GABA-Induced GnRH Release Triggers Chordate Metamorphosis

Report

GABA-Induced GnRH Release Triggers Chordate Metamorphosis Graphical Abstract

Authors Akiko Hozumi, Shohei Matsunobu, Kaoru Mita, ..., Keisuke Sakurai, Honoo Satake, Yasunori Sasakura

Correspondence [email protected]

In Brief Metamorphosis is a dramatic body change in metazoans that allows the use of different ecological niches. Hozumi et al. show that GABA is a key regulator of metamorphosis in the ascidian Ciona. During this process, GABA, generally thought of as an inhibitory neurotransmitter, positively regulates secretion of the neuropeptide GnRH.

Highlights d

The neurotransmitter GABA is a key regulator of Ciona metamorphosis

d

Gonadotropin-releasing hormone (GnRH) is the downstream neuropeptide of GABA

d

GABA positively regulates secretion of GnRH through the metabotropic GABA receptor

Hozumi et al., 2020, Current Biology 30, 1555–1561 April 20, 2020 ª 2020 Elsevier Ltd. https://doi.org/10.1016/j.cub.2020.02.003

Current Biology

Report GABA-Induced GnRH Release Triggers Chordate Metamorphosis Akiko Hozumi,1,7 Shohei Matsunobu,1,7 Kaoru Mita,1 Nicholas Treen,1,8 Takaho Sugihara,2 Takeo Horie,1 Tetsushi Sakuma,3 Takashi Yamamoto,3 Akira Shiraishi,4 Mayuko Hamada,5 Noriyuki Satoh,6 Keisuke Sakurai,2 Honoo Satake,4 and Yasunori Sasakura1,9,* 1Shimoda

Marine Research Center, University of Tsukuba, Shizuoka 415-0025, Japan of Biology, Graduate School of Life and Environmental Sciences, University of Tsukuba, Ibaraki 305-8572, Japan 3Division of Integrated Sciences for Life, Graduate School of Integrated Sciences for Life, Hiroshima University, Hiroshima 739-8526, Japan 4Bioorganic Research Institute, Suntory Foundation for Life Sciences, Kyoto 619-0284, Japan 5Ushimado Marine Institute, Okayama University, Okayama 701-4303, Japan 6Marine Genomics Unit, Okinawa Institute of Science and Technology Graduate University, Okinawa 904-0495, Japan 7These authors contributed equally 8Present address: Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544, USA 9Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.cub.2020.02.003 2Department

SUMMARY

Metamorphosis, a widespread life history strategy in metazoans, allows dispersal and use of different ecological niches through a dramatic body change from a larval stage [1, 2]. Despite its conservation and importance, the molecular mechanisms underlying its initiation and progression have been characterized in only a few animal models. In this study, through pharmacological and gene functional analyses, we identified neurotransmitters responsible for metamorphosis of the ascidian Ciona. Ciona metamorphosis converts swimming tadpole larvae into vase-like, sessile adults. Here, we show that the neurotransmitter GABA is a key regulator of metamorphosis. We found that gonadotropin-releasing hormone (GnRH) is a downstream neuropeptide of GABA. Although GABA is generally thought of as an inhibitory neurotransmitter, we found that it positively regulates secretion of GnRH through the metabotropic GABA receptor during Ciona metamorphosis. GnRH is necessary for reproductive maturation in vertebrates, and GABA is an important excitatory regulator of GnRH in the hypothalamus during puberty [3, 4]. Our findings reveal another role of the GABA-GnRH axis in the regulation of post-embryonic development in chordates. RESULTS AND DISCUSSION Tunicates are the closest living relatives of vertebrates [5]. Ascidians, the largest group of tunicates, exhibit typical metamorphosis [6, 7]. Ascidian metamorphosis is triggered upon adhesion to a substrate by the adhesive papillae (Figure 1A) [6, 8]. Once the process initiates, adhered larvae start to regress their tail into a trunk (Figure 1A). This event is followed by the growth

of adult organs, which are primordia at the larval stage. Tail regression and adult organ growth are triggered by distinct pathways, both of which are downstream of adhesion [9]. Ascidian larvae are reproductively immature, and their reproductive maturation, including formation of gonads, commences after metamorphosis [10]. Adhesive papillae, the essential organ for sensing the adhesion stimulus [6, 9], is composed of sensory neurons sandwiched between collocytes and axiocolumnar cells [11]. The sensory neurons of the adhesive papillae project axons toward posterior tissues [12]. These observations, along with pharmacological analyses [13, 14], suggest that the nervous system plays a crucial role in triggering ascidian metamorphosis; however, the neurotransmitters that control ascidian metamorphosis remain elusive. We addressed this issue by investigating molecules that are responsible for the regulation of metamorphosis of the model ascidian Ciona intestinalis Type A, recently proposed to be Ciona robusta [15]. We treated Ciona larvae with neurotransmitters and observed whether metamorphosis was induced or not. In this experiment, a portion of the larval tail was amputated to suppress locomotion and subsequent adhesion. Because ascidian larvae do not initiate metamorphosis without settlement, tail-amputated control larvae exhibit a greatly reduced rate of metamorphosis [8, 16]. GABA bypassed adhesion to induce tail regression, whereas glutamate and glycine did not (Figures 1B–1F). Carbachol, a stable agonist of acetylcholine, only weakly induced metamorphosis (Figures 1D and 1F). The requirement for GABA was supported by experiments in which the genes responsible for the function of GABAergic transmission were knocked down with antisense morpholino oligonucleotides (MOs) [17]. Disruption of the genes encoding glutamate decarboxylase (GAD, which is a GABA synthase) [18, 19] and vesicular inhibitory amino acid transporter (VIAAT) [20, 21] decreased the frequency of tail-regressed animals (Figures 1G–1N), even though the larvae underwent settlement. These phenocopies of metamorphosis failure were partially rescued by administering GABA to MO-introduced animals (Figures 1I–1N). Another inhibitory neurotransmitter, glycine, weakly rescued the phenocopy in

Current Biology 30, 1555–1561, April 20, 2020 ª 2020 Elsevier Ltd. 1555

A

Adhesive papilla

Swimming larva

Trunk

Tail regression

Tail

Adult organ growth

Juvenile

Regressed tail

Gill En Heart

+GABA

+Glycine

C

Administration

F

n.s. p=0.038 n.s. ****

80.5% tail regressed (n=108) 24.7% tail regressed (n=121) +Carbachol (acetylcholine) E D

+Glutamate

% tail regression

Neurotransmitter Administration

B

St

100

n=121 5 rep.

n=144 6 rep. n=108 4 rep.

50

n=91 4 rep. n=132 4 rep.

0

26.3% (n=91)

17.4% (n=132)

G

H

No GABA Glycine Carba Glut treatment

GAD knockdown

K

*** ****

87.5% (n=248)

Uninjected control 7.9% (n=214)

Gene knockdown

GAD MO

J

I

% tail regression

****

100

50

n=248 4 rep.

n=147 4 rep. n=149 4 rep.

n=214 4 rep.

0

51.0% (n=147)

GAD MO + GABA 21.4% (n=149)

M

L

Control GAD MO GAD MO GAD MO +GABA +glycine

GAD MO + Glycine

O

VIAAT knockdown n.s. ****

VIAAT MO 64.0% (n=200)

VIAAT MO + GABA

P

N

% tail regression

****

30.5% (n=331)

100

50

0

35.0% (n=191)

VIAAT MO + Glycine 94.0% (n=152)

Control MO

n=343 6 rep.

n=191 5 rep.

n=331 6 rep. n=200 5 rep.

Control VIAAT MO VIAAT MO VIAAT MO +GABA +glycine

Figure 1. GABA Is Necessary for Ciona Metamorphosis (A) Schematics of Ciona metamorphosis. Left: swimming larva; middle: juvenile that completed tail regression 2 days post-fertilization (2 dpf); right: juvenile with developed adult organs. En, endostyle; St, stomach. (B–F) Effects of neurotransmitters on tail regression. All photographs were taken at 2 dpf. In this and subsequent figures, the score of tail-regressed (metamorphosed) animals among experimental animals is shown in each panel. (B) GABA-treated juvenile. (C) Glycine-treated larva. (D) Carbachol-treataed larva. (E) Glutamate-treated larva. (F) Effect of neurotransmitter treatment on the percentage of tail-regressed larvae (y axis), shown as box-and-whisker plots. Boxes show means ± standard error of each treatment. n.s., not significant (p > 0.05); ****p < 0.0001 (chi-square test). n, number of examined larvae in total. ‘‘rep’’ represents the number of experiment replicates. Carba, carbachol; Glut, glutamate. (G–P) GABA transmission is necessary for metamorphosis. All photographs were taken at 2 dpf. (legend continued on next page)

1556 Current Biology 30, 1555–1561, April 20, 2020

A Nerve cord (NC) Motor ganglion (MG)

Adhesive papillae

Brain

B gnrh1 (green)

Brain

MG

GABABR2 (magenta)

NC

100% (n=5 larvae) overlapped expression observed

C gnrh2 (green)

merge

GABABR2 (magenta)

merge

NC Brain

MG

100% (n=3 larvae) overlapped expression observed Figure 2. GnRH Neurons Express GABA B Receptor (A) Schematic illustration of the larval nervous system. (B) A larva electroporated with gnrh1 > Kaede and GABABR2 > H2B::mCherry constructs. MG, motor ganglion; NC, nerve cord. Images are confocal slices of a single plane. mCherry, which marks expression of GABABR2, can be seen in the posterior part of the brain and motor ganglion. Kaede and mCherry doublepositive cells are indicated by arrows. (C) Larva electroporated with gnrh2 > Kaede and GABABR2 > H2B::mCherry constructs. See also Figures S1, S2, and S3.

the GAD knockdown (Figures 1J and 1K). However, the rescue score of glycine was much smaller than that of GABA, and glycine did not significantly rescue VIAAT morphants (Figures 1N and 1O), supporting the idea that GABA is an important contributor to metamorphosis. The control MO did not disrupt metamorphosis (Figure 1P), confirming that inhibition of metamorphosis by GAD/VIAAT MOs was sequence specific. GABA receptors are divided into two classes, namely, ionotropic (A receptor) and metabotropic (B receptor), both of which are encoded in the Ciona genome [19, 22–24]. Upon disruption of GABABR1, which encodes a B receptor subunit, initiation of metamorphosis was strongly suppressed (Figure S1). In contrast, disruption of GABAARa, which encodes a GABA A receptor subunit, only weakly disrupted metamorphosis, and the other GABA A receptor gene, GABAARb, did not have any disruptive effect (Figure S1). These results suggest that the metabotropic GABA receptor is responsible for tail regression. The GABA B receptor functions as a heterodimer of two subunits [25, 26]. Ciona has two genes that encode a GABA B

receptor subunit, namely, GABABR1 and GABABR2 [19, 24]. These genes exhibit very similar expression patterns in the sensory vesicle and motor ganglion, although GABABR2 is expressed in a narrower region [19]. These expression domains overlap with the localization of cholinergic neurons [21, 27]. Because acetylcholine is not the main neurotransmitter that initiates tail regression (Figures 1D and 1F), GABA-B-receptor-positive neurons are likely to use a different molecule for initiating tail regression upon receiving GABA. Because multiple neuropeptide-coding genes are expressed in the Ciona nervous system [28], we focused on neuropeptides as candidate downstream molecules of the GABA B receptor. Prohormone convertase 2 (PC2) is a protease necessary for the maturation of neuropeptides [29, 30]. Knockout or knockdown of the gene encoding PC2 resulted in a failure of tail regression (Figures S2A–S2F). At 3 days post-fertilization, PC2-disrupted larvae exhibited growth of the trunk without tail regression (Figures S2C and S2D). This morphological characteristic resembled the phenotype of the tail regression failed (trf) mutant (Figure S2G), which

(G) Uninjected control juvenile. (H) GAD-knockdown settled larva injected with antisense MO specific for this gene. (I) GAD-knockdown settled juvenile treated with GABA. (J) GAD-knockdown settled larva treated with glycine (as a negative control for the rescue experiment). (K) Effect of GAD knockdown on the percentage of tail-regressed larvae. n.s., not significant (p > 0.05); ***p < 0.001; ****p < 0.0001 (chi-square test). (L) VIAAT-knockdown larva. (M) VIAAT-knockdown and GABA-treated juvenile that completed tail regression. (N) VIAAT-knockdown and glycine-treated larva. (O) Effect of VIAAT knockdown on the percentage of tail-regressed larvae, shown as box-and-whisker plots. (P) Juvenile injected with control MO, showing no effect on metamorphosis. See also Figures S1 and S4.

Current Biology 30, 1555–1561, April 20, 2020 1557

A

90.3% (n=488) B

22.7% (n=329) E

gnrh2 knockdown p=0.013 p=0.022 ****

C

Uninjected 15.2% (n=301) D

gnrh2 MO 31.7% (n=321)

% tail regression

100

50

n=488 6 rep.

n=329 6 rep.

n=321 4 rep. n=301 4 rep.

0

gnrh2 MO + control peptide

gnrh2 MO + GnRH

Control gnrh2 MO gnrh2 MO gnrh2 MO +control pep +GnRH

F

gnrh2 knockout with TALEN 100% (n=11)

G

CTTCCTTCTAACAACGAGGAGCGGCGTCAGCATTGGTCTTATGCTTTATC

M T C

wt (0)

CTTCCTTCTAACAACGAGGAGC---------ATTGGTCTTATGCTTTATC (4) CTTCCTTCTAACAACGAGGAGC----------TTGGTCTTATGCTTTATC (1) CTTCCTTCTAACAACGAGG-------TCAGCATTGGTCTTATGCTTTATC (1) CTTCCTTCTAACAACGAGGAGC------AGCATTGGTCTTATGCTTTATC (1) CTTCCTTCTAACAACGAGGAGCGGC------ATTGGTCTTATGCTTTATC (4) H

89.0% (n=402) I

59.3% (n=278)

gnrh2 knockout

J

Uninjected

gnrh2 TALEN

% tail regression

****

100

50

n=278 9 rep. n=402 9 rep.

0 Control

gnrh2 TALEN

Figure 3. GnRH Is Necessary for Metamorphosis (A) Uninjected control juvenile at 2 dpf. (B) gnrh2 knockdown larva at 2 dpf. (C) gnrh2 knockdown larva treated with control peptide (LF5) [16]. (D) gnrh2 knockdown juvenile treated with t-GnRH4/7/8; this animal completed tail regression. (E) Effects of gnrh2 knockdown on the percentage of tail-regressed larvae, shown as box-and-whisker plots. (F) Examples of sequenced mutations introduced into the target site of gnrh2 using a TALEN pair specific for this gene. ‘‘-’’ indicates deletion of nucleotides. TALEN binding sites are highlighted in blue. wt, wild-type sequence. Number at right indicates the number of clones that appeared in the sequencing experiment. (G) Gel image of heteroduplex mobility shift assay showing the presence of heterogeneous (mutated) DNA sequence (bracket) in the amplified gnrh2 amplicon derived from larvae in which gnrh2 TALEN expression constructs were introduced at the 1-cell stage. C, control lane without mutated gnrh2; M, marker; T, TALEN injected. (H) Uninjected control juvenile. (I) gnrh2 knockout larva. (J) Effects of gnrh2 knockout on the percentage of tail-regressed larvae, shown as box-and-whisker plots. See also Figures S2, S3, and S4 and Table S1.

we previously reported as a recessive mutant defective in initiation of tail regression [9]. The similarity suggests that PC2 is the causative gene for the trf phenotype. Indeed, our mapping analyses suggested that PC2 is in close vicinity to the trf locus (Figure S2H). Microarray analyses revealed that the expression of PC2 decreased in trf mutants relative to their wild-type siblings (average log10 ratio =
0.52; gene ID CIYS9573 in Table S1). Furthermore, a PC2 mutant allele generated with PC2 TALENs 1558 Current Biology 30, 1555–1561, April 20, 2020

could not complement trf mutation (Figures S2G–S2J). Based on these results, we concluded that PC2 is the causative gene for the trf phenotype, suggesting that maturation of neuropeptides is necessary for tail regression. Previously, we showed that the neuropeptide gonadotropinreleasing hormone (GnRH) can induce tail regression when administered to Ciona larvae [16]. The gnrh1 and gnrh2 genes, each encoding several GnRH peptides, are both expressed in

Papilla neurons GABA neurons GABABR-positive GnRH neurons

Tail cells expressing GnRH receptors

1. Papilla neurons activate GABA neurons upon adhesion

2. GABA ( ) activates GnRH neurons via B receptor

3. GnRH ( ) activates tail regression

4. GABA activates adult organ growth at the trunk

Figure 4. GABA-GnRH Signaling Triggers Metamorphosis of Ciona Schematic illustration of a larva and metamorphic events are shown. Blue, red, and orange ovals indicate the positions of papilla neurons, GABA neurons, and GABABR-positive GnRH neurons, respectively, as reported previously [12, 21] and in this study. The central nervous system is highlighted in yellow.

the larval CNS, even though Ciona larvae are in a sexually immature state [31]. Their reported expression domains seem to overlap with those of the GABABR genes. To determine whether GnRH neurons express the GABA B receptor, we carried out reporter analyses [31]. We isolated the cis elements of gnrh1, gnrh2, and GABABR2 (which has a more restricted expression zone than GABABR1), fused them with reporter genes, and electroporated the reporter constructs into Ciona embryos. Some gnrh-reporter-expressing neurons expressed the reporter gene, recapitulating the pattern of the GABA B receptor gene (Figure 2), indicating that GABA transmission could directly regulate GnRH neurons. To further examine the requirement for GnRH in metamorphosis, we performed MO-mediated knock down of gnrh2, which encodes t-GnRH4/7/8 peptides. Knockdown of gnrh2 decreased the rate of tail regression (Figures 3A–3E). The tail regression properties of gnrh2 morphants could be ameliorated by administration of the GnRH peptide, albeit not very efficiently (Figures 3D and 3E). Therefore, to confirm the specificity of the antisense MO, we knocked out gnrh2 by genome editing. The resultant gnrh2 knockout larvae exhibited a failure of tail regression (Figures 3F–3J). We also knocked out gnrh1, which encodes t-GnRH3/5/6 peptides, with three pairs of TALENs that target different sites within the gene. Although the effects were moderate, all three knockouts exhibited a reduction in the metamorphosis rate (Figure S3), supporting the notion that GnRHs are required for Ciona metamorphosis. The results described above suggest that GABA signaling induces GnRH secretion to initiate Ciona metamorphosis. To confirm the epistatic order of GABA and GnRH transmission during metamorphosis, we carried out the following experiments. We attempted to rescue tail regression in GABABR1 and PC2 morphants by treatment with GABA. In contrast to GAD and VIAAT morphants, which were effectively rescued by GABA (Figures 1I and 1M), neither GABABR1 nor PC2 morphants could be rescued efficiently by GABA (Figure S4), suggesting that GABABR1 and PC2 act downstream of, or in parallel to, GABA in the pathway initiating tail regression. GnRH treatment ameliorated the failure of tail regression in GABABR1 knockdowns (Figures S4D and S4G), confirming that GnRH acts downstream of GABA signaling. Larvae lacking neuropeptide activity, represented by PC2/trf mutants, failed to initiate tail regression but still exhibited adult organ growth after settlement (Figures S2D–S2G) [9], suggesting that matured neuropeptides are not necessary for the initiation of

adult organ growth. Like PC2/trf mutants, gnrh2 and gnrh1 knockdown/knockout larvae exhibited adult organ growth (Figures S4I–S4K). In contrast, larvae in which GABA signaling was disrupted, even if they were cultured until 3 days post-fertilization (dpf), did not exhibit adult organ growth after settlement (Figures S4L and S4M). This suggests that GABA secretion is crucial for the initiation of all metamorphic events and that promotion of GnRH secretion and subsequent tail regression are among other downstream events. We showed here that the GABA-GnRH pathway is responsible for Ciona metamorphosis (Figure 4). As in Ciona, GABA positively regulates metamorphosis in mollusks [32] and sea urchins [33, 34], suggesting that GABA is a conserved molecule involved in animal metamorphosis. In Ciona, mollusks, and sea urchins, metamorphosis converts planktonic larvae into benthos. This drastic alteration of lifestyle requires the animals to switch from larval to post-larval behavior. As a classic inhibitory neurotransmitter, GABA is a strong candidate to stop larval swimming; however, our results indicate that GABA also positively regulates GnRH release to induce metamorphosis. In vertebrates, excitatory GABA function is observed in the neonatal brain [35]. Moreover, in the hypothalamus, GABA is an important excitatory regulator of GnRH neurons [36, 37]. Although both ionotropic and metabotropic GABA receptors are used in the regulation of GnRH neurons in the hypothalamus [37, 38], excitation by GABA in vertebrates is achieved by its ionotropic receptors, taking advantage of the fact that the concentration of chloride is higher inside the cell than in the extracellular fluid [39]. The excitatory GABA in Ciona metamorphosis is distinct from vertebrate systems in that it uses metabotropic receptors. Future characterization of the molecular mechanisms of the GABA-GnRH pathway in Ciona will reveal how metabotropic GABA receptors achieve excitation of GnRH neurons and how GnRHs induce the cellular changes that are necessary for tail regression. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Husbandry and housing conditions of experimental animals METHOD DETAILS B Constructs B Genome editing and gene knockdowns B Microinjection and electroporation and pharmacological treatments B Mutants B Microarray analysis QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. cub.2020.02.003.

Current Biology 30, 1555–1561, April 20, 2020 1559

ACKNOWLEDGMENTS This work was supported by grants from the MEXT and JSPS, Japan (nos. 16H04815, 15K14520, and 19H03262). We thank Atsuo Nishino, Junko Nishino, Aya Sakamoto, Ryusuke Niwa, and Yoshitaka Oka for their helpful discussion for constructing this manuscript. We are grateful to Shigeki Fujiwara, Manabu Yoshida, Yutaka Satou, Chikako Imaizumi, Reiko Yoshida, Satoe Aratake, all members of the Department of Zoology of Kyoto University, the Misaki Marine Biological Station of the University of Tokyo, and the Maizuru Fishery Research Station of Kyoto University for cultivation and provision of wildtype Ciona adults. AUTHOR CONTRIBUTIONS A.H., S.M., K.M., and Y.S. designed the study. A.H., S.M., and K.M. performed most experiments with help from N.T., T.H., and T. Sugihara. A.S., H.S., K.S., Y.S., N.T., T.H., T. Sakuma, and T.Y. assisted with gene knockouts. A.S., M.H., N.S., and H.S. analyzed gene expression profiles. Y.S. wrote the manuscript with the aid of A.H., N.T., S.M., K.M., T.H., M.H., and K.S. DECLARATION OF INTERESTS The authors declare no competing interests. Received: July 29, 2019 Revised: December 14, 2019 Accepted: February 3, 2020 Published: March 26, 2020 REFERENCES 1. Gilbert, S.F. (2006). Developmental Biology, Eighth Edition (Sinauer Associates). 2. Holstein, T.W., and Laudet, V. (2014). Life-history evolution: at the origins of metamorphosis. Curr. Biol. 24, R159–R161. 3. DeFazio, R.A., Heger, S., Ojeda, S.R., and Moenter, S.M. (2002). Activation of A-type gamma-aminobutyric acid receptors excites gonadotropin-releasing hormone neurons. Mol. Endocrinol. 16, 2872–2891. 4. Han, S.K., Abraham, I.M., and Herbison, A.E. (2002). Effect of GABA on GnRH neurons switches from depolarization to hyperpolarization at puberty in the female mouse. Endocrinology 143, 1459–1466. 5. Delsuc, F., Brinkmann, H., Chourrout, D., and Philippe, H. (2006). Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature 439, 965–968.

14. Kimura, Y., Yoshida, M., and Morisawa, M. (2003). Interaction between noradrenaline or adrenaline and the b 1-adrenergic receptor in the nervous system triggers early metamorphosis of larvae in the ascidian, Ciona savignyi. Dev. Biol. 258, 129–140. 15. Pennati, R., Ficetola, G.F., Brunetti, R., Caicci, F., Gasparini, F., Griggio, F., Sato, A., Stach, T., Kaul-Strehlow, S., Gissi, C., and Manni, L. (2015). Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS One 10, e0122879. 16. Kamiya, C., Ohta, N., Ogura, Y., Yoshida, K., Horie, T., Kusakabe, T.G., Satake, H., and Sasakura, Y. (2014). Nonreproductive role of gonadotropin-releasing hormone in the control of ascidian metamorphosis. Dev. Dyn. 243, 1524–1535. 17. Satou, Y., Imai, K.S., and Satoh, N. (2001). Action of morpholinos in Ciona embryos. Genesis 30, 103–106. 18. Varju, P., Katarova, Z., Madara´sz, E., and Szabo´, G. (2001). GABA signalling during development: new data and old questions. Cell Tissue Res. 305, 239–246. 19. Zega, G., Biggiogero, M., Groppelli, S., Candiani, S., Oliveri, D., Parodi, M., Pestarino, M., De Bernardi, F., and Pennati, R. (2008). Developmental expression of glutamic acid decarboxylase and of gamma-aminobutyric acid type B receptors in the ascidian Ciona intestinalis. J. Comp. Neurol. 506, 489–505. 20. Scimemi, A. (2014). Structure, function, and plasticity of GABA transporters. Front. Cell. Neurosci. 8, 161. 21. Horie, T., Nakagawa, M., Sasakura, Y., Kusakabe, T.G., and Tsuda, M. (2010). Simple motor system of the ascidian larva: neuronal complex comprising putative cholinergic and GABAergic/glycinergic neurons. Zool. Sci. 27, 181–190. 22. Frangaj, A., and Fan, Q.R. (2018). Structural biology of GABAB receptor. Neuropharmacology 136, 68–79. 23. Chua, H.C., and Chebib, M. (2017). GABAA Receptors and the Diversity in their Structure and Pharmacology. Adv. Pharmacol. 79, 1–34. 24. Okamura, Y., Nishino, A., Murata, Y., Nakajo, K., Iwasaki, H., Ohtsuka, Y., Tanaka-Kunishima, M., Takahashi, N., Hara, Y., Yoshida, T., et al. (2005). Comprehensive analysis of the ascidian genome reveals novel insights into the molecular evolution of ion channel genes. Physiol. Genomics 22, 269–282. 25. Kammerer, R.A., Frank, S., Schulthess, T., Landwehr, R., Lustig, A., and Engel, J. (1999). Heterodimerization of a functional GABAB receptor is mediated by parallel coiled-coil alpha-helices. Biochemistry 38, 13263– 13269.

6. Cloney, R.A. (1982). Ascidian larvae and the events of metamorphosis. Am. Zool. 22, 817–826.

26. Kuner, R., Ko¨hr, G., Gru¨newald, S., Eisenhardt, G., Bach, A., and Kornau, H.C. (1999). Role of heteromer formation in GABAB receptor function. Science 283, 74–77.

7. Karaiskou, A., Swalla, B.J., Sasakura, Y., and Chambon, J.P. (2015). Metamorphosis in solitary ascidians. Genesis 53, 34–47.

27. Stolfi, A., and Levine, M. (2011). Neuronal subtype specification in the spinal cord of a protovertebrate. Development 138, 995–1004.

8. Matsunobu, S., and Sasakura, Y. (2015). Time course for tail regression during metamorphosis of the ascidian Ciona intestinalis. Dev. Biol. 405, 71–81.

28. Hamada, M., Shimozono, N., Ohta, N., Satou, Y., Horie, T., Kawada, T., Satake, H., Sasakura, Y., and Satoh, N. (2011). Expression of neuropeptide- and hormone-encoding genes in the Ciona intestinalis larval brain. Dev. Biol. 352, 202–214.

9. Nakayama-Ishimura, A., Chambon, J.P., Horie, T., Satoh, N., and Sasakura, Y. (2009). Delineating metamorphic pathways in the ascidian Ciona intestinalis. Dev. Biol. 326, 357–367. 10. Okada, T., and Yamamoto, M. (1999). Differentiation of the gonad rudiment into ovary and testis in the solitary ascidian, Ciona intestinalis. Dev. Growth Differ. 41, 759–768. 11. Zeng, F., Wunderer, J., Salvenmoser, W., Hess, M.W., Ladurner, P., and €cher, U. (2019). Papillae revisited and the nature of the adhesive Rothba secreting collocytes. Dev. Biol. 448, 183–198. 12. Takamura, K. (1998). Nervous network in larvae of the ascidian Ciona intestinalis. Dev. Genes Evol. 208, 1–8. 13. Coniglio, L., Morale, A., Angelini, C., and Falugi, C. (1998). Cholinergic activation of settlement in Ciona intestinalis metamorphosing larvae. J. Exp. Zool. 280, 314–320.

1560 Current Biology 30, 1555–1561, April 20, 2020

29. Steiner, D.F. (1998). The proprotein convertases. Curr. Opin. Chem. Biol. 2, 31–39. 30. Sekiguchi, T., Kawashima, T., Satou, Y., and Satoh, N. (2007). Further EST analysis of endocrine genes that are preferentially expressed in the neural complex of Ciona intestinalis: receptor and enzyme genes associated with endocrine system in the neural complex. Gen. Comp. Endocrinol. 150, 233–245. 31. Kusakabe, T.G., Sakai, T., Aoyama, M., Kitajima, Y., Miyamoto, Y., Takigawa, T., Daido, Y., Fujiwara, K., Terashima, Y., Sugiuchi, Y., et al. (2012). A conserved non-reproductive GnRH system in chordates. PLoS One 7, e41955. 32. Garcia-Lavandeira, M., Silva, A., Abad, M., Pazos, A.J., Sanchez, J.L., and Perez-Paralle, L. (2005). Effect of GABA and epinephrine on the settlement

and metamorphosis of the larvae of four species of bivalve molluscs. J. Exp. Mar. Biol. Ecol. 316, 149–156. 33. Pearce, C.M., and Scheibling, R.E. (1990). Induction of metamorphosis of larvae of the green sea urchin, Strongylocentrotus droebachiensis, by Coralline red algae. Biol. Bull. 179, 304–311. 34. Rahmani, M.A., and Ueharai, T. (2001). Induction of metamorphosis and substratum preference in four sympatric and closely related species of sea urchins (Genus Echinometra) in Okinawa. Zool. Stud. 40, 29–43. 35. Ben-Ari, Y. (2002). Excitatory actions of gaba during development: the nature of the nurture. Nat. Rev. Neurosci. 3, 728–739. 36. Herbison, A.E., and Moenter, S.M. (2011). Depolarising and hyperpolarising actions of GABA(A) receptor activation on gonadotrophinreleasing hormone neurones: towards an emerging consensus. J. Neuroendocrinol. 23, 557–569. 37. Watanabe, M., Fukuda, A., and Nabekura, J. (2014). The role of GABA in the regulation of GnRH neurons. Front. Neurosci. 8, 387. 38. Zhang, C., Bosch, M.A., Rønnekleiv, O.K., and Kelly, M.J. (2009). Gammaaminobutyric acid B receptor mediated inhibition of gonadotropin-releasing hormone neurons is suppressed by kisspeptin-G protein-coupled receptor 54 signaling. Endocrinology 150, 2388–2394. 39. Ben-Ari, Y. (2014). The GABA excitatory/inhibitory developmental sequence: a personal journey. Neuroscience 279, 187–219. 40. Sakuma, T., Ochiai, H., Kaneko, T., Mashimo, T., Tokumasu, D., Sakane, Y., Suzuki, K., Miyamoto, T., Sakamoto, N., Matsuura, S., and Yamamoto, T. (2013). Repeating pattern of non-RVD variations in DNA-binding modules enhances TALEN activity. Sci. Rep. 3, 3379. 41. R Core Team (2018). R: A language and environment for statistical computing (R Foundation for Statistical Computing). 42. Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A., Somia, N.V., Bogdanove, A.J., and Voytas, D.F. (2011). Efficient design and assembly of custom TALEN and other TAL effectorbased constructs for DNA targeting. Nucleic Acids Res. 39, e82. 43. Hozumi, A., Kawai, N., Yoshida, R., Ogura, Y., Ohta, N., Satake, H., Satoh, N., and Sasakura, Y. (2010). Efficient transposition of a single Minos transposon copy in the genome of the ascidian Ciona intestinalis with a transgenic line expressing transposase in eggs. Dev. Dyn. 239, 1076–1088.

44. Ogura, Y., Sakaue-Sawano, A., Nakagawa, M., Satoh, N., Miyawaki, A., and Sasakura, Y. (2011). Coordination of mitosis and morphogenesis: role of a prolonged G2 phase during chordate neurulation. Development 138, 577–587. 45. Sasakura, Y., Suzuki, M.M., Hozumi, A., Inaba, K., and Satoh, N. (2010). Maternal factor-mediated epigenetic gene silencing in the ascidian Ciona intestinalis. Mol. Genet. Genomics 283, 99–110. 46. Treen, N., Yoshida, K., Sakuma, T., Sasaki, H., Kawai, N., Yamamoto, T., and Sasakura, Y. (2014). Tissue-specific and ubiquitous gene knockouts by TALEN electroporation provide new approaches to investigating gene function in Ciona. Development 141, 481–487. 47. Kawai, N., Ochiai, H., Sakuma, T., Yamada, L., Sawada, H., Yamamoto, T., and Sasakura, Y. (2012). Efficient targeted mutagenesis of the chordate Ciona intestinalis genome with zinc-finger nucleases. Dev. Growth Differ. 54, 535–545. 48. Ota, S., Hisano, Y., Muraki, M., Hoshijima, K., Dahlem, T.J., Grunwald, D.J., Okada, Y., and Kawahara, A. (2013). Efficient identification of TALEN-mediated genome modifications using heteroduplex mobility assays. Genes Cells 18, 450–458. 49. Yoshida, K., Treen, N., Hozumi, A., Sakuma, T., Yamamoto, T., and Sasakura, Y. (2014). Germ cell mutations of the ascidian Ciona intestinalis with TALE nucleases. Genesis 52, 431–439. 50. Yoshida, K., and Treen, N. (2018). TALEN-Based Knockout System. Adv. Exp. Med. Biol. 1029, 131–139. 51. Kobayashi, K., and Satou, Y. (2018). Microinjection of Exogenous Nucleic Acids into Eggs: Ciona Species. Adv. Exp. Med. Biol. 1029, 5–13. 52. Corbo, J.C., Levine, M., and Zeller, R.W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development 124, 589–602. 53. Nakatani, Y., Moody, R., and Smith, W.C. (1999). Mutations affecting tail and notochord development in the ascidian Ciona savignyi. Development 126, 3293–3301. 54. Yoshida, K., Hozumi, A., Treen, N., Sakuma, T., Yamamoto, T., ShiraeKurabayashi, M., and Sasakura, Y. (2017). Germ cell regenerationmediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells. Dev. Biol. 423, 111–125.

Current Biology 30, 1555–1561, April 20, 2020 1561

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Actinase E from Streptomyces griseus

Kaken-Seiyaku

Cat#650133

Sodium Thioglycolate

Wako

Cat#192-03552

Sodium Thioglycolate

Sigma

Cat#T0632-25G

PrimeStar HS DNA Polymerase

Takara Bio

Cat#R010B

Takara Ex Taq Hot Start Version

Takara Bio

Cat#RR006B

BamHI

Takara Bio

Cat#1010A

BglII

Takara Bio

Cat#1021A

XhoI

Takara Bio

Cat#1094A

SalI

Takara Bio

Cat#1080A

BsaI-HF

Takara Bio

Cat#R3535S

Esp3I

Fermentas

Cat#ER0452

m7G(50 )ppp(50 )G RNA Cap Structure Analog

New England Biolabs (NEB)

Cat#S1404L

Fast Green FCF

Wako

Cat#061-00031

D-(-)-Mannitol

Nacalai Tesque

Cat#21303-45

Chemicals, Peptides, and Recombinant Proteins

4-Aminobutyric Acid

Wako

Cat#010-02441

Glycine

Wako

Cat#077-00735

L-Glutamic Acid

Wako

Cat#070-00502

Sodium L(+)-Glutamate Monohydrate

Wako

Cat#194-02032

Carbamylcholine Chloride

Wako

Cat#036-09841

Critical Commercial Assays Surveyor Nuclease Kit

Transgenomics

Cat#706025

In-Fusion HD Cloning Kit

Clontech

Cat#639648

Quick Ligation Kit

NEB

Cat#M2200S

MEGAscript T3 Transcription Kit

Thermofisher Scientific

Cat#AM1338

Poly(A) Tailing Kit

Thermofisher Scientific

Cat#AM1350

Wizard Genomic DNA Purification Kit

Promega

Cat#A1120

Quick Amp Labeling Kit

Agilent Technologies

Cat#5190-0444

C. intestinalis Custom Microarray

Agilent Technologies

GEO: GPL5576

Gene Expression Hybridization Kit

Agilent Technologies

Cat#5188-5242

This paper

GEO: GSE124672

Wild type Ciona intestinalis (Pacific species, also designated Ciona robusta)

National BioResource Project Japan (NBRP)

N/A

tail regression failed

NBRP

N/A

GAD MO: acctccaagccgattgtttctgcat

Gene Tools

N/A

VIAAT MO: atattgcagccatacttaacagaagg

Gene Tools

N/A

gnrh2 MO: acgtcattgttacgttatctctcta

Gene Tools

N/A

GABABR1 MO: gcttacgactttacataaccttaca

Gene Tools

N/A

PC2 MO: gttgtctgccattcaaataaaatgc

Gene Tools

N/A

Control MO: cctcttacctcagttacaatttata

Gene Tools

N/A

Deposited Data Microarray data for trf mutants Experimental Models: Organisms/Strains

Oligonucleotides Table S2 for PCR primers

(Continued on next page)

e1 Current Biology 30, 1555–1561.e1–e4, April 20, 2020

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Recombinant DNA pHTB-TALEN-NG::2A::mCherry

NBRP

N/A

pHTB-TALEN-NG

NBRP

N/A

pEF1a > TALEN-NG::2A::mCherry

NBRP

N/A

pEF1a > TALEN-NI::2A::mCherry

NBRP

N/A

pEF1a > TALEN-NN::2A::mCherry

NBRP

N/A

pEF1a > TALEN-HD::2A::mCherry

NBRP

N/A

pTnI > TALEN-NG::2A::mCherry

NBRP

N/A

pSP-Kaede

NBRP

N/A

pSPCiEpi1H2BmCherry

NBRP

N/A

pBluescript SKII (+)

Stratagene

N/A

pGEM-T Easy Vector

Promega

Cat#A1360

Platinum Gate TALEN Kit

[40]

AddGene #1000000043

[41]

https://cran.r-project.org/bin/ windows/base/

GAD

Ghost database

Gene model: KH.S761.6

VIAAT

Ghost database

Gene model: KH.C2.526

GABABR1

Ghost database

Gene model: KH.L22.28

GABABR2

Ghost database

Gene model not characterized

GABAARa

Ghost database

Gene model not characterized

GABAARb

Ghost database

Gene model: KH.C9.860

PC2

Ghost database

Gene model: KH.L128.2

gnrh1

Ghost database

Gene model: KH.S1051.1

gnrh2

Ghost database

Gene model: KH.C9.484

Software and Algorithms R-3.6.1 for Windows Other

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yasunori Sasakura ([email protected]). Plasmids and mutant lines generated in this study will be deposited to the National BioResource Project, Japan (https://marinebio.nbrp.jp/ciona/). EXPERIMENTAL MODEL AND SUBJECT DETAILS Husbandry and housing conditions of experimental animals Wild-type C. intestinalis (the Pacific species also designated Ciona robusta) individuals derived from Onagawa Bay (Miyagi, Japan) and Onahama Bay (Fukushima, Japan) were cultivated as closed colonies by the National BioResource Project, Japan. They were kept under a constant light condition to avoid untimely spawning. Eggs and sperm were surgically collected from gonadal ducts. All procedures involving live animals were performed at 18 C. After dechorionation, eggs and embryos were cultured in gelatin coated plastic plates. METHOD DETAILS Constructs TALENs were assembled using the four-module Golden Gate method [40, 42]. The plasmids with a single TALE repeat and pFUS2 plasmids were digested with BsaI-HF (New England Biolabs) and ligated using a Quick Ligation kit (New England Biolabs) to make three- or four-module assembled plasmids. The assembled plasmids and a plasmid containing the partial cDNA regions encoding N- and C-termini of the TALENs were digested with Esp3I (Fermentas) and ligated using a Quick Ligation kit to make fully assembled TALENs. The cis elements of gnrh1 and gnrh2 reported previously [31] were PCR-amplified with primer pairs 50 -cgactctagaggatcctg taacacacgcatgttgtac-30 / 50 -ggccgcaaggggatccttgtgaagttggataagcgattg-30 and 50 -cgactctagaggatccaggagcagacgtcataagtag-30 / 50 -ggccgcaaggggatcctgttacgttatctctctagaag-30 . The cis element and genomic region encoding the first intron of GABABR2 [19] Current Biology 30, 1555–1561.e1–e4, April 20, 2020 e2

were PCR-amplified with primer pairs 50 -cgactctagaggatccttaccagagtactgtactttg-30 / 50 -ggccgcaaggggatccataggttgtgggtgatattcg-30 and 50 -agcggccatcagatctaagagaacctgttctgttaa-30 / 50 -ggagaccggcagatctgtgaaaatacagttttgtaatag-30 . These PCR fragments were inserted into the BamHI or BglII restriction sites of pSP-Kaede and pSPCiEpiIH2BmCherry [43, 44] by In-Fusion cloning (Clontech). Genome editing and gene knockdowns TALENs were driven by the EF1a cis element, which expresses genes in the ubiquitous manner [45, 46]. Approximately 50–100 animals that expressed high levels of mCherry (which monitors expression of TALENs) were selected. Genomic DNA was isolated using the Wizard genomic DNA purification kit (Promega). The genomic region including the target site of introduced TALENs was amplified by PCR with Ex Taq Hot Start Version (Takara Bio), and the PCR fragment was analyzed by the surveyor nuclease assay [47] or heteroduplex mobility shift assay [48] to determine the heterogeneity of the sequence, which reflects the presence of a mutated gene. The PCR bands were subcloned into a conventional vector, and sequences of some clones were determined. The TALEN assemblies that exhibited relatively high mutation rates were subcloned into pHTB-TALEN or pHTB-TALEN::2A::mCherry vectors by the In Fusion cloning for in vitro transcription of mRNAs [49, 50]. The vectors for mRNA synthesis were digested with XhoI. After phenol-chloroform extraction, they were subjected to in vitro mRNA synthesis with a MEGAscript T3 Transcription kit (Thermofisher Scientific) using a 50 -cap structure analog (New England Biolabs) and a Poly(A) Tailing kit (Thermofisher Scientific). The antisense morpholino oligonucleotides (MOs) were purchased from Gene Tools. The sequence of MOs are as follows: GABABR1 MO, 50 -gcttacgactttacataaccttaca-30 ; GAD MO, 50 -acctccaagccgattgtttctgcat-30 ; gnrh2 MO, 50 -acgtcattgttacgttatctctcta-30 ; PC2 MO, 50 -gttgtctgccattcaaataaaatgc-30 ; VIAAT MO, 50 -atattgcagccatacttaacagaagg-30 ; control MO, 50 -cctcttacctcagttacaatttata-30 . Microinjection and electroporation and pharmacological treatments Microinjection of TALEN mRNAs and MOs was performed as described previously [17, 49, 51]. The concentrations of mRNAs and MOs in the injection media (2 mg/ml Fast Green) were 1,000 ng/ml and 0.5 mM, respectively. The volume of media microinjected was estimated to be one fourth of the diameter of the eggs by observing the green color of the media. Injected larvae were collected in a new plate filled with seawater and allowed to initiate metamorphosis. The occurrence of tail regression was observed at 2 days after fertilization, at a time when control had animals usually completed tail regression [8]. Images were acquired on a Carl Zeiss Axio Imager Z1. Electroporation was carried out as previously described [52]. Dechorionated fertilized eggs were washed with seawater ten times diluted with 0.77 M D-(-)-Mannitol (Mannitol-SW). 30 mg of Kaede and mCherry expressing vectors were mixed with eggs in Mannitol-SW, and then simultaneously subjected to electroporation at 52 V for 20 ms. Confocal images were acquired on a Carl Zeiss Axio Observer.Z1 and LSM700. For pharmacological treatment, part of the larval tail was cut away, for two reasons. First, it promoted absorption of chemicals into the larval body. Second, in the pharmacological treatments in which we examined the inductive effect of a neurotransmitter on Ciona metamorphosis, we needed to prevent larval adhesion, because adhered larvae complete metamorphosis quickly, preventing us from distinguishing whether the occurrence of metamorphosis was the consequence of the effect of a chemical or adhesion. Accordingly, a portion of the larval tail was amputated to suppress locomotion and subsequent adhesion [8]. Because ascidian larvae do not initiate metamorphosis without settlement, tail-amputated control larvae exhibit a greatly reduced rate of metamorphosis [16]. Tail-amputated larvae preserve the capability to complete metamorphosis when a sufficient adhesion stimulus is administered to their adhesive papillae [16], suggesting that tail amputation does not influence metamorphosis process per se. Neurotransmitters and neuropeptides were dissolved in seawater at concentrations of 0.7 mM and 20 mM, respectively. Neuropeptides were synthesized in vitro using an ABI 430A solid-phase peptide synthesizer (Life Technologies). Mutants A tail regression failed (trf) heterozygous mutant at a reproductive stage was subjected to dark-light induced spawning. Collected eggs and sperm mixtures were kept for approximately 30 min to promote fertilization [53] to obtain progeny including homozygous trf mutants (Figure S2). At 2 or 3 days after fertilization, individual animals with trf phenotypes were collected in 50 mL TE containing 20 mg/ml Proteinase K, and incubated for 3 hours at 50 C. After inactivating Proteinase K by incubating for 15 min at 95 C, the solution was used for PCR analyses to examine the genotypes of the chromosome marker sites. Primer sets used for PCR were as follows: 10P-4, 50 -atggaaattctcatgtgctg-30 and 50 -gattgtttgggattttggag-30 ; 10P-10, 50 -tcatatcgggagatggataa-30 and 50 -actgttggtttaactggatcac-30 ; 10q-4, 50 -aaacacccatgaagagtgaa-30 and 50 -cgttctcattcaagcaattc-30 ; 10q-14, 50 -taggcatcaacattcacaca-30 and 50 -gcgaatagcatcgacataac-30 . PCR-amplified DNAs were sequenced after purification. The PC2 mutant was generated by the germ cell regeneration method by expressing PC2 TALEN pairs from the TnI promoter [54]. Tails of larvae into which the TALEN plasmids were electroporated were cut to remove primordial germ cells. The tail-amputated larvae were cultured until reproductively mature stages. Eggs and sperm of the G0 animals (G0 is TALEN construct-introduced generation) were collected and used for self-fertilization or for crossing with a heterozygous trf mutant for the cis/trans test. Microarray analysis Gene expression of trf mutants was examined by microarray analysis of two-color detection using two biological replicates [28]. Swimming larvae with trf/trf phenotypes were collected at 42 hours post fertilization. As controls with normal phenotype, swimming larvae and juveniles were obtained from the same batch of trf mutants. Genes expressed at > 1.5-fold lower levels in mutants than in controls (swimming larva and juvenile) in both biological replicates were defined as downregulated in the mutant.

e3 Current Biology 30, 1555–1561.e1–e4, April 20, 2020

QUANTIFICATION AND STATISTICAL ANALYSIS The results of microinjections and pharmacological treatments were statistically analyzed by the chi-square test using the R 3.6.1 software [41]. DATA AND CODE AVAILABILITY The detailed procedures and data series about the microarray analysis have been deposited at NCBI GEO: GSE124672.

Current Biology 30, 1555–1561.e1–e4, April 20, 2020 e4