G2 checkpoint in uterine cervical cancer with HPV 16 E6 according to p53 polymorphism and its screening value☆

Available online at www.sciencedirect.com R

Gynecologic Oncology 90 (2003) 15–22

www.elsevier.com/locate/ygyno

G2 checkpoint in uterine cervical cancer with HPV 16 E6 according to p53 polymorphism and its screening value夞 Nam Hoon Cho, M.D.,a,* Shin Young Lim,a Young Tae Kim, M.D.,b Dongki Kim, Ph.D.,c Young Sun Kim, Ph.D.,c and Jae Wook Kim, M.D.b a

b

Department of Pathology, Yonsei University College of Medicine, Seoul 120-749, South Korea Department of Obstetric Gynecology, Yonsei University College of Medicine, Seoul 120-749, South Korea c Department of Biostatistics, Yonsei University College of Medicine, Seoul 120-749, South Korea Received 8 February 2002

Abstract Introduction. We aimed to verify not only whether homozygous Arg at codon 72 of the p53 apoptotic domain is a possible risk factor for cervical human papillomavirus (HPV)-related cancer, but whether degraded p53 may have an effect on a G2 checkpoint of the cell cycle. The implication of the codon 72 polymorphism of p53 in cervical tumor remains controversial. Furthermore, G2 checkpoint alteration and its relationship with p53, the codon 72 allotype, according to HPV infection in cervical tumors, has not been studied. Materials and methods. The purified genomic DNA from 252 archival cervical tissues [102 cervical intraepithelial neoplasias (CINs) and 46 squamous cell carcinomas of the uterine cervix (SCCs), and 104 normal] were amplified by nested polymerase chain reaction (PCR) for HPV-16/HPV-18. In addition, all of them were amplified by PCR for exon 4 of p53, where the codon 72 resides. The amplified PCR products were then sequenced using the forward primer. A polymorphism analysis was done by SnaPshot ddNTP primer extension and following direct sequencing. The reaction mixture was treated with 0.25 unit of shrimp alkaline phosphatase (Amersham) at 37°C for 1 h, subsequently performed in an ABI Prism 310 Genetic Analyzer (Perkin-Elmer). The archival slides were incubated overnight at 4°C using mouse anti-human recombinant cyclin B1 polyclonal antibody or mouse anti-Xenopus p34cdc2 monoclonal antibody for immunohistochemistry (Santa Cruz Biotech, Santa Cruz, CA). Results. The frequency of Arg allelic homozygosity was high in both cases (89.1%) and the control (80.8%) group (P ⫽ 0.4703). All groups except CIN were in Hardy-Weinberg equilibrium. There was no significant difference in the frequency of p53 polymorphism between the HPV-positive (Arg, 88.0%) and the negative (Arg, 88.8%) groups, or between CIN (Arg, 88.2%) and SCC (Arg, 89.1%). Both immunoreactivities to cyclin B and p34cdc2 were strongly correlated with the HPV infection (P ⫽ 0.0001) and the histological types (P ⫽ 0.0001) between CIN and SCC, being strongly correlated with each other (␣:0.62954, P ⫽ 0.0001). Conclusion. The particular type of the p53 polymorphism does not bear relation to the progression of cervical cancer, HPV infection, or to the p53 codon 72 polymorphism. However, the G2 checkpoint appears to be altered in the case of a HPV-positive SCC. © 2003 Elsevier Science (USA). All rights reserved. Keywords: p53 polymorphism; G2 checkpoint; Cyclin B1; p34cdc2; SnaPshot

Introduction Since an in vitro study regarding a common p53 polymorphism at codon 72, which encodes either Arg or Pro,

夞 This paper was supported by a Non-Directed Research Fund Korea Research Foundation, 2000 (FP0029). This paper was presented at the meeting of the Korean Society of Biochemistry and Korean Society of Pathologists (2001) and the European Association of Cancer Research (Granada, Spain, 2002). * Corresponding author. Yonsei University College of Medicine, De-

was shown to affect E6-mediated degradation of p53 [1], several ethnic studies have been performed [2–10]. The Arg form of p53 has been associated with an increased risk of human papillomavirus (HPV)-related cancer in humans [1,4], but this observation remains controversial. To examine whether p53 Arg (CGC) or p53 Pro (CCC) at codon 72 partment of Pathology, 134 Snichon-dong, Seodaemoon-gu, Seoul 120749, South Korea. Fax: ⫹82-2-362-0860. E-mail address: [email protected] (N.H. Cho).

0090-8258/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0090-8258(03)00198-7

16

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

could make a difference in the risk factor for HPV-associated cervical carcinomas in the Korean population, we analyzed p53 genotypes of 148 patients with cervical neoplasms and 104 control samples from Korean women, using the Snapshot ddNTP primer extension technique as well as direct sequencing. The p53 gene is usually the wild type in primary cervical carcinomas, indicating that an inactivation of the p53 by HPV E6 probably plays a crucial role in the development of cervical cancer [11–14]. The tumor suppressor gene p53 serves within the checkpoint circuits that regulate cell division. That means to ensure the completion of dependent events in the cell division cycle and provide more time for DNA repair before DNA replication and mitosis [15]. HPV16/18 E6 protein binds to the cellular tumor suppressor gene p53 and induces its degradation through the ubiquitin pathway [11,13,14,16]. In turn, the G2 checkpoint as well as a G1 checkpoint may be disrupted in the case of HPV-16/18 E6, and furthermore, some in vitro studies support this hypothesis [17–21]. Unlike G1 arrest, however, the effect on the G2 checkpoint in HPV 16 E6 oncoprotein infection is still questionable. To explore the effect of the p53 polymorphism at codon 72 on a G2 checkpoint, we analyzed G2 checkpoint activity as an index of G2 delay by estimation of immunoreactive signals of cyclin B1/p34cdc2 complex localized in nuclei apart from cytoplasm. Furthermore, we compared those findings with the infection status of HPV-16/18 E6 or p53 polymorphism.

Materials and methods Tissue specimens A total of 148 cervical tumor tissues, including 102 that were cervical intraepithelial neoplasias (CINs) and 46 that were squamous cell carcinoma of the uterine cervix (SCC), as well as 104 normal cervical tissues, were obtained from 252 patients who underwent surgery in the Department of Gynecology, Yonsei University College of Medicine, Seoul, Korea, between 1997 and 1999. The histopathological diagnosis was decided on the basis of CIN criteria. DNA was extracted from the well-separated normal tissue from the lesion, which was reserved for p53 polymorphism analysis. DNA extracted from the lesion was amplified followed by the manual microdissection method for HPV typing. DNA extraction was performed by the phenol chloroform protocol, as has been previously described. HPV detection and typing The purified genomic DNA was amplified by using nested polymerase chain reaction (PCR) for HPV-16 and

HPV-18. The oligodeoxynucleotide primers were as follows: The outer primer: forward (FW) ACCGAAAACGGTTGAACCG AAAACGGT, reverse (RV) AATAATGTCTATATTCACTAATT, inner primer for HPV 16 E6, FW ATGTTTCA GGACCCACAGGA, RV CCTCACGTCGCAGTAACTGT, for HPV 18 E6, FW ATGGCGCGCTTT GAGGATCC, RV GCATGCGGTATACTGTCTCT. P53 polymorphism analysis Purified genomic DNA was amplified by PCR from exon 4 of p53, using oligonucleotide primers as follows: FW TGAGGACCTGGTCCTCGG, RV AGAGGAATCCCAAAGTTCCA. The amplified PCR products were then sequenced by using the forward primer. After checking with the polymorphism of either Arg or Pro in codon 72, a SnaPshot ddNTP primer extension kit was used to analyze the polymorphism in this study. The SnaPshot primer of p53 was ATGCCAGAGGCTGCTCCCC. The reaction mixture 10 ␮l (SnaPshot premix 1␮l, SnaPshot primer 1 ␮l, template 1 ␮l, sequence buffer 4 ␮l) was amplifed (25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 30 s) and it was then treated with 0.25 unit of shrimp alkaline phosphatase (Amersham) at 37°C for an hour. The enzyme was deactivated by incubating at 72°C for 15 min. The runs were performed in an ABI Prism 310 Genetic Analyzer (PerkinElmer). Immunoblot analysis Cells (HeLa) and a fresh-frozen cervical cancer tissue were lysed in a lysis buffer (0.1 M NaCl, 0.01 M Tris, 0.01 M EDTA, 1% Triton X-100, 1 ␮g/ml aprotinin, 100 ␮g/ml phenylmethylsulfunyl fluoride) passed through a 25-gauge needle 10 times, and were kept cool on ice for 30 min. The samples with an equal protein content (approximately 100 ␮g) were analyzed by sodium dodecyl sulfate-polyaerylamide gel electrophoresis on 12% gel and transferred to a PVDF membrane (Bio-Rad). After blocking nonspecific binding sites by incubating in 5% Carnation nonfat dry milk (in 10 mM Tris-HCl, pH 7.5, 2.5 mM EDTA, 50 mM NaCl, 0.1% Tween 20) the membrane was hybridized overnight at 37°C with the primary antibody, which was anti-p34cdc2 (clone 17; Santa Cruz Biotech, Santa Cruz, CA) and cyclin B1 (clone H-433; Santa Cruz, CA). After washing and subsequent incubation with horseradish peroxidase-conjugated sheep anti-mouse antibody (Amersham), proteins were detected by the enhanced chemiluminescence system (Amersham). Immunohistochemical analysis Three-micrometer-thick sections were placed onto saline-coated slides, deparaffinized, immersed in phosphatebuffered saline (PBS) with 0.3% (vol/vol) hydrogen peroxide, and subjected to a microwave oven treatment (10

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

17

Fig. 1. A high correspondence between direct sequencing and SnaPshot analysis. A specified allele sequence of codon 72 was represented. The first peak is essentially representative in SnaPshot sequence analysis. Upper lane: CCC (Pro/Pro); Mid: CNC (Arg/Pro); Lower: CGC (Arg/Arg)

mmol/L sodium citrate buffer, pH 6.5, for 15 min at 700 W).After blocking with 1% (wt/vol) bovine serum albumin in PBS containing 0.05% (vol/vol) Tween 20 for 30 min, the slides were incubated overnight at 4°C with a mouse antihuman recombinant cyclin B1 polyclonal antibody (clone H-433; Santa Cruz, CA) or a mouse anti-Xenopus p34cdc2 monoclonal antibody (clone 17; Santa Cruz, CA), that is known to react with the human homologue. The immunoperoxidase staining was performed by using the streptavidin-biotin peroxidase complex method (LSAB universal kit, Dako, Carpinteria, CA). In the negative control, the antibodies were replaced by equivalent amounts of the subtypematched normal mouse IgG. The final reaction product was visualized after a 0.03% (wt/vol) 3,3⬘-diaminobenzidine tetrachloride for 5–20 min. Statistical analysis The odds ratio (OR) with a 95% confidence intervals (CI) were calculated to examine the strength and precision of the statistical associations between the homozygous p53Arg genotype and the lesion risk. The ␹2 tests were carried out to examine differences in the proportions of the three p53 codon 72 genotypes between the cervical patients and the controls using the SAS program. The observed genotype frequencies were compared with the expected genotype frequencies (calculated on the basis of the observed allelic frequencies), assuming a Hardy-Weinberg equilibrium. Departures from the Hardy-Weinberg equilib-

rium were tested by using a goodness-of-fit ␹2 test. An analysis of variance test was carried out to evaluate cyclin B1/p34cdc2 according to p53 genotypes or the histological subtypes.

Results In the control group, four of them (3.85%) had HPV-16. In the cancer group, HPV-16 or HPV-18 DNA sequences were observed in 50 cases [28 (27.5%) CINs and 22 (47.8%) SCCs]. The relative risk ratio of CIN and SCC in case of HPV infection is 9 times and 23 times higher than in the control group, respectively [CIN vs. control OR, 9.4595 (95% CI, 3.1807–28.1328), SCC vs. control OR, 22.9167 (95% CI, 7.2217–72.7215)]. The SnaPshot ddNTP primer extension as well as direct sequencing were used to analyze p53 genotypes specifically to detect either the Arg or the Pro allele. Analysis of the p53 polymorphism at codon 72 by SnaPshot ddNTP and corresponding direct sequencing are shown in Fig. 1. Both methods were highly concordant. The p53 genotypes and the allele frequencies in patients and controls, as well as the distribution of HPV status and cancer histiotypes, are calculated in Table 1. The frequency of Arg homozygosity was found to be comparatively high, and ranged from 80.8% (84 of 104) in the control group to 89.1% (41 of 46) in the SCC group. The relative risk of CIN and SCC in Arg/Arg indi-

18

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

Table 1 Genotypes and allelic frequencies in 148 patients and 104 healthy controls

Control (n ⫽ 104) CIN (n ⫽ 102) SCC (n ⫽ 46)

HPV HPV HPV HPV HPV HPV

(⫹) (⫺) (⫹) (⫺) (⫹) (⫺)

(n (n (n (n (n (n

⫽ ⫽ ⫽ ⫽ ⫽ ⫽

4) 100) 28) 74) 22) 24)

Arg/Arg (%)

Pro/Arg (%)

Pro/Pro (%)

H-W (P)a

Odds ratio (Arg.Pro/Pro.Pro) (95% CI)c

2 (50.0) 82 (82.0) 25 (89.3) 65 (87.8) 19 (86.4) 22 (91.7)

2 (50.0) 12 (12.0) 2 (7.1) 6 (8.1) 0 2 (8.3)

0 6 (6.0) 1 (3.6) 3 (4.1) 3 (13.6) 0

0.83385b 0.000012 0.0135 0.00009 0 0.83497b

Reference group 1.8750/1.6071 (0.7486–4.6963/0.4382–5.8950) 3.4167/0.9762 (0.7413–5.7465/0.2324–4.1011)

a

CI, confidence interval; HPV, human papillomavirus; CIN, ; SCC,. No deviation from Hardy-Weinberg (H-W) equilibrium in these groups. c Odds ratio and 95% CI computed for Arg/Arg vs. Arg/Pro and Pro/Pro, respectively. b

viduals appeared to be high, but statistically insignificant. There was a difference in the frequency of Arg homozygosity between the HPV-infected and noninfected group. No deviations from expectations using Hardy-Weinberg assumptions were observed in the CIN group, but not in the control and cervical carcinoma group. Both of cyclin B1 and p34cdc2 were proven to be specific when they were applied to the HeLa cell line and freshfrozen cervical carcinoma tissue by Western blot (Fig. 2). Both cyclin B1 and p34cdc2 showed colocalization in the nucleus and the cytoplasm according to the mitotic phase. Whereas both antibodies were restricted to the suprabasal layer of the normal squamous epithelium (Fig. 3A), and spread to the entire epithelium in CIN (Fig. 3B and C) and along the frontal invading margin in SCC (Fig. 3D) and in adenocarcinoma (Fig. 3E). The nuclear expression of cyclin B1 correlates with that of p34cdc2 (␣ ⫽ 0.62954, P ⫽ 0.0001) in both CIN and SCC. None of G2 checkpoint molecules showed correlation with an allelic difference of

p53 (Table 2). The immunoreactivity of cyclin B1 and p34cdc2 was significantly higher not only in HPV-positive cases than in HPV-negative cases (Table 3; P ⫽ 0.0001), but also in SCC than CIN (Table 4; P ⫽ 0.0001).

Discussion A recent study [1] gives new insight into the mechanism of cervical carcinogenesis, by demonstrating that individuals who have Arg alleles at codon 72 of p53 are presdisposed to have a HPV-associated cervical cancer compared with those who have Pro alleles. This suggests that not only the presence of an HPV infection but also a structural difference in the p53 locus, at least in part, may be an important factor to consider for the process of cervical carcinogenesis. The overall Arg homozygosity frequency as determined ranged from 31.7% to 78.6%, whereas the Pro homozygosity frequency ranged from 0% to 19.4% [2–10].

Fig. 2. Immunoblot result of polyclonal cyclin B1 and monoclonal p34Cdc2. p34Cdc2 was marked approximately at 34.7 kDa, whereas cyclin B1 was specific at 50.1 kDa. The left lane in each gel was applied to the HeLa cell line, and the right one was a human cervical cancer tissue. The ␣-tubulin was used as an internal control. Notice immunoreactive signals of both antibodies in nuclei as well as in cytoplasm of cervical tumor tissue.

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

19

Fig. 3. Distribution of G2 checkpoint molecules in cervical lesions. (A) Both antibodies were restricted to the suprabasal layer of the normal squamous epithelium. (B) They spread to the entire epithelium according to the CIN grade. Low squamous intraepithelial lesion, so-called CIN I. (C) High-grade intraepithelial lesion, CIN II to III. (D) Areas along the frontal invading margin in SCC were the most intense. (E) Adenocaricnoma also showed intense immunoreactivities to both antibodies.

As summarized in Table 5, almost all surveys, except the study of Zehbe, did not find any correlation between Arg homozygosity and cancer. We identified that the Arg homozygosity frequency in Korean women is higher (82– 87.9%) than the frequencies that have been reported in other ethnic surveys. Although this is not correlated with cervical cancer, it is noticeable that the high frequency of Arg in Korean women appears to be associated with the higher frequency of cervical cancer in Korea than in other countries. The previous studies had failed to identify a significant association between the p53 genotype and invasive carci-

noma occurring in different countries argues against these variants as having a strong influence. Further analysis of the relationship between the “allelic distribution frequency” and the “grade” or “stage” of each type of cancer or “HPV infection” did not show a statistically significant difference. Thus, to use this polymorphism in the estimation of tumor progression may be of little value. To detect polymorphism of p53 at codon 72, several different methods have been adopted, such as direct sequencing, RFLP, and PCR-SSCP (Table 5). We utilized a novel method of SnaPshot ddNTP detection [22–25] and

Table 2 Cyclin B and p34Cdc2 in CIN and SCC according to p53 polymorphism

Cyclin B (n ⫽ 148)

Nc (⬎5) Cyto (⬎5)

p34Cdc2 (n ⫽ 148)

Nc (⬎5) Cyto (⬎15)

a

OR means the value for A/A.

HPV HPV HPV HPV HPV HPV HPV HPV

(⫹) (⫺) (⫹) (⫺) (⫹) (⫺) (⫹) (⫺)

A/A

A/P

P/P

ORa

P value

19 (86.4) 46 (86.8) 21 (87.5) 43 (93.5) 35 (85.4) 28 (87.5) 30 (88.2) 40 (93.0)

1 (4.6) 5 (9.4) 1 (4.2) 1 (2.2) 5 (12.2) 1 (3.1) 1 (2.9) 3 (7.0)

2 (9.0) 2 (3.8) 2 (8.3) 2 (4.3) 1 (2.4) 3 (9.4) 3 (8.8) 0 (0)

1.9286 (1.1906–19.5125)

N.S.

0.5111 (0.0306–8.5493)

N.S.

0.2500 (0.0276–2.2649)

N.S.

0.4444 (0.044–4.4873)

N.S.

20

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

Table 3 Cyclin B/p34Cdc2 expression in CIN and SCC according to HPV p34Cdc2

Cyclin B Nc HPV 16 (⫹) HPV 16 (⫺)

Cyto

26.4 ⫾ 3.9 8.2 ⫾ 1.2

a

Nc

14.7 ⫾ 2.5 7.0 ⫾ 1.0

a

Cyto

18.9 ⫾ 2.9 5.6 ⫾ 0.9

a

35.2 ⫾ 3.9a 9.6 ⫾ 1.3

a Means statistically significant difference by less than 0.05 between two groups.

subsequently performed direct sequencing. It starts with PCR amplification of a short stretch of genomic DNA including an exon of a gene containing an SNP. Allelespecific products are generated by using a special primer to bind to one base ahead of the SNP site, with a conditioned set of fluorescently labeled ddNTPs, and ampliTaq DNA polymerase in a primer extension reaction. Residual primers or dNTPs or unincorporated ddNTPs were digested by using shrimp alkaline phosphatase (SAP). Compared with direct sequencing, this novel method was perfectly equivalent. This is a valid method to enhance the efficiency and to reduce the labor and time for an effortless analysis of known SNPs. Transformed cells expressing HPV-16 or HPV-18 E6 lost their G1 checkpoint activity very early, presumably because of the degradation of p53 [11–15]. They are also resistant to p53-induced growth arrest and apoptosis as a result of DNA damage [16]. However, it remains arbitrary whether the G2/M checkpoint is altered when p53 is degraded by HPV-16 E6 infection [17–21]. In the present study, we found that a key to G2 gate, cyclin B/ p34Cdc2, is significantly increased in HPV-16 or 18 positive cervical lesions including CIN and SCC in comparison with HPV-16 or 18 negative normal lesions, which is consistent with several in vitro studies [19 –21]. The alteration of the cyclin B/p34Cdc2 complex by HPV-16 E6 is implicated in this loss of genomic stability. Thomas and Laimins [20] also suggested that both E6 and E7 independently contribute to genomic instability at the mitotic checkpoint. P53 interacts with the promotor of p34Cdc2 and cyclin B1 and downregulates their expression via the CCAAT-binding NF-Y transcription factor [26]. A downregulating effect on the expression of both cdc2 and cyclin B1 mRNA and protein with a concomitant decrease of p34Cdc2 activity could be clearly attributed to a functional p53 [27]. Now, the mechanism by which p53 blocks cells at the G2 checkpoint has been clarified to inhibit p34Cdc2 via binding to the codon 330 –339 of p34Cdc2 [28], where a domain is simultaneously regulated by GADD45, p21, and 14-3-3 [29]. The G2 checkpoint is initially unaffected [17], but there is an increased chromosomal instability in E6-expressing cells over time, and this appears to be caused by the attenuation of the G2 checkpoint function [18]. Despite no significance between the p34Cdc2/cyclin B complex immunoreactivity and the p53 polymorphism at the 72 codon, the

significant alteration of G2 checkpoint molecules by HPV-16 E6 may show a relation to the ablation of a p53regulated G2/M checkpoint. Nonetheless, we found that a high expression of p34Cdc2/cyclin B in p53 non-Arg/Arg polymorphism patients tends to be more related to a relative lower risk than p53 72 codon Arg/Arg, although this is not significant probably because of the small number of the p53 72 codon A/P and P/P populations. The cyclin B/p34Cdc2 complex shuttles between the nucleus and cytoplasm throughout the G2/M phase, and their activities are dependent upon their localization [30 –34]. We identified that the cyclin B/p34Cdc2 complex is increased in each immunoreactivity expression in the cytoplasm as well as in the nucleus. During prophase, the interphase microtubule network disassembles and begins to rearrange itself into a mitotic spindle [33]. The localization of human cyclin B1 into microtubules before their nuclear relocalization [31,32] suggests that cyclin B1/p34Cdc2 is the principal mitotic cyclin/cdc2 complex that is involved in changing microtubule dynamics at the G2/M stage. At the beginning of mitosis, cyclin B/p34Cdc2 is alone in the nuclei, so this complex could participate in nuclear events during G2/M transition. Based on the nuclear and cytoplasmic shuttling of cyclin B1/p34Cdc2, nuclear labeling index was estimated as an active form. While an inactive complex before the metaphase is present exclusively in the cytoplasm, in association with cytoskeleton, part of the complex moves to the nucleus to condense the chromatins upon activation following transition to anaphase [33]. As a matter of fact, we identified that the G2 complex is restricted to the chromatin in a number of mitotic cells. As soon as cells transit to the anaphase, the complex is destined to be disappeared by the ubiquitin proteolytic enzyme, which involves p34Cdc2 dephosphorylation and leads to M phase termination [30,33– 35]. When this complex is inappropriately abundant in tumor cells, however, those fail to lead to M phase termination, which represent G2 delay [30,34]. We observed that the complex regarding the G2/M phase is significantly increased in the protein level when it is infected by HPV-16 E6, irrespective of disease status. In conclusion, the G2 checkpoint appears to be impaired especially in the case of a HPV-positive SCC, although our findings do not support the hypothesis that the p53 polymorphism is important in determining the susceptibility of

Table 4 Cyclin B1/p34Cdc2 between CIN and SCC p34Cdc2

Cyclin B1

CIN (n ⫽ 102) SCC (n ⫽ 46)

Nc

Cyto

Nc

Cyto

14.8 ⫾ 2.0 33.3 ⫾ ⫺4.1a

11.5 ⫾ 1.6 21.8 ⫾ 2.8a

9.8 ⫾ 1.4 24.6 ⫾ 3.3a

17.9 ⫾ 2.1 42.9 ⫾ 3.7a

a Means statistically significant difference by less than 0.05 between two groups.

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

21

Table 5 Comparative review of p53 polymorphism in several ethnicity

Storey [1] Helland [2] Josefsson [3] Zehbe [4] Yamashita [5] Tenti [6] Agorastos [7] Malcom [8] Madeleine [9] Kawaguchi [10] Cho

A (%)

A/P

P

a

76% 57% 54% 73% 37% 53% 67% 46% 56% 49% 78%

17% 30% 38% 23% 58% 34% 25% 44% 38% 25% 14%

7% 13% 8% 3% 5% 12.5% 8% 10% 6% 25% 8%

30 77 488 84 320 64 58 373 111 75 148

n

b

H-W

nt NS NS nt nt NS NS nt nt nt NS

Method

Ethnicity

RFLP RFLP RFLP SSCP RFLP RFLP RFLP RFLP RFLP sequencing SSddNTP/sequencing

UK Norway Sweden Sweden JPN Italy Greek US US JPN KOR

a

n, number of squamous cell carcinoma cases; bH-W, Hardy-Weinberg equilibrium test; nt, not tested; NS, not statistically significant; RFLP, restriction fragment length polymorphism; SSCP, single-strand conformational polymorphism; UK, United Kingdom; JPN, Japan; US, United States of America; KOR, Korea.

an individual either to infection with HPV or to the development of a cervical neoplasia.

References [1] Storey A, Thomas M, Kalita A, Harwood C, Gardiol D, Mantovani F, et al. Role of a p53 polymorphism in the development of human papillomavirus-associated cancer. Nature 1998;393:229 –34. [2] Helland A, Langerod A, Johnsen H, Oslen AO, Skovlund E, Borresen-Dale A. p53 polymorphism and risk of cervical cancer. Nature 1998;396:530 –3. [3] Josefsson AM, Magnusson PKE, Ylitalo N, Quarforth-Tubbin P, Ponten J, Adami HO, et al. P53 polymorphism and risk of cervical cancer. Nature 1998;396:531. [4] Zehbe I, Voglino G, Wilander E, Genta F, Tommasino M. Codon 72 polymorphism of p53 and its association with cervical cancer. Lancet 1999;354:218 –20. [5] Yamashita T, Yaginuma Y, Saitoh Y, Kawai K, Kurakane T, Hayashi H, et al. Codon 72 polymorphism of p53 as a risk factor for patients with human papillomavirus-associate squamous intraepithelial lesions and invasive cancer of the uterine cervix. Carcinogenesis 1999; 20:1733– 6. [6] Tenti P, Vesentini N, Spaudo MR, Zappatore R, Migliora P, Carnevali L, et al. P53 codon 72 polymorphism does not affect the risk of cervical cancer in patients from Northern Italy. Cancer Epidemiol Biomarkers Prev 2000;9:435– 8. [7] Agarastos T, Lambropoulos AF, Constantinidis TC, Kotsis A, Bontis JN. p53 codon 72 polymorphism and risk of intra-epithelial and invasive cervical neoplasia in Greek women. Eur J Cancer Prev 2000;9:113– 8. [8] Malcom EK, Baber GB, Boyd JC, Stoler MH. Polymorphism at codon 72 of p53 is not associated with cervical cancer risk. Mod Pathol 2000;13:373– 8. [9] Maldeleine MM, Shera K, Schwartz SM, Daling JR, Galloway DA, Wipf GC, et al. The P53 Arg72Pro polymorphism, human papillomavirus, and invasive squamous cell cervical cancer. Cancer Epidemiol Biomarkers Prev 2000;9:225–7. [10] Kawaguchi H, Ohno S, Araki K, Miyazaki M, Saeki H, Watanabe M, et al. P53 polymorphism in human papillomavirus-associated esophageal cancer. Cancer Res 2000;60:2753–5. [11] Turek LP, Smith EM. The genetic program of genital human papilomaviruss in infection and cancer. Obstet Gynecol Clin North Am 1996;23:735–58.

[12] Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 1997;88:323–31. [13] Albrechtsen N, Dornreiter I, Grosse F, Kim E, Wiesmuller L, Deppert W. Maintenance of genomic integrity by p53: complementary roles for activated and non-activated p53. Oncogene 1999;18:7706 –17. [14] Thomas M, Pim D, Banks L. The role of the E6-p53 interaction in the molecular pathogenesis of HPV. Oncogene 1999;18:7690 – 700. [15] Dulic V, Kaufmann WK, Wilson SJ, Tlsty TD, Lees E, Harper JW, et al. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell 1994;76: 1013–23. [16] Ishiwatari H, Hayasaka N, Inoue H, Yutsudo M, Hakura A. Degradation of p53 only is not sufficient for the growth stimulatory effect of human papillomavirus 16 E6 oncoprotein in human embryonic fibroblasts. J Med Virol 1994;44:243–9. [17] Paules R, Levedakaou E, Wilson S, Innes C, Rhodes N, Tlsty T, et al. Defective G2 checkpoint function in cells from individuals with familial cancer syndromes. Cancer Res 1995;55:1763–73. [18] White A, Livanos E, Tlsty T. Differential disruption of genomic integrity and cell cycle regulation in normal human fibroblasts by the HPV oncoproteins. Genes Dev 1994;8:666 –77. [19] Thompson DA, Belinsky G, Chang TH, Jones DL, Schlegel R, Munger K. The human papillomavirus-16 E6 oncoprotein decreases the vigilance of mitotic checkpoints. Oncogene 1997;15: 3025–35. [20] Thomas JT, Laimins LA. Human papillomavirus oncoproteins E6 and E7 independently abrogate the mitotic spindle checkpoint. J Virol 1998;72:1131–7. [21] Katich SC, Zerfass-Thome K, Hoffmann I. Regulation of the cdc25A gene by the human papillomavirus type 16 E7 oncogene. Oncogene 2001;20:543–50. [22] Morley JM, Bark JE, Evans CE, Perry JG, Hett CA, Tully G. Validation of mitochondrial DNA minisequencing for forensic casework. Int J Legal Med 1999;112:2410 – 8. [23] Syvanen AC. From gels to chips: “minisequencing” primer extension for analysis of point mutations and single nucleotide polymorphisms. Hum Mutat 1999;13:1–10. [24] Chen J, Iannone MA, Li M-S, Taylor JD, Rivers P, Nelsen AJ, et al. A microsphere-based assay for multiplexed single nucleotide polymorphism analysis using single base chain extension. Genome Res 2000;10:549 –57. [25] Sauer S, Lechner D, Berlin K, Lehrach H, Escary J-L, Fox N, et al. A novel procedure for efficient genotyping of single nucleotide polymorphisms. Nucleic Acids Res 2000;28:E13–E13.

22

N.H. Cho et al. / Gynecologic Oncology 90 (2003) 15–22

[26] Manni I, Mazzaro G, Gurtner A, Mantovani R, Haugwitz U, KrauseK, et al. NF-Y mediates the transcriptional inhibition of the cyclin B1, cyclin B2, and cdc25C promoters upon induced G2 arrest. J Biol Chem 2001;276:5570 – 6. [27] Ababneh M, Gotz C, Montenarh M. Downregulation of the cdc2/ cyclin B protein kinase activity by binding of p53 to p34. Biochem Biophys Res Commun 2001;283:507–12. [28] Wagner P, Fuchs A, Nastainczyk W, Gotz C, Montenarh M. Fine mapping and regulation of the association of p53 and p34cdc2. Oncogene 1998;16:105–11. [29] Taylor WR, Stark GR. Regulation of the G2/M transition by p53. Oncogene 2001;20:1803–15. [30] Bailly E, Doree MPN, Bornens M. p34 is located in both nucleus and cytoplasm: part is centrosomally associated at G2/M and enters vesicles at anaphase. EMBO J 1989;8:3989 –95.

[31] Pines J, Hunter Y. Cyclin A and B1 are differentially located in the cell and undergo cell cycle-dependent nuclear transport. J Cell Biol 1991;115:1–17. [32] Jackman M, Firth M, Pines J. Human cyclin B1 and B2 are localized to strikingly different structures: B1 to microtubules, B2 primarily to the Golgi apparatus. EMBO J 1995;14:1646 –54. [33] Jackman MR, Pines JN. Cyclins and the G2/M transition. Cancer Surv 1997;29:47–73. [34] Kawamoto H, Koizumi H, Uchikoshi T. Expression of the G2-M checkpoint regulators cyclin B1 and cdc2 in nonmalignant and malignant human breast lesions. Am J Pathol 1997;150: 15–23. [35] Murray AW, Solomon MJ, Kirschner MW. The role of cyclin synthesis and degradation in the control of maturation promoting factor activity. Nature 1989;339:280 –5.