p
GGTGGGGAGGAGAC[TAMRA]3’
Cellular Nucleoplasm Extraction
Jo
ur
na
lP
MiaPaCa-2 cells were grown to ~90% confluency in 75 mL flasks and collected in a 50 mL conical tube. Cells were resuspended and centrifuged at 4,000 rpm for 5 min in ~5 packed cell volume (pcv) hypotonic buffer solution (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl) after adding 0.2 mM phenylmethylsulfonyl fluoride (PMSF) and 0.5 M dithiothreitol (DTT). The pellet was then resuspended in 3 pcv hypotonic buffer solution, and the cells were allowed to swell on ice for 10 min. Cells were homogenized and spun at 4,000 rpm for 15 min and were then resuspended in ½ packed nuclear volume (pnv) low-salt buffer solution (20 mM HEPES, pH 7.9, 25% glycerol, 1.5 mM MgCl2, and 0.2 mM EDTA) after adding 0.2 mM PMSF and 0.5 M DTT. Slowly, ½ pnv high-salt buffer solution (add 0.8 M KCl to low-salt buffer stock) was added in a dropwise fashion upon addition of 0.2 mM PMSF and 0.5 M DTT. Cytoplasmic extract was incubated at room temperature for 30 min with continuous mixing and then centrifuged at 14,000 rpm for 30 min. Supernatant was collected as the nuclear extract. Electronic Circular Dichroism (ECD) The G4 oligonucleotides (5 µM) were prepared in 50 mM Tris-HCl (pH 7.4) with varying amounts of KCl and co-solvents (0 - 40%). The co-solvents utilized were (1) osmolytes: acetonitrile (MeCN), glucose, sucrose, dextran sulfate, and ficoll-70 and (2) molecular crowding agents: polyethylene glycol (PEG), glycerol, and extracted nucleoplasm. Preparatory conditions involved heating the G4 to 95 °C for 5 min and either cooling rapidly on ice, or slowly in the turned off heat block; this was either done one, five, or ten times. Spectra were collected with a Jasco J-1500 spectropolarimeter equipped with a Peltier cell holder (Easton, MD). Recordings were made simultaneously at 262 nm 5
Journal Pre-proof from 20-100 °C at every 1 °C, and over the wavelength range 225-350 nm and at increasing temperatures (20-100 °C, every 10 °C), with a 0.5 min. hold at temperature before spectra were recorded in 1 mm quartz cuvette. Annealing after the first, fifth, or tenth melt cycles was measured immediately following the melt profiles, also every 1 or 10 °C, with a 0.5 min. hold at temperature before spectra were recorded. The ordinate is reported as millidegrees normalized to those measured at 20 °C; TM’s were determined from the mdeg at 262 nm every 1 °C with non-linear regression fitting performed with GraphPad Prism software (La Jolla, CA). Electrophoretic Mobility Shift Assay (EMSA)
re
-p
ro
of
FAM-labeled oligonucleotide (1 µM) bearing the 46 bp MYC G4-forming region in WT or KO form was prepared with 10 mM KCl, 50 mM Tris-HCl (pH 7.4), and nucleoplasm or co-solvents, as indicated. The solutions were each denatured by heating to 95 °C for 5 min, rapidly cooled for 5 min, and repeated for up to ten cycles to induce G4 formation. Upon addition of non-denaturing loading dye, the samples were loaded onto a 10% native polyacrylamide gel. After running at 100 V, the gel was visualized under blue light LED using a FotoDyne Incorporated Investigator FX Imager (Hartland, WI). Image was aligned horizontally based on the location of the wells. Fluorescence Resonance Energy Transfer (FRET) Melt
Results
Jo
ur
na
lP
A dual-labeled DNA oligomer probe bearing the 46 nucleic acid G4-forming region of the MYC promoter was used. DNA was diluted to 2 M in 10 mM Sodium Cacodylate (pH 7.4) + 100 mM LiCl, alone, with 10 mM KCl plus or minus 10% glycerol or 20% ficoll-70. G4 DNA was added to a 96-well PCR plate with or without controls and test compounds. Fluorescence was recorded from 20-95 °C, at every degree after a 10 sec hold on a Bio-Rad CFX96 real-time thermocycler (Hercules, CA). For multiple annealing repeats, the temperature was returned from 95 to 20 °C rapidly (within 3 – 5 min) before the next ramp cycle. All compounds examined in the assay were screened at a final concentration of 1 or 10 M.
G4 annealing optimization There is a wide array of preparatory techniques used for in vitro DNA studies that vary in the quantity of heat and cool cycles, the speed of DNA annealing, the presence of co-solvents, and more. In order to optimize these conditions, we did an analysis of the MYC G4 in 10 mM KCl by varying the quantity of heating and annealing conditions (1, 5, or 10) and the annealing speed (slow or rapid). We also analyzed the isoform distribution, as indicated by slope of the thermal behavior, and the absolute T M, as a relationship to stability, while both melting and annealing the G4 (Figure 1, Table 2, Supplemental Figures 1-2). One G4 annealing cycle with slow cooling demonstrated a variable thermal stability through the melting and annealing cycles (79 vs 69 °C, respectively), and showed a 1.5-fold variation in Hill slope, indicating a broader isoform distribution. If rapid cooling was used, the Hill slope and thermal stability were more variable with a 1.7-fold and 13 °C variation, respectively. With five G4 annealing cycles 6
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
and slow cooling, thermal stability varied by 11 °C, and Hill slope varied 1.4-fold. When cooled rapidly, thermal stability varied by only 7 °C (74 versus 67 °C for the melting and annealing processes, respectively), and the Hill slope was the most consistent with only a 1.2-fold change. As the G4 annealing cycles increased to ten, the discrepancy between melting and annealing thermal stability was consistently >10 °C and the slope of the melting profiles varied 1.4-1.6-fold. EMSAs were performed to evaluate possible DNA degradation after a number of cycles under simple buffer and some relevant osmolyte conditions described below. No degradation products were noted (Supplemental Figure 3). It is notable that the annealing cycles measured by ECD at after one, five, or ten melting studies were neither rapid nor slow. They were machine controlled as described in the methods above, taking ~40 minutes. From these data, we concluded that by heating to 95 °C and rapidly annealing the DNA at 4 °C five times, the most consistent thermal stability is reached with the minimal number of isoforms for the MYC promoter G4. For further experiments, five annealing conditions with rapid cooling were used.
7
ro
of
Journal Pre-proof
lP
re
-p
Figure 1. MYC G4 heating and annealing conditions affect stability and isoform distribution. The MYC G4 forming oligonucleotide, Pu46, was subjected to an array of heating and annealing conditions including a variation of number of cycles and of annealing temperatures. Thermal melt profiles were examined by ECD for the melting and re-annealing at one, five, and ten total cycles under slow (left) and rapid (right) cooling conditions; ECD mdeg was normalized to pre-melting values at 20 C. Data were collected every 1 C, all experiments were performed in triplicate. Five cycles of annealing using rapid cooling demonstrated the most consistent thermal profiles under melting and annealing conditions. Table 2. Thermal stability profile with varying annealing conditions.
Slow 76 0.6 64 0.8 1.4
5
10 Rapid 74 0.7 67 0.9 1.2
Slow 75 0.6 64 0.8 1.4
Rapid 76 0.7 64 1 1.6
Jo
ur
na
Number of 1 cycles Cooling Slow Rapid Melt TM (C) 79 0.5 79 0.5 Anneal TM (C) 69 0.8 66 0.8 Hill-slope ratio 1.5 1.7 (slopeM/slopeA)
Using Co-Solvents to Mimic Physiological Conditions for Drug Discovery Screening Through the use of co-solvents, physiological mimicry can be accomplished extracellularly. The nature of a nucleus’s dehydration and density can be achieved with the incorporation of osmolytes and molecular crowding agents. To investigate this use of co-solvents, a small cohort was chosen to add to standard buffers while examining MYC G-rich oligonucleotide sequences prior to G4 induction. Osmolytes acetonitrile (MeCN), glucose, sucrose, and ethylene glycol, along with polymers and molecular crowding agents PEG, dextran sulfate, glycerol, and ficoll-70 were utilized. Initial studies with these co-solutes determined that ethylene glycol prevented stable, inducible, G4 formation as observed with ECD (data not shown); therefore it was not used in future experiments. No other problems arose with co-solvents preventing G4 formation. In addition, we incorporated another way to mimic nuclear conditions more naturally by extracting nucleoplasm from the transformed and immortalized pancreatic cancer cell 8
Journal Pre-proof line, MiaPaCa-2. This extracted nucleoplasm contains all physiologically relevant nuclear co-solutes, with the exception of DNA and histones.
Jo
ur
na
lP
re
-p
ro
of
The incorporation of each of these solutes was first examined for the effects on MYC G4 thermal stability by ECD, as compared to a low (10 mM) salt (KCl) control (Figure 2A-B). Three concentrations (2, 5, and 10%) of extracted nucleoplasm were used to induce MYC G4 formation (Figure 2A); the inherent Cotton effects on ECD found in higher concentrations of nucleoplasm prevented their use. With increasing concentration of nucleoplasm, the hill slope of the thermal melting profile increased; correspondingly, the number of MYC G4 isoforms also increased. 2% nucleoplasm’s melting temperature matched that of the 10 mM KCl control, but its marked increase in hill slope suggest a two-state transition consistent with a single major G4 formed (Figure 2B). In addition, for each osmolyte, we determined the minimum concentration required to achieve maximal G4 formation, as described previously [21] (Supplemental Figure 4); from these studies, 10% dextran sulfate, glycerol, and glucose and 20% MeCN, PEG, ficoll-70, and sucrose were selected and utilized for the remainder of the experiments described. Of these, PEG and MeCN mediated effects that notably varied from both the other co-solvents and from the 10 mM KCl control. PEG led to marked disruption of isoforms, as noted by a change in Hill slope and a lack of a clear transition state between folded and unfolded G4, and MeCN mediated a 14 °C stabilization, both of the MYC G4. Of the remaining co-solvents, 10% glycerol most closely resembled 2% nucleoplasm by spectral profile, thermal stability, and transition state (Hill slope) (Figure 2B). Ficoll-70 also displayed a similar EMSA migration and ECD spectra as both 10% glycerol and 2% nucleoplasm. Notably, each of these co-solvents has been studied in the context of G4s and mimicking intracellular environments, where it was concluded that glycerol mimicked the nucleolus and ficoll-70 mimicked nuclear conditions[22]. Thus, both of these co-solvents were selected for further analysis.
9
na
lP
re
-p
ro
of
Journal Pre-proof
Jo
ur
Figure 2. Co-solvents and nucleoplasm effect on MYC G4 formation and isoform distribution. ECD Spectra (left, measured at room temperature) and thermal stability (right) were determined for the MYC G4 in the presence of saturating co-solvents (A) or increasing nucleoplasm (B). The dashed lined in both A and B compares the TM of the MYC G4 in the presence of 2% nucleoplasm (demonstrating the fewest isoforms) with the co-solvents. (C) G4 formation and isoform density were confirmed by EMSA, as compared to a linear knockout control oligonucleotide. From these studies, 10% glycerol and 20% ficoll70 were determined to be most consistent with nucleoplasm in regards to G4 formation, thermal stability, and isoform distribution.
With the apparent variation in G4 isoforms in solution, the co-solvent’s influence on inter- vs intra-molecular isoforms predominating was evaluated by EMSA; a knockout G-rich oligonucleotide was used as a linear reference (Figure 2C). This sequence contains G>T mutations in each of the first four guanine runs involved in the physiologically relevant G4 formation. Upon KCl, nucleoplasm, or co-solvent addition to the wild-type MYC G4-forming sequence, the structural species existing were intramolecular G4 isoforms based on the lower migration patterns as compared to the linear control. As the intramolecular isoforms being studied are so similar in overall size and vary only in loop lengths and directionality, distinctly migrating bands are not evident. Instead, the overall spread of the band and their migration can be compared. Consistent with fewer isoforms, 2% nucleoplasm in the solution mediated a sharper band with a lower migration pattern, as compared to the 5 and 10% nucleoplasm conditions. Co-solvents at or below the migration pattern of 2% nucleoplasm include 10
Journal Pre-proof dextran sulfate, ficoll70, glycerol, and glucose. Cumulatively from the EMSA and ECD findings, addition of 10% glycerol or 20% ficoll-70 were determined to be the closest and most consistent recapitulation of physiologically relevant MYC G4 isoforms and was used for further assay development and validation.
Jo
ur
na
lP
re
-p
ro
of
FRET Melt2 primary assay The FRET Melt assay used to screen for G4 interactive compounds was first published in 2007[23]. This assay was utilized for the identification of compounds that interact with the MYC G4, and the “hits” identified were ultimately shown to not have intracellular activity related to this structure[24]. Modifications to the assay were recently published wherein the osmolyte PEG was added, which improved agreement between the screening assay and ECD, but a correlation with biological activity related to G4 stabilization was not assessed[25]. Based on our findings described above related to annealing conditions and the effect of osmolytes, we sought to optimize the predictive ability of the FRET Melt for published compounds’ activity in cells. In particular, we incorporated either 10% glycerol or 20% ficoll-70 into the assay and examined a series of negative (TMPyP2, NSC 176327 and Quindoline i[24, 26]) and positive (TMPyP4, Braco-19[27], and NSC338258[28]) control compounds at two concentrations over up to nine melting and annealing cycles (Figure 3). Even in the absence of compounds, the increased stability of the control melting and annealing dynamics with either glycerol or ficoll-70 is evident over the nine cycles as a consistent sigmoidal entity. It is also evident that the first melt and anneal cycle, wherein the G4 is formed alone or in the presence of the compounds does not lend itself to analysis by this assay. Thus, while it is being shown in Figure 3, we did not attempt to derive a T M from the first cycle data.
11
na
lP
re
-p
ro
of
Journal Pre-proof
Jo
ur
Figure 3. Melting profiles of the 5’ FAM and 3’ TAMRA labeled Pu46 FRET probe under varying conditions of co-solvent and melt cycles with 10 M test compounds. Fluorescence as a function of temperature, and as an indirect measure of G4 thermal stability, was measure on a BioRad CFX96 realtime PCR machine in varying control and test conditions, as indicated. RFU was normalized to initial (20 C) and final (100 C) values. Negative test compounds are shown in red and positive test compounds are shown in green; separation of the red and green compounds is most evident in the assay run with 10% glycerol as a co-solvent.
From each buffer condition, each test concentration, and each melt cycle, we calculated a Z’ factor for the FRET Melt assay using the aforementioned three negative and positive controls (Figure 4A). Z’ factor is a measure of the quality and reliability of a screening method, taking into account the statistical effect size of positive and negative controls and each of their inherent variance, a Z’-factor >0.5 indicates a reproducible and reliable method[29]. These controls were particularly chosen because they have either been shown to have ex vivo MYC G4 stabilizing ability with no correlating intracellular activity related to the MYC G4 (e.g. Quindoline i and NSC176327[24, 26]), or the ex vivo stabilization has been affirmatively connected to the compound’s ability to stabilize the MYC G4 in vitro (e.g. NSC338258[28]). While some combinations of conditions, melt cycles and compound concentration had Z’ factors >0, only those with five or fewer melt and anneal cycles that incorporated 10% glycerol had positive Z’ factors. Three conditions reached Z’ factors over 0.5: compounds tested at 1 M 12
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
examined at their third melt cycle (Z’ factor = 0.6), and compounds tested at 10 M examined at their second (Z’ factor = 0.5) or fourth (Z’ factor = 0.5) melt cycle (Figure 4B). These conditions were then used to test lesser-known negative (the glucocorticoid, prednisolone) and positive (DC-34[30] and D-089[31]) compounds (Figure 4C). As expected, a dose-response of changes in melt temperature was observed for the two positive compounds, ranging from neglible changes at 1 M to up to 30 °C at 10 M screened concentration. Both two and four melting cycles demonstrated a lack of thermal stabilization of the MYC G4 by the glucocorticoid, prednisolone, and increased thermal stability of the structure in the presence of DC-34 and D-089. Overall, two melt cycles is the most consistent with sigmoidal and cooperative melting profiles, and demonstrates a clear differentiation from the lesser known negative and positive compounds. Globally, the FRET Melt assay has been optimized to include 90 mM LiCl/10 mM KCl and 10% glycerol in the buffer, to be run at a 5:1 compound:G4 ratio (versus the 20:1 ratio initially described for the assay[23], and to screen compounds at the second melt cycle. Cumulatively, these conditions underlie the modified FRET Melt2 assay herein described.
2
Figure 4. Improved predictability of the FRET Melt assay. The FRET assay was done under varying conditions of up to nine heat and anneal cycles, with buffer conditions in the presence of varying osmolytes, and at either ligand:G4 ratios of 0.5 (1 M) or 5 (10 M). Z’-factors were calculated and
13
Journal Pre-proof consistently improved with the inclusion of glycerol (A and B). The updated FRET Melt assay using conditions with Z’ factors>0.5 was performed with an unrelated glucocorticoid, prednisolone, and with two newer MYC G4 stabilizing compounds, DC-34 and D-089 (C, the inset legends for each graph indicate the TM).
Discussion
ro
of
G4s are found in many regulatory regions of nucleic acids within a cell, including DNA’s centromeres, telomeres, promoters and untranslated regions, as well as RNA’s initiation region, introns and exon borders. Molecularly targeting G4s for cancer is related to their prevalence within oncogenes and tumor suppressor genes that are highly dysregulated across an array of cancer types. Cell-free techniques are generally used as the primary screening assay for compounds that interact with specific G4s; however, structures formed without physiological stressors may differ from those formed within more complex environments such as under supercoiled stress or in cells.
Jo
ur
na
lP
re
-p
Biomolecules influence cellular activities, as they occupy a substantive amount of space within a cell, and particularly within the nucleus; these biomolecules allow for the dehydrated and condensed environment within nuclei. MeCN and PEG are common cosolutes reported in G4 literature; the FRET assay has already gone through first generation of modification with the inclusion of PEG. Of note, some have concluded that PEG positively impacts G4 melting behavior by stabilizing the structure directly, as opposed to altering the environment[13, 32]. Thus, careful consideration needs to be taken when proposing to use PEGs as molecular crowding agents, which led to the selection of alternative agents utilized in the current study – dextran sulfate, ficoll-70, and glycerol. Similar criticism has been made regarding the use of MeCN, although it has since been accepted to not alter G4 conformations, but to enhance G4 stability by manipulating the surroundings[14]. Herein we included other osmolytes – sucrose, glucose, and ethylene glycol – to examine in addition to MeCN. Additionally, extracted nucleoplasm was introduced within these studies as an ideal example of mimicking physiological conditions, which is a practice that has not been performed within the G4 field to date. With this array of co-solutes, we determined the optimal concentrations to be used within MYC in order to understand how biomolecules affect G4 formation in order to improve future drug discovery efforts. We concluded that low amounts of extracted nucleoplasm, MeCN, dextran sulfate, ficoll-70, glycerol, and glucose can limit the number of intramolecular G4 isoforms existing when compared to simple buffer +/KCl controls. In addition to examining the array of co-solvents and nucleoplasm, we sought to perform a systematic evaluation of the number of conditions of G4 heating and annealing conditions. Although this is seemingly a simplistic portion of the G4 field, it is notable that most labs do not use consistent conditions and to our knowledge this was not something previously studied. We observed that more than one heating and annealing cycle, but fewer than eight total, and the use of rapid cooling lead to both the most consistent G4 formed in terms of stability and distribution of isoforms. Cumulatively, the use of heating and annealing conditions and co-solvents was incorporated into a rapid screening method for G4 stabilization – the FRET Melt technique. 14
Journal Pre-proof
of
Most G4 targeting is centralized around small molecules that selectively bind and stabilize specific higher order structures, following the premise that these globular formations are better targets than dsDNA, with a measure of compound selectivity possible. Screening for small molecules that stabilize specific G4s is frequently performed using the FRET melt screen. This procedure is implemented under simple conditions containing buffer and the presence of a monovalent cation like potassium with KCl; the second-generation assay incorporates PEG. The use of this assay has led to the identification of several compound classes that act as G4 stabilizers, but has not yielded high in vitro or in vivo success, or the activity of the agents is unrelated to a G4 mechanism. To date, Quarfloxin and compound CX-5461 are the only G4-stabilizing agents to make it to clinical trials, although neither compound has been directly linked to the MYC promoter G4. Unfortunately, Quarfloxin failed phase II trials due to high albumin binding. CX-5461 is a pan-G4 stabilizing agent that binds RNA and DNA structures and is currently in trial for BRCA mutant cancers[33].
Jo
ur
na
lP
re
-p
ro
There are various factors that come into play for drug screening outside of cells such as affinity, selectivity, and specificity. We were primarily concerned with the imitation of the molecular conditions within a cell, more specifically, in this case, within a cell’s nucleus in order to recapitulate G4s formed in the nucleus. This led to the aforementioned application of co-solvents as mimicry agents of biomolecules within a cell’s nuclear environment. Using the knowledge gained about G4 annealing conditions and the effect of co-solvents on G4 stability, isoform distribution, and similarity to the effects of nucleoplasm, we developed the FRET Melt2 technique. Applying this assay to an array of MYC G4-interactive compounds, we were able to differentiate between those with no interaction (the glucocorticoid prednisolone) and those with well described, pan-G4 stabilization (TMPyP4 and BRACO-19). More notably, this assay was able to tease apart the effects of the previously examined MYC G4-interactive compounds: quindoline I, NSC176327, NSC338258, DC-34 and D-089. Each of these agents were identified through the first-generation FRET Melt assay, and the former two were subsequently shown to downregulate MYC, but in a non-G4-related mechanism. Only NSC33825829, DC-3430 and D-08931 have been shown to downregulate MYC via direct stabilization of the MYC G4 through use of the CA46 exon test; both Quindoline i and NSC176327 failed this test. The CA46 exon test is an isogenic method of measuring compound stabilization of the MYC G4 utilizing the heterogenous chromosome 8:11 translocations in this Burkitt’s cell line wherein exon 1 remains driven by a G4 and exon 2 is moved to regulation by the immunoglobin enhancer element [28]. Remarkably, the FRET Melt2 assay differentiated the former compounds from the latter, with a Z’-factor of >0.5. Notably, while this improved assay is more predictive of cellular activity related to G4s, it is not able to distinguish between compounds that can and cannot enter the cell. All “hits” require follow up with cellular conditions to examine cellular penetration. 5. Conclusions The current study examined annealing and co-solvent conditions in order to improve the recapitulation of biologically relevant G4 structures within the MYC promoter and modified the popular FRET melt assay to improve predictability. Cumulatively, it was found that the inclusion of low (10) millimolar potassium and 10% 15
Journal Pre-proof glycerol, along with at least two total annealing cycles, significantly improved the Z’factor of the FRET Melt for the MYC promoter G4. These studies can be applied to an array of high therapeutic value G4 targets, although it is notable that similar preliminary annealing conditions and co-solvent analyses may be necessary for each unique, physiologically relevant, G4. Acknowledgements
of
This work was supported by the National Institutes of Health/National Cancer Institute grant 1R15CA173667-01A1.
References
Jo
ur
na
lP
re
-p
ro
[1] A. Verma, K. Halder, R. Halder, V.K. Yadav, P. Rawal, R.K. Thakur, F. Mohd, A. Sharma, S. Chowdhury, Genome-wide computational and expression analyses reveal G-quadruplex DNA motifs as conserved cis-regulatory elements in human and related species, J Med Chem, 51 (2008) 5641-5649. [2] V.S. Chambers, G. Marsico, J.M. Boutell, M. Di Antonio, G.P. Smith, S. Balasubramanian, High-throughput sequencing of DNA G-quadruplex structures in the human genome, Nat Biotechnol, 33 (2015) 877-881. [3] T.A. Brooks, L.H. Hurley, Targeting MYC Expression through G-Quadruplexes, Genes Cancer, 1 (2010) 641-649. [4] S. Balasubramanian, L.H. Hurley, S. Neidle, Targeting G-quadruplexes in gene promoters: a novel anticancer strategy?, Nat Rev Drug Discov, 10 (2011) 261-275. [5] T.G. Hao, V.C.; Brooks, T.A., Nucleic Acid clamps engineered to detect and stabilize the MYC G-quadruplex: a new therapeutic approach, Nucleic acids research, (2016). [6] D. Sun, L.H. Hurley, The importance of negative superhelicity in inducing the formation of G-quadruplex and i-motif structures in the c-Myc promoter: implications for drug targeting and control of gene expression, Journal of medicinal chemistry, 52 (2009) 2863–2874. [7] J. Dai, M. Carver, R. Mathad, L.H. Hurley, D. Yang, Structure of 2:1 quindoline–MYC G-quadruplex. Ligand-induced reorientation and insights into drug design, Nature Chemistry, (2011) submitted. [8] T.S. Dexheimer, S.S. Carey, S. Zuohe, V.M. Gokhale, X. Hu, L.B. Murata, E.M. Maes, A. Weichsel, D. Sun, E.J. Meuillet, W.R. Montfort, L.H. Hurley, NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III1, Molecular cancer therapeutics, 8 (2009) 1363–1377. [9] H.T. Le, M.C. Miller, R. Buscaglia, W.L. Dean, P.A. Holt, J.B. Chaires, J.O. Trent, Not all G-quadruplexes are created equally: an investigation of the structural polymorphism of the c-Myc G-quadruplex-forming sequence and its interaction with the porphyrin TMPyP4, Organic & biomolecular chemistry, 10 (2012) 9393-9404. [10] D. Sun, In vitro footprinting of promoter regions within supercoiled plasmid DNA, Methods in molecular biology (Clifton, N.J, 613 (2010) 223-233. 16
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
[11] D. Sun, K. Guo, Y.J. Shin, Evidence of the formation of G-quadruplex structures in the promoter region of the human vascular endothelial growth factor gene, Nucleic Acids Res, 39 (2011) 1256-1265. [12] D. Miyoshi, H. Karimata, N. Sugimoto, Hydration regulates thermodynamics of Gquadruplex formation under molecular crowding conditions, J Am Chem Soc, 128 (2006) 7957-7963. [13] C.H. Spink, J.B. Chaires, Effects of hydration, ion release, and excluded volume on the melting of triplex and duplex DNA, Biochemistry, 38 (1999) 496-508. [14] J. Zhou, H. Tateishi-Karimata, J.L. Mergny, M. Cheng, Z. Feng, D. Miyoshi, N. Sugimoto, C. Li, Reevaluation of the stability of G-quadruplex structures under crowding conditions, Biochimie, 121 (2016) 204-208. [15] M.C. Miller, R. Buscaglia, J.B. Chaires, A.N. Lane, J.O. Trent, Hydration Is a Major Determinant of the G-Quadruplex Stability and Conformation of the Human Telomere 3' Sequence of d(AG(3)(TTAG(3))(3)), J Am Chem Soc, (2010). [16] C.V. Dang, K.A. O'Donnell, K.I. Zeller, T. Nguyen, R.C. Osthus, F. Li, The c-Myc target gene network, Seminars in cancer biology, 16 (2006) 253-264. [17] H.J. Chung, D. Levens, c-myc expression: keep the noise down!, Mol Cells, 20 (2005) 157-166. [18] R.N. Eisenman, Deconstructing myc, Genes Dev, 15 (2001) 2023-2030. [19] T.A. Brooks, L.H. Hurley, The role of supercoiling in transcriptional control of MYC and its importance in molecular therapeutics, Nature reviews, 9 (2009) 849-861. [20] A. Siddiqui-Jain, C.L. Grand, D.J. Bearss, L.H. Hurley, Direct evidence for a Gquadruplex in a promoter region and its targeting with a small molecule to repress cMYC transcription, Proc Natl Acad Sci U S A, 99 (2002) 11593-11598. [21] R.K. Morgan, M.M. Molnar, H. Batra, B. Summerford, R.M. Wadkins, T.A. Brooks, Effects of 5-Hydroxymethylcytosine Epigenetic Modification on the Stability and Molecular Recognition of VEGF i-Motif and G-Quadruplex Structures, Journal of nucleic acids, 2018 (2018) 9281286. [22] S. Takahashi, J. Yamamoto, A. Kitamura, M. Kinjo, N. Sugimoto, Characterization of Intracellular Crowding Environments with Topology-Based DNA Quadruplex Sensors, Analytical chemistry, 91 (2019) 2586-2590. [23] A. De Cian, L. Guittat, M. Kaiser, B. Sacca, S. Amrane, A. Bourdoncle, P. Alberti, M.P. Teulade-Fichou, L. Lacroix, J.L. Mergny, Fluorescence-based melting assays for studying quadruplex ligands, Methods (San Diego, Calif, 42 (2007) 183-195. [24] P.V. Boddupally, S. Hahn, C. Beman, B. De, T.A. Brooks, V. Gokhale, L.H. Hurley, Anticancer activity and cellular repression of c-MYC by the G-quadruplex-stabilizing 11piperazinylquindoline is not dependent on direct targeting of the G-quadruplex in the cMYC promoter, Journal of medicinal chemistry, 55 (2012) 6076-6086. [25] A. De Rache, J.L. Mergny, Assessment of selectivity of G-quadruplex ligands via an optimised FRET melting assay, Biochimie, 115 (2015) 194-202. [26] T.M. Ou, Y.J. Lu, C. Zhang, Z.S. Huang, X.D. Wang, J.H. Tan, Y. Chen, D.L. Ma, K.Y. Wong, J.C. Tang, A.S. Chan, L.Q. Gu, Stabilization of G-quadruplex DNA and down-regulation of oncogene c-myc by quindoline derivatives, Journal of medicinal chemistry, 50 (2007) 1465-1474. [27] G. Zhou, X. Liu, Y. Li, S. Xu, C. Ma, X. Wu, Y. Cheng, Z. Yu, G. Zhao, Y. Chen, Telomere targeting with a novel G-quadruplex-interactive ligand BRACO-19 induces T17
Journal Pre-proof
Jo
ur
na
lP
re
-p
ro
of
loop disassembly and telomerase displacement in human glioblastoma cells, Oncotarget, 7 (2016) 14925-14939. [28] R.V. Brown, F.L. Danford, V. Gokhale, L.H. Hurley, T.A. Brooks, Demonstration that drug-targeted down-regulation of MYC in non-Hodgkins lymphoma is directly mediated through the promoter G-quadruplex, J Biol Chem, 286 (2011) 41018-41027. [29] J.H. Zhang, T.D. Chung, K.R. Oldenburg, A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays, J Biomol Screen, 4 (1999) 67-73. [30] D.R. Calabrese, X. Chen, E.C. Leon, S.M. Gaikwad, Z. Phyo, W.M. Hewitt, S. Alden, T.A. Hilimire, F. He, A.M. Michalowski, J.K. Simmons, L.B. Saunders, S. Zhang, D. Connors, K.J. Walters, B.A. Mock, J.S. Schneekloth, Jr., Chemical and structural studies provide a mechanistic basis for recognition of the MYC G-quadruplex, Nature communications, 9 (2018) 4229. [31] K.M. Felsenstein, L.B. Saunders, J.K. Simmons, E. Leon, D.R. Calabrese, S. Zhang, A. Michalowski, P. Gareiss, B.A. Mock, J.S. Schneekloth, Jr., Small Molecule Microarrays Enable the Identification of a Selective, Quadruplex-Binding Inhibitor of MYC Expression, ACS chemical biology, 11 (2016) 139-148. [32] L. Petraccone, A. Malafronte, J. Amato, C. Giancola, G-quadruplexes from human telomeric DNA: how many conformations in PEG containing solutions?, The journal of physical chemistry. B, 116 (2012) 2294-2305. [33] H. Xu, M. Di Antonio, S. McKinney, V. Mathew, B. Ho, N.J. O'Neil, N.D. Santos, J. Silvester, V. Wei, J. Garcia, F. Kabeer, D. Lai, P. Soriano, J. Banath, D.S. Chiu, D. Yap, D.D. Le, F.B. Ye, A. Zhang, K. Thu, J. Soong, S.C. Lin, A.H. Tsai, T. Osako, T. Algara, D.N. Saunders, J. Wong, J. Xian, M.B. Bally, J.D. Brenton, G.W. Brown, S.P. Shah, D. Cescon, T.W. Mak, C. Caldas, P.C. Stirling, P. Hieter, S. Balasubramanian, S. Aparicio, CX-5461 is a DNA G-quadruplex stabilizer with selective lethality in BRCA1/2 deficient tumours, Nature communications, 8 (2017) 14432.
18
Journal Pre-proof Highlights:
of ro -p re lP na
ur
Two or more melting and annealing cycles facilitate select MYC G4 isomer formation Dehydration and molecular crowding mediate physiologically relevant G4 isoforms G4 annealing and co-solvent conditions improve ligand screening in FRET Melt2 assay
Jo
19