- Email: [email protected]
Galactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway
Journal Pre-proof ssssGalactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway
Hongqian Chu, Xi Tao, Zhaogang Sun, Weidong Hao, Xuetao Wei PII:
S0024-3205(19)31148-8
DOI:
https://doi.org/10.1016/j.lfs.2019.117220
Reference:
LFS 117220
To appear in:
Life Sciences
Received date:
22 October 2019
Revised date:
12 December 2019
Accepted date:
22 December 2019
Please cite this article as: H. Chu, X. Tao, Z. Sun, et al., ssssGalactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway, Life Sciences(2019), https://doi.org/10.1016/j.lfs.2019.117220
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier.
Journal Pre-proof Galactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway Hongqian Chu a,c,d,1, Xi Tao a,b,1, Zhaogang Sunc,d, Weidong Hao a,b, Xuetao Wei a,b* a
Department of Toxicology, School of Public Health, Peking University, Beijing 100191, P.R.
China. b
Beijing Key Laboratory of Toxicological Research and Risk Assessment for Food Safety,
f
Beijing 100191, P.R. China. c
oo
National Tuberculosis Clinical Laboratory, Beijing Chest Hospital, Capital Medical
Beijing Key Laboratory for Drug Resistance Tuberculosis Research, Beijing Tuberculosis and
e-
d
pr
University, Beijing 101149, P. R. China.
Thoracic Tumor Research Institute, Beijing 101149, P. R. China. *
Pr
Correspondence: Tel:+86 10 82801520 Fax: +86 10 82801520
E-mail addresses: [email protected]
rn
al
Hongqian Chu and Xi Tao have contributed equally to this work.
Jo u
1
1
Journal Pre-proof ABSTRACT Background/Aims Previous studies have demonstrated that Galactooligosaccharides (GOS), known as "bifidus factor", has anti-inflammatory effects. Colitis, a kind of colonic inflammatory damage could be induced by different chemicals. The pathogenesis and mechanism of colitis remains unclear, and may be related to intestinal microflora, genetic susceptibility or immune factors. The aim is to explore the effects of GOS on intestinal flora and its anti-inflammatory effects in Dextran
oo
f
Sulfate Sodium (DSS) induced murine colitis and extrapolate the underlying mechanism. Main Methods
pr
Initially, 5% DSS was used to induced colitis by free access to drinking water for 5-7 days.
e-
Then the mice were treated with GOS 1 day after DSS treatment. Colon samples were evaluated
Pr
grossly using a microscope. The percentage of Treg and Th17 cells was analyzed by flow cytometry. The levels of cytokines secretion and mRNA expression were detected by ELISA
rn
Key Findings
al
and real-time PCR. The level of protein was detected by western blot.
Jo u
GOS attenuated DSS induced body weight loss and also reduced the increase in disease index caused by DSS. GOS ameliorated DSS induced colonic histological damage . The protective effect of GOS on DSS induced colitis may be partly attributed to intestinal flora regulation and Th17/Treg imbalance. Furthermore, GOS markedly decreased cytokines (IL-6, IL-18, IL-13 and IL-33) secretion and mRNA expression in colon tissues, through inhibiting activation of NF-κB pathways. Significance GOS could prevent the DSS induced colitis through intestinal flora regulation and reduce the secretion of inflammation related cytokines relying on the NF-κB signaling pathway. Keywords 2
Journal Pre-proof
Jo u
rn
al
Pr
e-
pr
oo
f
Colitis; Galactooligosaccharides; NF-κB signaling pathway; Intestinal microflora.
3
Journal Pre-proof Introduction Ulcerative colitis (UC), a type of inflammatory bowel disease (IBD), is characterized by inflammatory cell infiltration in the colon mucosa [1]. The incidence and prevalence of IBD are not only high in North America and northern Europe, but also increased in previously reported low incidence areas such as Asia or some other developing countries [2].The pathogenesis of ulcerative colitis remains unclear, but may be related to genetic susceptibility, intestinal microflora or immune factors.
oo
f
Although the precise etiology of colitis is unknown, with further research, the role of
pr
intestinal microflora and immune factors in the pathogenesis of UC is becoming clearer [3]. Current common medical treatments for UC are mainly anti-inflammatory and immune-
e-
regulatory medications, such as aminosalicylic acid and glucocorticoids. New biological agents,
Pr
as well as probiotics, have also emerged as recommended drugs for clinical treatment of UC [4,5].
al
DSS-induced colitis is a well-established animal model for the study of colon inflammation
rn
[6,7]. In fact, DSS induced colitis has similar clinical symptoms and histological changes to
Jo u
IBD in humans. Also, there are many studies about use of the DSS-induced colitis model to validate related therapeutic agents. Therefore, DSS-induced colitis may be a bridge to translate mice data to human diseases.
Galactooligosaccharides (GOS) is indigestible but can be fermented by the microbiota in the colon, and further stimulate the development of a complex microflora dominated by bifidobacteria and lactobacilli; hence commonly known as "bifidus factor". GOS also has antiinflammatory, anti-aging and anticancer effects [8,9]. Whether it could attenuate ulcerative colitis is still unclear. Depending on indications from current research, it is supported that GOS might be a potential candidate to alleviate damage from colitis. In order to prove our hypothesis, the effects of GOS on intestinal flora and its anti-inflammatory effects in DSS induced murine 4
Journal Pre-proof colitis was investigated and the underlying mechanism was postulated. Materials and methods Animals Female C57BL/6 mice (8-10 weeks old, 18-22 g) were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and maintained in a sterile environment. At the end of the experiment, mice were sacrificed by cervical dislocation under isoflurane anesthesia (The oxygen flow rate was 0.4 to 0.8 L/min and he isoflurane concentration was 2% to 2.5%).
oo
f
All related operations about mice were approved for use by the Institutional Animal Care and
pr
Use Committee of Peking University. Induction of colitis
e-
After 3 days of acclimatization, mice were randomly divided into four groups (n=6 per group)
Pr
listed as follows: negative control group, GOS group, DSS model group and DSS + GOS treatment group. Mice received either drinking regular water or 5% (w/v) DSS (molecular
al
weight 36,000-50,000; MP Bi medicals) for 7 days to induce acute colitis. GOS was given
rn
intragastrically (0.5 g/kg/day; Ausnutria Dairy Corporation Ltd) to GOS control group and
Jo u
GOS treatment group at a fixed time from day1 to day7. Meanwhile, water was given intragastrically (0.5 g/kg/day) to the negative group and model group. All mice were carefully recorded and monitored daily for signs of disease (weight loss, stool consistency, and rectal bleeding). On day 8, mice were humanely sacrificed and colon and feces were harvested. Colon length and wet weight were measured as indications of colonic inflammation. The mechanism of design was shown in Scheme.
5
oo
f
Journal Pre-proof
Scheme Schematic Illustration of GOS inhibited DSS induced colitis.
pr
Stool sample collection
Disease activity index evaluation
e-
Fresh stool samples were collected and stored at -80 °C immediately.
Pr
The disease activity index (DAI) was recorded according to the published nature protocol scoring system [10]. The details of grading system were shown in Table S1. All scores were
al
combined together for the final DAI score.
Weight loss (%) None
Jo u
Score 0 1 2 3 4
rn
Table S1 Disease activity index evaluation
1-5 5-10 10-20 >20
Stool consistency Normal Normal Loose stools Loose stools Diarrhea
Occult/gross rectal bleeding Normal Normal Positive hemoccult Positive hemoccult Gross bleeding
Table S1 Disease activity index evaluation
Histology 70% ethanol was used to spray on the surface of mice and carefully open the mouse by ventral midline incision. The colon was separated from the cecum at the ileocecal junction and quickly flushed (5 ml syringe with feeding needle) using cold PBS to remove feces and blood. After flushing with PBS, colons were fixed immediately in 10% buffered formalin and stained with hematoxylin and eosin (H&E). The histological score of each mouse was calculated according 6
Journal Pre-proof to epithelium damage and cell infiltration [10]. The specimens were analyzed blindly by a pathologist under a light microscope and the scores were recorded and confirmed as follows: 0, no significant change; 1, Low level of inflammation with scattered inflammatory cells; 2, moderate inflammation with multiple foci; 3, high level of inflammation with marked wall thickening; 4, maximal severity of inflammation with transmural leukocyte infiltration and loss of goblet cells. The neutrophil infiltration in colon tissue was also analyzed blindly by a pathologist and judged according to the characteristic of neutrophil, and the number of
oo
f
neutrophil aggregation was recorded. Flow cytometry analysis
pr
Mesenteric lymph nodes were removed and mechanically dissociated into single cell
e-
suspensions. Cells were stained with antibodies labeled florescence, including, CD4-PECY5,
Pr
Foxp3-FITC and IL-17-PE (eBioscience). The procedure of each experiment was performed according manufacture instructions. Cells were analyzed by Beckman Coulter Flow Cytometer
materials.
Jo u
ELISA analysis
rn
al
(Beckman Coulter, FC500-MPL). The details of the staining were shown in supplementary
Colon tissues were homogenized mechanically in phosphate buffered saline (PBS). The homogenate was centrifuged at 3000 rpm at 4 oC for 10 min. The level of cytokines (IL-6, IL18, IL-13 and IL-33) in the colon homogenates was measured by using enzyme-linked immunosorbant assay (ELISA) kits. All of the kits were purchased from Abcam Co. Ltd. (UK). All of the procedures were performed according to the manufacturer's instructions. RT-PCR analysis Total RNA was extracted from colon was using Trizol (Invitrogen, USA). Then, cDNA was generated using PrimeScript® RT-PCR Kit (TaKaRa, DRR014A). Real-time PCR was performed using IQTM5 Multicolor Real-Time PCR Detection System (Bio-Rad iCycler). The 7
Journal Pre-proof relative change of gene expression was calculated using the comparative method by normalization to the internal control GAPDH. The details of the method were shown in supplementary materials. The sequences of all cytokines primer for PCR were listed in Table S2. Table S2 Sequences of Real-time PCR primers Reverse Primer (5’-3’) GTTCACACCCATCACAAAC TCTCATTTCCACGATTTCCCAG GCCTCGGGTATTCTGTTATGGA CATCTCCCTTCCTCCTCAAC GATGTCTGTGTCTTTGATGG
f
Forward Primer (5’-3’) GCTGAGTATCGTGGAGT ACAACCACGGCCTTCCCTAC GACCTGGAATCAGACAACTTTGG ATGAGGAGAGACCATCCCTG GGTGCTACTACGCTACTATG
oo
Gene GAPDH IL-6 IL-18 IL-13 IL-33
pr
Table S2. Primer sequences used for detecting GAPDH, IL-6, IL-18, IL-13 and IL-33 in Real-time PCR.
Western blot analysis
e-
Cytosolic and nuclear proteins were extracted separately and analyzed by western blot. Protein
Pr
extracts were prepared by lysing the colon tissue with 1% PMSF (Beyotime, China) for 30 min at 4 °C, supernatants were collected after centrifugation (13,000 rpm for 5 min). The amount
rn
loading buffer 1:1.
al
of proteins were quantified using the BCA assay (Beyotime, China), and then mixed with 2x
Jo u
The details of the method were shown in supplementary materials. All experiments were performed independently at least three times. Statistical analysis
Data were presented as mean ± S.D. Comparison of more than two groups was made with a one-way analysis of variance ANOVA followed by Dunnett t-test (SPSS 13.0 Peking University). The P value < 0.05 was considered significant. Results GOS ameliorated colitis induced by DSS As shown in Fig.1 B, mice treated with DSS showed significant body weight loss, whereas GOS treatment could prevent the body weight loss. The DAI score of the model group was 8
Journal Pre-proof significantly increased compared with DSS + GOS treatment group from day 3 (Fig.1 E). Furthermore, the length of colon was measured and it was found that GOS treatment significantly inhibited reduction of colon length (Fig.1 C and D). The severity of colonic inflammation was then analyzed using H&E staining. As expected, there was serious damage and inflammation in the H&E-stained sections in the model group (Fig.1 F and G). Severe changes of colon architecture were observed. The colonic villi were irregular. The pithelial layers and lamina propria were disrupted. The mucosal damage was increased in comparison
oo
f
with the vehicle control group, accompanied by infiltration of inflammatory cells into mucosa and goblet cell disruption or disappearance. In contrast, GOS treated mice exhibited less
pr
inflammatory cell infiltration in tissue and intact colonic architecture with less apparent
e-
ulceration (Fig.1 F and G). As well as the histological assessment showed in Fig.1 G, the score
Pr
of model group was significantly higher than GOS treated group. In conclusion, these results
Jo u
rn
al
support that GOS treatment could alleviate symptoms of murine colitis induced by DSS.
9
Journal Pre-proof Fig. 1. GOS ameliorated colitis induced by DSS. (A) Protocol for acute DSS colitis and GOS treatment. (B) Change of body weight from day1 to day 7. (C and D) Change of colon length in each group. (E) Change of DAI score in each group (F and G) Colon tissues from mice were stained with hematoxylin and eosin (H&E) for histological score. Scale bars, 100 μm (original magnification, 200×). Results were expressed in mean ± S.D. **P < 0.05, n=6 mice per group.
GOS regulated intestinal flora GOS is the fermentation substrate of Bifidobacterium produces short fatty acids (mostly are aetic acid and lactic acid) and antibiotics. Some antibiotics can inhibit the growth and
oo
f
reproduction of deleterious bacteria to regulate the balance of flora in colon, like Shigella, Salmonella, Staphylococcus aureus and Escherichia coli [11].
pr
Here, bar and heatmap figures suggest that the percentage of Bacteroidetes in the colon of
e-
the GOS treatment group was significantly increased and Proteobacteria was evidently
Jo u
rn
al
Pr
decreased compared with the model group in this study (Fig.2, A and B).
10
Jo u
rn
al
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 2. GOS regulated intestinal flora.( A and B) Bar and heat map of microarray analysis of stool samples.
GOS treatment down-regulated the percentage of Th17 cells In intestinal tissue, Th17 cells play an important role in defense of bacteria and fungi by raising neutrophils to inflammatory targets. IL-17 secreted by Th17 cells can induce the production of inflammatory cytokines, cooperate or magnify the inflammatory reaction, and promote the 11
Journal Pre-proof process of inflammation [11]. Th17 cells were measured in this study and was much higher in the model group than in the GOS treatment group (Fig.3, A and B). Those results indicated that
Pr
e-
pr
oo
f
GOS treatment might inhibit differentiation of Th17 cells in colitis induced by DSS.
Fig. 3. GOS modulated Th17and Treg cells in colitis induced by DSS in mice. (A) Among CD4+ cells, the
al
condition of Th17 cells and Treg cells in mesenteric lymph node under different treatment . (B) The proportion of Th17 cells. (C) The proportion of Treg cells. Results were expressed in mean ± S.D. **P <
rn
0.01, n=6.
Jo u
GOS treatment upregulated the percentage Treg cells Regulatory T cells (CD4+Foxp3+ Treg cells) play a critical role in the maintenance of intestinal immune homeostasis. In the present study, the percentage of Treg cells in CD4+ T cells was almost 10% of control groups and there was no difference between the two control groups. But, it was remarkably high in GOS treatment group compared with model group (Fig.3, A and C). This suggested that Treg cells exist in normal mice, and GOS could significantly promote Treg cells differentiation in colitis induced by DSS. GOS decreased secretion of pro-inflammatory cytokines High levels of pro-inflammatory cytokines are closely related to exacerbated intestinal inflammation. Thus we investigated whether GOS treatment influenced the secretion of pro12
Journal Pre-proof inflammatory cytokines (IL-6, IL-18, IL-13 and IL-33) in DSS-induced colitis. As shown in Fig. 4, after induction with DSS, the level of cytokines in the colon was significantly higher compared with control groups. However, the level of cytokines was significantly downregulated after GOS treatment compared with the model group. Thus, GOS could prevent DSS-
Jo u
rn
al
Pr
e-
pr
oo
f
induced secretion of pro-inflammatory cytokines in colon tissues.
Fig. 4. GOS inhibited secretion of pro-inflammatory cytokines. The level of IL-6, IL-18, IL-13 and IL-33 in colon tissues was measured by ELISA kits. (A) IL-6, (B) IL-18, (C) IL-13, (D) IL-33. Results were expressed in mean ± S.D. **P < 0.01, n=6.
GOS inhibits mRNA expressions of pro-inflammatory cytokines In the present study, cytokines (IL-6, IL-18, IL-13 and IL-33) mRNA expression in the colon were significantly suppressed relative to those in the model group. GOS could significantly inhibit the elevated production of these cytokines (Fig.5).
13
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 5. GOS inhibits mRNA expressions of pro-inflammatory cytokine. Results are presented relative to the **P < 0.01, ***P < 0.001, n=6.
al
expression of GAPDH. (A) IL-6, (B) IL-18, (C) IL-13, (D) IL-33. Results were expressed in mean ± S.D.
rn
NF-κB signaling pathway reconstruction
Jo u
As shown in Fig. 6, the expression of p-Akt, p-IκB α and p-p65 were assessed. The phosphorylation of AKT, IκBα and p65 were increased after exposure to DSS. Moreover, the phosphorylation of ERK, JNK and P38 in the DSS + GOS group was lower than that of the model group. All these results indicated that DSS-induced colitis through promoting activation of p-Akt and p-IκBα in the cytoplasm and p-p65 translocation from the cytoplasm to the nucleus. It suggested that GOS treatment could alleviate colitis induced by DSS via inhibiting activation of NF-κB signaling pathway.
14
Jo u
rn
al
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 6. NF-κB signaling pathway reconstruction. (A) Pan-Akt and p-Akt in colon tissues and grey analysis for p-Akt in the right histogram. (B) Pan-IκBα and p-IκBα in colon tissues and grey analysis for p-IκBα in the right histogram. (C) P65 and p-p65 in colon tissues and grey analysis for p-p65 in the right histogram. The blots were performed under the same experimental condition except for blotting with the different antibodies, respectively. Statistics are given as mean ± S.D. **P < 0.01, n=6.
Discussion Animal experiments confirmed that GOS could inhibit the growth and reproduction of deleterious bacteria to regulate the balance of flora in colon and also could improve the body's immunity and activate macrophage phagocytic activity [12]. The present study suggested that GOS treatment could effectively attenuate DSS-induced colonic inflammation. After treated 15
Journal Pre-proof with 0.5 mg/kg/d GOS+DSS, the body weight loss, DAI score, colon length and histological changes in mice were significantly improved compared with the model group. Furthermore, GOS treatment markedly decreased IL-6, IL-18, IL-13 and IL-33 secretion and also the mRNA expression in colon, through inhibiting the activation of NF-κB signaling pathway. GOS also triggered Th17/Treg imbalance through regulation of intestinal flora. All of these results suggested that GOS could protect mice from colitis induced by DSS. It is well know that the gastrointestinal tract is exposed to multiple antigens from diets,
oo
f
commensal bacteria, and pathogens and is considered the largest immune interface in mammals. Since the tract has a high antigen load, a balance between inflammatory responses to harmful
pr
pathogens and tolerance to commensal flora (maintaining immune homeostasis) is required to
e-
maintain a healthy gut. Both innate and adaptive immunity have been suggested playing a key
Pr
role in maintaining intestinal homeostasis and there are various factors involved in this process. A breakdown in this well-controlled balance could result in intestinal disorders, such as
al
ulcerative colitis and increased infectious diseases [13].
rn
UC is characterized by the dysregulated CD4+T cell mediated immune responses to
Jo u
microbiota in intestinal mucosa [14]. UC was thought to be associated with Th2-like responses for many years. However, studies revealed that IL-17 play an essential role in defense of bacteria and fungi by raising neutrophils to inflammatory targets. IL-17 can induce the production of inflammatory cytokines, cooperate or magnify the inflammatory reaction, and promote the process of inflammation [15]. As shown, the percentage of Th17 cells in model group was significantly high in comparison with GOS treatment group. Namely, DSS imbalance intestinal flora so as to promote the production of Th17 cells and induce colitis, but GOS could inhibit it. In the gut, Treg is a primary mediator in maintaining the immune homeostasis. The level of Foxp3 protein in Treg plays a key role in their suppressive function, and deficiency of the Foxp3 16
Journal Pre-proof gene leads to autoimmune diseases [16]. Its regulatory mechanism involves many aspects, such as secreting cytokines (TGF-β, IL-10, IL-35) to regulate immune response, inhibiting or killing effector lymphocytes. Research showed that the normal flora can promote the function of Treg in a variety of ways. Treg can be activated by intestinal contents or some types of intestinal bacteria [17]. Short chain fatty acid (SCFA) fermentation products of intestinal bacteria regulate the number and frequency of Treg in the colon [17]. Bacteroides fragilis and Clostridia species have been found to suppress an inflammatory response in the intestine by promoting
oo
f
Treg [18]. This experiment suggested that the proportion of Bacteroides fragilis in GOS treated mice were significantly higher than that of model mice, however, Verrucomicrobia and
pr
Proteobacteria showed the opposite effect (Fig.2 A&B). In the stimulation of bacteria, intestinal
e-
epithelial cells (IECs) can provide an immune protection function by secreting various
Pr
cytokines, including IL-1 family (e.g. IL-18, IL-33), IL-6, and some anti-inflammatory cytokines [19].
al
IL-18 is a potent proinflammatory cytokine with the ability to promote colitis through the
rn
induction of inflammatory mediators such TNF-α and chemokines [20]. Some studies have
Jo u
found that the treatment of recombinant IL-18 to mice during early colitis could promote epithelial proliferation in inflammasome deficient mice, rescuing intestinal pathology [21]. IL-33 induces Th2 response and promotes the production of IL-13 in Th2 cells [22]. In DSSinduced colitis model, IL-33 promotes the recruitment of neutrophils and induces Tregs differentiation. IL-33 is a highly inflammatory cytokine constitutively expressed in mucosal and barrier cell types, acting as regulators of innate and acquired immune responses by amplifying both Th1 and Th2 responses [23]. IL-18 and IL-33could induce the secretion of Th1 and Th2 cytokine (such as IL-5, IL-9, IL-13, IFN-γ, and TNF-α) which suggests that they are endogenous activators of inflammatory responses, IL-6 has a positive correlation with IBD disease activities and plays a key role in apoptosis 17
Journal Pre-proof in the lamina propria at the inflamed site [24]. IL-13 is a type of anti-inflammatory cytokines produced by T lymphocytes, monocytes and macrophages. It can inhibit lipopolysaccharide (LPS) and TNF induced monocytes and macrophages to produce inflammatory mediators, including IL-1, IL-6, TNF-α and IL-2. It also can cut multiple pro-inflammatory cytokines, such as IL-1, IL-8 and TNF-α expression [25,26]. Inflammation is usually initiated when host cells come in contact with microbes and is dependent on the activation of nuclear factor κB (NF-κB) signaling pathway [27]. Inhibition of
oo
f
NF-kB activation has been suggested as an anti-inflammatory strategy in UC [28]. As evaluated by western blot analysis in our study, colitis induced by DSS resulted in rapid activation of p-
pr
IκBα, p-Akt and p-p65 in colon tissues. In contrast, GOS inhibited activation of p-IκBα, p-Akt
e-
and p-p65 in colon tissues in colitis induced by DSS. These results indicated that GOS had
Pr
effects on suppression of NF-kB activation in DSS induced colitis. In addition, GOS mediated a reduction of the expression of pro-inflammatory cytokines (IL-
al
6, IL-18, IL-13 and IL-33). Upon induction of DSS colitis, NF-κB was activated and
rn
translocated to the nucleus of colon tissues, the place regulated the transcription of a series of
Jo u
genes [39]. In this study, we found that cytokines (IL-6, IL-18, IL-13 and IL-33) mRNA expression increased in the DSS colitis mice and GOS treatment could inhibit this up-regulation. These data suggested that GOS could inhibit the expression of pro-inflammatory cytokines in the colon of DSS colitis mice. In summary, these findings provide evidence that GOS could ameliorate DSS induced colitis. The underlying mechanism may be related to the regulation of intestinal flora and the inhibition of NF-κB activation. Thus GOS might act as a protective factor for acute colitis. Thus, we provide a theoretical basis for prevention of colitis. Conflict of interest None declared. 18
Journal Pre-proof Acknowledgments The authors would like to thank Yao Pan for excellent technical assistance. References [1] Cummings FJR, Jewell DP. Clinical implications of inflammatory bowel disease genetics on phenotype. Inflamm Bowel Dis 2005;11:56-61. [2] Ng SC, Bernstein CN, Vatn MH, Lakatos PL, Loftus EV, Tysk C, et al. Geographical variability and
oo
f
environmental risk factors in inflammatory bowel disease. Gut 2013;62:630-49.
pr
[3] Manichanh C, Borruel N, Casellas F, Guarner F. The gut microbiota in IBD. Nat Rev Gastro Hepat 2012;9:599-608.
e-
[4] ales-Campos H, Basso P J, Alves VBF, Fonseca, MTC, Bonfá G, Nardini V, Cardoso CRB. Classical and
Pr
recent advances in the treatment of inflammatory bowel diseases. Braz J Med Biol Res 2015;48:96-107.
rn
2010;45:571-83.
al
[5] Engel MA, Neurath MF. New pathophysiological insights and modern treatment of IBD. J Gastroenterol
Jo u
[6] Saleh M, Elson CO. Experimental inflammatory bowel disease: insights into the host-microbiota dialogue. Immunity 2011; 34:293-302.
[7] Abraham C, Medzhitov R. Interactions between the host innate immune system and microbes in inflammatory bowel disease. Gastroenterology 2011;140:1729-37. [8] amazaki SH, Machii K, Tsuyuki S, Momose H, Kawashima T, Ueda K. Immunological responses to monoassociated bifidobacterium longum and their relation to prevention of bacterial invasion. Immunology 1985;56:43-50. [9] Minoru F, Jun A, Shun'Ichiro T. The genus bifidobacterium for cancer gene therapy. Curr Opin Cell Biol 2002;5:200-3.
19
Journal Pre-proof
[10] Wirtz S, Neufert C, Weigmann B, Neurath MF. Chemically induced mouse models of intestinal inflammation. Nat Protoc 2007;2:541-6. [11] Yen CH, Kuo YW, Tseng YH, Lee MC, Chen HL. Beneficial effects of fructo-oligosaccharides supplementation on fecal bifidobacteria and index of peroxidation status in constipated nursing-home residents-a placebo-controlled, diet-controlled trial. Nutrition 2011;27:323-8.
f
[12] Yamazaki S, Machii K, Tsuyuki S, Momose H, Kawashima T, Ueda K. Immunological responses to
oo
monoassociated Bifidobacterium longum and their relation to prevention of bacterial invasion, Immunology
pr
1985;56:43-50.
e-
[13] Garrett WS, Gordon JI, Glimcher LH, Homeostasis and inflammation in the intestine, Cell 2010;140:859-
Pr
70.
[14] Gagliani N, Vesely MCA, Iseppon A, Brockmann L, Xu H, Palm NW, et al. Th17 cells transdifferentiate into
al
regulatory T cells during resolution of inflammation. Nature 2015;523:221-5.
Jo u
2010;16:1808-13.
rn
[15] Sarra M, Pallone F, Macdonald TT, Monteleone G. IL-23/IL-17 axis in IBD. Inflamm Bowel Dis
[16] Kryczek I, Liu R, Wang G, Ke W, Shu X, Szeliga W, et al. FOXP3 defines regulatory T cells in human tumor and autoimmune disease, Cancer Res 2009;69:3995-4000. [17] Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T, Momose Y, et al. Induction of colonic regulatory T cells by indigenous clostridium species. Science 2011: 331:337-41. [18] Reiff C, Kelly D, Inflammatory bowel disease, gut bacteria and probiotic therapy. Int J Med Microbiol 2010;300:25-33. [19] Sims JE, Smith DE, The IL-1 family: regulators of immunity. Nat Rev Immunol. 2010;10:89-102. [20] Sivakumar PV, Westrich GM, Kanaly S, Garka K, Born TL, Derry JM, et al. Interleukin 18 is a primary 20
Journal Pre-proof
mediator of the inflammation associated with dextran sulphate sodium induced colitis: blocking interleukin 18 attenuates intestinal damage. Gut 2002;50:812-20. [21] Liu H, Yao S, Dann SM, Qin H, Elson CO, Cong Y, ERK differentially regulates Th17-and Treg-cell development and contributes to the pathogenesis of colitis. Eur J Immunol. 2013;43:1716-26. [22] Arend WP, Palmer G, Gabay C, IL-1, IL-18, and IL-33 families of cytokines. Immunol Rev 2008;223:20-38.
f
[23] Pastorelli L, Garg RR, Hoang SB, Spina L, Mattioli B, Scarpa M, et al. Epithelial-derived IL-33 and its
oo
receptor ST2 are dysregulated in ulcerative colitis and in experimental Th1/Th2 driven enteritis. Proc Natl
pr
Acad Sci USA 2010;107:8017-22.
e-
[24] Erta M, Quintana A, Hidalgo J. Interleukin-6, a major cytokine in the centralnervous system. Int J Biol Sci
Pr
2012;8:1254–66.
[25] Fichtner Feigl S, Young CA, Kitani A, Geissler EK, Schlitt HJ, Strober W, IL-13 signaling via IL-13R alpha2
rn
2008;135:1-7.
al
induces major downstream fibrogenic factors mediating fibrosis in chronic TNBS colitis. Gastroenterology
Jo u
[26] Strober W, Fuss IJ, Heller F, Blumberg RS, Methods of treating and preventing colitis involving IL-13 and NK-T cells. U.S. Patent 7,666,411. 2010-2-23. [27] Kumar A, Wu H, Collier Hyams LS, Hansen JM, Li T, Yamoah K, et al. Commensal bacteria modulate cullin-dependent signaling via generation of reactive oxygen species. Embo J 2007;26:4457-66. [28] Atreya I, Atreya R, Neurath MF, NF-kappaB in inflammatory bowel disease. J Intern Med 2008;263:591-6. [29] Yan F, Wang L, Shi Y, Cao H, Liu L, Washington MK, et al. Berberine promotes recovery of colitis and inhibits inflammatory responses in colonic macrophages and epithelial cells in DSS-treated mice. Am J Physiol Gastrointest Liver Physiol 2011;302:G504-G514.
21
Journal Pre-proof
Highlights GOS ameliorated DSS induced colitis.
GOS could regulate intestinal flora and balance Th17/Treg cells.
GOS inhibited NF-κB activation, reduce secretion of inflammatory cytokines.
GOS might act as a protective candidate for acute colitis induced by DSS.
Jo u
rn
al
Pr
e-
pr
oo
f
22
Hongqian Chu, Xi Tao, Zhaogang Sun, Weidong Hao, Xuetao Wei PII:
S0024-3205(19)31148-8
DOI:
https://doi.org/10.1016/j.lfs.2019.117220
Reference:
LFS 117220
To appear in:
Life Sciences
Received date:
22 October 2019
Revised date:
12 December 2019
Accepted date:
22 December 2019
Please cite this article as: H. Chu, X. Tao, Z. Sun, et al., ssssGalactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway, Life Sciences(2019), https://doi.org/10.1016/j.lfs.2019.117220
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier.
Journal Pre-proof Galactooligosaccharides protects against DSS-induced murine colitis through regulating intestinal flora and inhibiting NF-κB pathway Hongqian Chu a,c,d,1, Xi Tao a,b,1, Zhaogang Sunc,d, Weidong Hao a,b, Xuetao Wei a,b* a
Department of Toxicology, School of Public Health, Peking University, Beijing 100191, P.R.
China. b
Beijing Key Laboratory of Toxicological Research and Risk Assessment for Food Safety,
f
Beijing 100191, P.R. China. c
oo
National Tuberculosis Clinical Laboratory, Beijing Chest Hospital, Capital Medical
Beijing Key Laboratory for Drug Resistance Tuberculosis Research, Beijing Tuberculosis and
e-
d
pr
University, Beijing 101149, P. R. China.
Thoracic Tumor Research Institute, Beijing 101149, P. R. China. *
Pr
Correspondence: Tel:+86 10 82801520 Fax: +86 10 82801520
E-mail addresses: [email protected]
rn
al
Hongqian Chu and Xi Tao have contributed equally to this work.
Jo u
1
1
Journal Pre-proof ABSTRACT Background/Aims Previous studies have demonstrated that Galactooligosaccharides (GOS), known as "bifidus factor", has anti-inflammatory effects. Colitis, a kind of colonic inflammatory damage could be induced by different chemicals. The pathogenesis and mechanism of colitis remains unclear, and may be related to intestinal microflora, genetic susceptibility or immune factors. The aim is to explore the effects of GOS on intestinal flora and its anti-inflammatory effects in Dextran
oo
f
Sulfate Sodium (DSS) induced murine colitis and extrapolate the underlying mechanism. Main Methods
pr
Initially, 5% DSS was used to induced colitis by free access to drinking water for 5-7 days.
e-
Then the mice were treated with GOS 1 day after DSS treatment. Colon samples were evaluated
Pr
grossly using a microscope. The percentage of Treg and Th17 cells was analyzed by flow cytometry. The levels of cytokines secretion and mRNA expression were detected by ELISA
rn
Key Findings
al
and real-time PCR. The level of protein was detected by western blot.
Jo u
GOS attenuated DSS induced body weight loss and also reduced the increase in disease index caused by DSS. GOS ameliorated DSS induced colonic histological damage . The protective effect of GOS on DSS induced colitis may be partly attributed to intestinal flora regulation and Th17/Treg imbalance. Furthermore, GOS markedly decreased cytokines (IL-6, IL-18, IL-13 and IL-33) secretion and mRNA expression in colon tissues, through inhibiting activation of NF-κB pathways. Significance GOS could prevent the DSS induced colitis through intestinal flora regulation and reduce the secretion of inflammation related cytokines relying on the NF-κB signaling pathway. Keywords 2
Journal Pre-proof
Jo u
rn
al
Pr
e-
pr
oo
f
Colitis; Galactooligosaccharides; NF-κB signaling pathway; Intestinal microflora.
3
Journal Pre-proof Introduction Ulcerative colitis (UC), a type of inflammatory bowel disease (IBD), is characterized by inflammatory cell infiltration in the colon mucosa [1]. The incidence and prevalence of IBD are not only high in North America and northern Europe, but also increased in previously reported low incidence areas such as Asia or some other developing countries [2].The pathogenesis of ulcerative colitis remains unclear, but may be related to genetic susceptibility, intestinal microflora or immune factors.
oo
f
Although the precise etiology of colitis is unknown, with further research, the role of
pr
intestinal microflora and immune factors in the pathogenesis of UC is becoming clearer [3]. Current common medical treatments for UC are mainly anti-inflammatory and immune-
e-
regulatory medications, such as aminosalicylic acid and glucocorticoids. New biological agents,
Pr
as well as probiotics, have also emerged as recommended drugs for clinical treatment of UC [4,5].
al
DSS-induced colitis is a well-established animal model for the study of colon inflammation
rn
[6,7]. In fact, DSS induced colitis has similar clinical symptoms and histological changes to
Jo u
IBD in humans. Also, there are many studies about use of the DSS-induced colitis model to validate related therapeutic agents. Therefore, DSS-induced colitis may be a bridge to translate mice data to human diseases.
Galactooligosaccharides (GOS) is indigestible but can be fermented by the microbiota in the colon, and further stimulate the development of a complex microflora dominated by bifidobacteria and lactobacilli; hence commonly known as "bifidus factor". GOS also has antiinflammatory, anti-aging and anticancer effects [8,9]. Whether it could attenuate ulcerative colitis is still unclear. Depending on indications from current research, it is supported that GOS might be a potential candidate to alleviate damage from colitis. In order to prove our hypothesis, the effects of GOS on intestinal flora and its anti-inflammatory effects in DSS induced murine 4
Journal Pre-proof colitis was investigated and the underlying mechanism was postulated. Materials and methods Animals Female C57BL/6 mice (8-10 weeks old, 18-22 g) were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and maintained in a sterile environment. At the end of the experiment, mice were sacrificed by cervical dislocation under isoflurane anesthesia (The oxygen flow rate was 0.4 to 0.8 L/min and he isoflurane concentration was 2% to 2.5%).
oo
f
All related operations about mice were approved for use by the Institutional Animal Care and
pr
Use Committee of Peking University. Induction of colitis
e-
After 3 days of acclimatization, mice were randomly divided into four groups (n=6 per group)
Pr
listed as follows: negative control group, GOS group, DSS model group and DSS + GOS treatment group. Mice received either drinking regular water or 5% (w/v) DSS (molecular
al
weight 36,000-50,000; MP Bi medicals) for 7 days to induce acute colitis. GOS was given
rn
intragastrically (0.5 g/kg/day; Ausnutria Dairy Corporation Ltd) to GOS control group and
Jo u
GOS treatment group at a fixed time from day1 to day7. Meanwhile, water was given intragastrically (0.5 g/kg/day) to the negative group and model group. All mice were carefully recorded and monitored daily for signs of disease (weight loss, stool consistency, and rectal bleeding). On day 8, mice were humanely sacrificed and colon and feces were harvested. Colon length and wet weight were measured as indications of colonic inflammation. The mechanism of design was shown in Scheme.
5
oo
f
Journal Pre-proof
Scheme Schematic Illustration of GOS inhibited DSS induced colitis.
pr
Stool sample collection
Disease activity index evaluation
e-
Fresh stool samples were collected and stored at -80 °C immediately.
Pr
The disease activity index (DAI) was recorded according to the published nature protocol scoring system [10]. The details of grading system were shown in Table S1. All scores were
al
combined together for the final DAI score.
Weight loss (%) None
Jo u
Score 0 1 2 3 4
rn
Table S1 Disease activity index evaluation
1-5 5-10 10-20 >20
Stool consistency Normal Normal Loose stools Loose stools Diarrhea
Occult/gross rectal bleeding Normal Normal Positive hemoccult Positive hemoccult Gross bleeding
Table S1 Disease activity index evaluation
Histology 70% ethanol was used to spray on the surface of mice and carefully open the mouse by ventral midline incision. The colon was separated from the cecum at the ileocecal junction and quickly flushed (5 ml syringe with feeding needle) using cold PBS to remove feces and blood. After flushing with PBS, colons were fixed immediately in 10% buffered formalin and stained with hematoxylin and eosin (H&E). The histological score of each mouse was calculated according 6
Journal Pre-proof to epithelium damage and cell infiltration [10]. The specimens were analyzed blindly by a pathologist under a light microscope and the scores were recorded and confirmed as follows: 0, no significant change; 1, Low level of inflammation with scattered inflammatory cells; 2, moderate inflammation with multiple foci; 3, high level of inflammation with marked wall thickening; 4, maximal severity of inflammation with transmural leukocyte infiltration and loss of goblet cells. The neutrophil infiltration in colon tissue was also analyzed blindly by a pathologist and judged according to the characteristic of neutrophil, and the number of
oo
f
neutrophil aggregation was recorded. Flow cytometry analysis
pr
Mesenteric lymph nodes were removed and mechanically dissociated into single cell
e-
suspensions. Cells were stained with antibodies labeled florescence, including, CD4-PECY5,
Pr
Foxp3-FITC and IL-17-PE (eBioscience). The procedure of each experiment was performed according manufacture instructions. Cells were analyzed by Beckman Coulter Flow Cytometer
materials.
Jo u
ELISA analysis
rn
al
(Beckman Coulter, FC500-MPL). The details of the staining were shown in supplementary
Colon tissues were homogenized mechanically in phosphate buffered saline (PBS). The homogenate was centrifuged at 3000 rpm at 4 oC for 10 min. The level of cytokines (IL-6, IL18, IL-13 and IL-33) in the colon homogenates was measured by using enzyme-linked immunosorbant assay (ELISA) kits. All of the kits were purchased from Abcam Co. Ltd. (UK). All of the procedures were performed according to the manufacturer's instructions. RT-PCR analysis Total RNA was extracted from colon was using Trizol (Invitrogen, USA). Then, cDNA was generated using PrimeScript® RT-PCR Kit (TaKaRa, DRR014A). Real-time PCR was performed using IQTM5 Multicolor Real-Time PCR Detection System (Bio-Rad iCycler). The 7
Journal Pre-proof relative change of gene expression was calculated using the comparative method by normalization to the internal control GAPDH. The details of the method were shown in supplementary materials. The sequences of all cytokines primer for PCR were listed in Table S2. Table S2 Sequences of Real-time PCR primers Reverse Primer (5’-3’) GTTCACACCCATCACAAAC TCTCATTTCCACGATTTCCCAG GCCTCGGGTATTCTGTTATGGA CATCTCCCTTCCTCCTCAAC GATGTCTGTGTCTTTGATGG
f
Forward Primer (5’-3’) GCTGAGTATCGTGGAGT ACAACCACGGCCTTCCCTAC GACCTGGAATCAGACAACTTTGG ATGAGGAGAGACCATCCCTG GGTGCTACTACGCTACTATG
oo
Gene GAPDH IL-6 IL-18 IL-13 IL-33
pr
Table S2. Primer sequences used for detecting GAPDH, IL-6, IL-18, IL-13 and IL-33 in Real-time PCR.
Western blot analysis
e-
Cytosolic and nuclear proteins were extracted separately and analyzed by western blot. Protein
Pr
extracts were prepared by lysing the colon tissue with 1% PMSF (Beyotime, China) for 30 min at 4 °C, supernatants were collected after centrifugation (13,000 rpm for 5 min). The amount
rn
loading buffer 1:1.
al
of proteins were quantified using the BCA assay (Beyotime, China), and then mixed with 2x
Jo u
The details of the method were shown in supplementary materials. All experiments were performed independently at least three times. Statistical analysis
Data were presented as mean ± S.D. Comparison of more than two groups was made with a one-way analysis of variance ANOVA followed by Dunnett t-test (SPSS 13.0 Peking University). The P value < 0.05 was considered significant. Results GOS ameliorated colitis induced by DSS As shown in Fig.1 B, mice treated with DSS showed significant body weight loss, whereas GOS treatment could prevent the body weight loss. The DAI score of the model group was 8
Journal Pre-proof significantly increased compared with DSS + GOS treatment group from day 3 (Fig.1 E). Furthermore, the length of colon was measured and it was found that GOS treatment significantly inhibited reduction of colon length (Fig.1 C and D). The severity of colonic inflammation was then analyzed using H&E staining. As expected, there was serious damage and inflammation in the H&E-stained sections in the model group (Fig.1 F and G). Severe changes of colon architecture were observed. The colonic villi were irregular. The pithelial layers and lamina propria were disrupted. The mucosal damage was increased in comparison
oo
f
with the vehicle control group, accompanied by infiltration of inflammatory cells into mucosa and goblet cell disruption or disappearance. In contrast, GOS treated mice exhibited less
pr
inflammatory cell infiltration in tissue and intact colonic architecture with less apparent
e-
ulceration (Fig.1 F and G). As well as the histological assessment showed in Fig.1 G, the score
Pr
of model group was significantly higher than GOS treated group. In conclusion, these results
Jo u
rn
al
support that GOS treatment could alleviate symptoms of murine colitis induced by DSS.
9
Journal Pre-proof Fig. 1. GOS ameliorated colitis induced by DSS. (A) Protocol for acute DSS colitis and GOS treatment. (B) Change of body weight from day1 to day 7. (C and D) Change of colon length in each group. (E) Change of DAI score in each group (F and G) Colon tissues from mice were stained with hematoxylin and eosin (H&E) for histological score. Scale bars, 100 μm (original magnification, 200×). Results were expressed in mean ± S.D. **P < 0.05, n=6 mice per group.
GOS regulated intestinal flora GOS is the fermentation substrate of Bifidobacterium produces short fatty acids (mostly are aetic acid and lactic acid) and antibiotics. Some antibiotics can inhibit the growth and
oo
f
reproduction of deleterious bacteria to regulate the balance of flora in colon, like Shigella, Salmonella, Staphylococcus aureus and Escherichia coli [11].
pr
Here, bar and heatmap figures suggest that the percentage of Bacteroidetes in the colon of
e-
the GOS treatment group was significantly increased and Proteobacteria was evidently
Jo u
rn
al
Pr
decreased compared with the model group in this study (Fig.2, A and B).
10
Jo u
rn
al
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 2. GOS regulated intestinal flora.( A and B) Bar and heat map of microarray analysis of stool samples.
GOS treatment down-regulated the percentage of Th17 cells In intestinal tissue, Th17 cells play an important role in defense of bacteria and fungi by raising neutrophils to inflammatory targets. IL-17 secreted by Th17 cells can induce the production of inflammatory cytokines, cooperate or magnify the inflammatory reaction, and promote the 11
Journal Pre-proof process of inflammation [11]. Th17 cells were measured in this study and was much higher in the model group than in the GOS treatment group (Fig.3, A and B). Those results indicated that
Pr
e-
pr
oo
f
GOS treatment might inhibit differentiation of Th17 cells in colitis induced by DSS.
Fig. 3. GOS modulated Th17and Treg cells in colitis induced by DSS in mice. (A) Among CD4+ cells, the
al
condition of Th17 cells and Treg cells in mesenteric lymph node under different treatment . (B) The proportion of Th17 cells. (C) The proportion of Treg cells. Results were expressed in mean ± S.D. **P <
rn
0.01, n=6.
Jo u
GOS treatment upregulated the percentage Treg cells Regulatory T cells (CD4+Foxp3+ Treg cells) play a critical role in the maintenance of intestinal immune homeostasis. In the present study, the percentage of Treg cells in CD4+ T cells was almost 10% of control groups and there was no difference between the two control groups. But, it was remarkably high in GOS treatment group compared with model group (Fig.3, A and C). This suggested that Treg cells exist in normal mice, and GOS could significantly promote Treg cells differentiation in colitis induced by DSS. GOS decreased secretion of pro-inflammatory cytokines High levels of pro-inflammatory cytokines are closely related to exacerbated intestinal inflammation. Thus we investigated whether GOS treatment influenced the secretion of pro12
Journal Pre-proof inflammatory cytokines (IL-6, IL-18, IL-13 and IL-33) in DSS-induced colitis. As shown in Fig. 4, after induction with DSS, the level of cytokines in the colon was significantly higher compared with control groups. However, the level of cytokines was significantly downregulated after GOS treatment compared with the model group. Thus, GOS could prevent DSS-
Jo u
rn
al
Pr
e-
pr
oo
f
induced secretion of pro-inflammatory cytokines in colon tissues.
Fig. 4. GOS inhibited secretion of pro-inflammatory cytokines. The level of IL-6, IL-18, IL-13 and IL-33 in colon tissues was measured by ELISA kits. (A) IL-6, (B) IL-18, (C) IL-13, (D) IL-33. Results were expressed in mean ± S.D. **P < 0.01, n=6.
GOS inhibits mRNA expressions of pro-inflammatory cytokines In the present study, cytokines (IL-6, IL-18, IL-13 and IL-33) mRNA expression in the colon were significantly suppressed relative to those in the model group. GOS could significantly inhibit the elevated production of these cytokines (Fig.5).
13
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 5. GOS inhibits mRNA expressions of pro-inflammatory cytokine. Results are presented relative to the **P < 0.01, ***P < 0.001, n=6.
al
expression of GAPDH. (A) IL-6, (B) IL-18, (C) IL-13, (D) IL-33. Results were expressed in mean ± S.D.
rn
NF-κB signaling pathway reconstruction
Jo u
As shown in Fig. 6, the expression of p-Akt, p-IκB α and p-p65 were assessed. The phosphorylation of AKT, IκBα and p65 were increased after exposure to DSS. Moreover, the phosphorylation of ERK, JNK and P38 in the DSS + GOS group was lower than that of the model group. All these results indicated that DSS-induced colitis through promoting activation of p-Akt and p-IκBα in the cytoplasm and p-p65 translocation from the cytoplasm to the nucleus. It suggested that GOS treatment could alleviate colitis induced by DSS via inhibiting activation of NF-κB signaling pathway.
14
Jo u
rn
al
Pr
e-
pr
oo
f
Journal Pre-proof
Fig. 6. NF-κB signaling pathway reconstruction. (A) Pan-Akt and p-Akt in colon tissues and grey analysis for p-Akt in the right histogram. (B) Pan-IκBα and p-IκBα in colon tissues and grey analysis for p-IκBα in the right histogram. (C) P65 and p-p65 in colon tissues and grey analysis for p-p65 in the right histogram. The blots were performed under the same experimental condition except for blotting with the different antibodies, respectively. Statistics are given as mean ± S.D. **P < 0.01, n=6.
Discussion Animal experiments confirmed that GOS could inhibit the growth and reproduction of deleterious bacteria to regulate the balance of flora in colon and also could improve the body's immunity and activate macrophage phagocytic activity [12]. The present study suggested that GOS treatment could effectively attenuate DSS-induced colonic inflammation. After treated 15
Journal Pre-proof with 0.5 mg/kg/d GOS+DSS, the body weight loss, DAI score, colon length and histological changes in mice were significantly improved compared with the model group. Furthermore, GOS treatment markedly decreased IL-6, IL-18, IL-13 and IL-33 secretion and also the mRNA expression in colon, through inhibiting the activation of NF-κB signaling pathway. GOS also triggered Th17/Treg imbalance through regulation of intestinal flora. All of these results suggested that GOS could protect mice from colitis induced by DSS. It is well know that the gastrointestinal tract is exposed to multiple antigens from diets,
oo
f
commensal bacteria, and pathogens and is considered the largest immune interface in mammals. Since the tract has a high antigen load, a balance between inflammatory responses to harmful
pr
pathogens and tolerance to commensal flora (maintaining immune homeostasis) is required to
e-
maintain a healthy gut. Both innate and adaptive immunity have been suggested playing a key
Pr
role in maintaining intestinal homeostasis and there are various factors involved in this process. A breakdown in this well-controlled balance could result in intestinal disorders, such as
al
ulcerative colitis and increased infectious diseases [13].
rn
UC is characterized by the dysregulated CD4+T cell mediated immune responses to
Jo u
microbiota in intestinal mucosa [14]. UC was thought to be associated with Th2-like responses for many years. However, studies revealed that IL-17 play an essential role in defense of bacteria and fungi by raising neutrophils to inflammatory targets. IL-17 can induce the production of inflammatory cytokines, cooperate or magnify the inflammatory reaction, and promote the process of inflammation [15]. As shown, the percentage of Th17 cells in model group was significantly high in comparison with GOS treatment group. Namely, DSS imbalance intestinal flora so as to promote the production of Th17 cells and induce colitis, but GOS could inhibit it. In the gut, Treg is a primary mediator in maintaining the immune homeostasis. The level of Foxp3 protein in Treg plays a key role in their suppressive function, and deficiency of the Foxp3 16
Journal Pre-proof gene leads to autoimmune diseases [16]. Its regulatory mechanism involves many aspects, such as secreting cytokines (TGF-β, IL-10, IL-35) to regulate immune response, inhibiting or killing effector lymphocytes. Research showed that the normal flora can promote the function of Treg in a variety of ways. Treg can be activated by intestinal contents or some types of intestinal bacteria [17]. Short chain fatty acid (SCFA) fermentation products of intestinal bacteria regulate the number and frequency of Treg in the colon [17]. Bacteroides fragilis and Clostridia species have been found to suppress an inflammatory response in the intestine by promoting
oo
f
Treg [18]. This experiment suggested that the proportion of Bacteroides fragilis in GOS treated mice were significantly higher than that of model mice, however, Verrucomicrobia and
pr
Proteobacteria showed the opposite effect (Fig.2 A&B). In the stimulation of bacteria, intestinal
e-
epithelial cells (IECs) can provide an immune protection function by secreting various
Pr
cytokines, including IL-1 family (e.g. IL-18, IL-33), IL-6, and some anti-inflammatory cytokines [19].
al
IL-18 is a potent proinflammatory cytokine with the ability to promote colitis through the
rn
induction of inflammatory mediators such TNF-α and chemokines [20]. Some studies have
Jo u
found that the treatment of recombinant IL-18 to mice during early colitis could promote epithelial proliferation in inflammasome deficient mice, rescuing intestinal pathology [21]. IL-33 induces Th2 response and promotes the production of IL-13 in Th2 cells [22]. In DSSinduced colitis model, IL-33 promotes the recruitment of neutrophils and induces Tregs differentiation. IL-33 is a highly inflammatory cytokine constitutively expressed in mucosal and barrier cell types, acting as regulators of innate and acquired immune responses by amplifying both Th1 and Th2 responses [23]. IL-18 and IL-33could induce the secretion of Th1 and Th2 cytokine (such as IL-5, IL-9, IL-13, IFN-γ, and TNF-α) which suggests that they are endogenous activators of inflammatory responses, IL-6 has a positive correlation with IBD disease activities and plays a key role in apoptosis 17
Journal Pre-proof in the lamina propria at the inflamed site [24]. IL-13 is a type of anti-inflammatory cytokines produced by T lymphocytes, monocytes and macrophages. It can inhibit lipopolysaccharide (LPS) and TNF induced monocytes and macrophages to produce inflammatory mediators, including IL-1, IL-6, TNF-α and IL-2. It also can cut multiple pro-inflammatory cytokines, such as IL-1, IL-8 and TNF-α expression [25,26]. Inflammation is usually initiated when host cells come in contact with microbes and is dependent on the activation of nuclear factor κB (NF-κB) signaling pathway [27]. Inhibition of
oo
f
NF-kB activation has been suggested as an anti-inflammatory strategy in UC [28]. As evaluated by western blot analysis in our study, colitis induced by DSS resulted in rapid activation of p-
pr
IκBα, p-Akt and p-p65 in colon tissues. In contrast, GOS inhibited activation of p-IκBα, p-Akt
e-
and p-p65 in colon tissues in colitis induced by DSS. These results indicated that GOS had
Pr
effects on suppression of NF-kB activation in DSS induced colitis. In addition, GOS mediated a reduction of the expression of pro-inflammatory cytokines (IL-
al
6, IL-18, IL-13 and IL-33). Upon induction of DSS colitis, NF-κB was activated and
rn
translocated to the nucleus of colon tissues, the place regulated the transcription of a series of
Jo u
genes [39]. In this study, we found that cytokines (IL-6, IL-18, IL-13 and IL-33) mRNA expression increased in the DSS colitis mice and GOS treatment could inhibit this up-regulation. These data suggested that GOS could inhibit the expression of pro-inflammatory cytokines in the colon of DSS colitis mice. In summary, these findings provide evidence that GOS could ameliorate DSS induced colitis. The underlying mechanism may be related to the regulation of intestinal flora and the inhibition of NF-κB activation. Thus GOS might act as a protective factor for acute colitis. Thus, we provide a theoretical basis for prevention of colitis. Conflict of interest None declared. 18
Journal Pre-proof Acknowledgments The authors would like to thank Yao Pan for excellent technical assistance. References [1] Cummings FJR, Jewell DP. Clinical implications of inflammatory bowel disease genetics on phenotype. Inflamm Bowel Dis 2005;11:56-61. [2] Ng SC, Bernstein CN, Vatn MH, Lakatos PL, Loftus EV, Tysk C, et al. Geographical variability and
oo
f
environmental risk factors in inflammatory bowel disease. Gut 2013;62:630-49.
pr
[3] Manichanh C, Borruel N, Casellas F, Guarner F. The gut microbiota in IBD. Nat Rev Gastro Hepat 2012;9:599-608.
e-
[4] ales-Campos H, Basso P J, Alves VBF, Fonseca, MTC, Bonfá G, Nardini V, Cardoso CRB. Classical and
Pr
recent advances in the treatment of inflammatory bowel diseases. Braz J Med Biol Res 2015;48:96-107.
rn
2010;45:571-83.
al
[5] Engel MA, Neurath MF. New pathophysiological insights and modern treatment of IBD. J Gastroenterol
Jo u
[6] Saleh M, Elson CO. Experimental inflammatory bowel disease: insights into the host-microbiota dialogue. Immunity 2011; 34:293-302.
[7] Abraham C, Medzhitov R. Interactions between the host innate immune system and microbes in inflammatory bowel disease. Gastroenterology 2011;140:1729-37. [8] amazaki SH, Machii K, Tsuyuki S, Momose H, Kawashima T, Ueda K. Immunological responses to monoassociated bifidobacterium longum and their relation to prevention of bacterial invasion. Immunology 1985;56:43-50. [9] Minoru F, Jun A, Shun'Ichiro T. The genus bifidobacterium for cancer gene therapy. Curr Opin Cell Biol 2002;5:200-3.
19
Journal Pre-proof
[10] Wirtz S, Neufert C, Weigmann B, Neurath MF. Chemically induced mouse models of intestinal inflammation. Nat Protoc 2007;2:541-6. [11] Yen CH, Kuo YW, Tseng YH, Lee MC, Chen HL. Beneficial effects of fructo-oligosaccharides supplementation on fecal bifidobacteria and index of peroxidation status in constipated nursing-home residents-a placebo-controlled, diet-controlled trial. Nutrition 2011;27:323-8.
f
[12] Yamazaki S, Machii K, Tsuyuki S, Momose H, Kawashima T, Ueda K. Immunological responses to
oo
monoassociated Bifidobacterium longum and their relation to prevention of bacterial invasion, Immunology
pr
1985;56:43-50.
e-
[13] Garrett WS, Gordon JI, Glimcher LH, Homeostasis and inflammation in the intestine, Cell 2010;140:859-
Pr
70.
[14] Gagliani N, Vesely MCA, Iseppon A, Brockmann L, Xu H, Palm NW, et al. Th17 cells transdifferentiate into
al
regulatory T cells during resolution of inflammation. Nature 2015;523:221-5.
Jo u
2010;16:1808-13.
rn
[15] Sarra M, Pallone F, Macdonald TT, Monteleone G. IL-23/IL-17 axis in IBD. Inflamm Bowel Dis
[16] Kryczek I, Liu R, Wang G, Ke W, Shu X, Szeliga W, et al. FOXP3 defines regulatory T cells in human tumor and autoimmune disease, Cancer Res 2009;69:3995-4000. [17] Atarashi K, Tanoue T, Shima T, Imaoka A, Kuwahara T, Momose Y, et al. Induction of colonic regulatory T cells by indigenous clostridium species. Science 2011: 331:337-41. [18] Reiff C, Kelly D, Inflammatory bowel disease, gut bacteria and probiotic therapy. Int J Med Microbiol 2010;300:25-33. [19] Sims JE, Smith DE, The IL-1 family: regulators of immunity. Nat Rev Immunol. 2010;10:89-102. [20] Sivakumar PV, Westrich GM, Kanaly S, Garka K, Born TL, Derry JM, et al. Interleukin 18 is a primary 20
Journal Pre-proof
mediator of the inflammation associated with dextran sulphate sodium induced colitis: blocking interleukin 18 attenuates intestinal damage. Gut 2002;50:812-20. [21] Liu H, Yao S, Dann SM, Qin H, Elson CO, Cong Y, ERK differentially regulates Th17-and Treg-cell development and contributes to the pathogenesis of colitis. Eur J Immunol. 2013;43:1716-26. [22] Arend WP, Palmer G, Gabay C, IL-1, IL-18, and IL-33 families of cytokines. Immunol Rev 2008;223:20-38.
f
[23] Pastorelli L, Garg RR, Hoang SB, Spina L, Mattioli B, Scarpa M, et al. Epithelial-derived IL-33 and its
oo
receptor ST2 are dysregulated in ulcerative colitis and in experimental Th1/Th2 driven enteritis. Proc Natl
pr
Acad Sci USA 2010;107:8017-22.
e-
[24] Erta M, Quintana A, Hidalgo J. Interleukin-6, a major cytokine in the centralnervous system. Int J Biol Sci
Pr
2012;8:1254–66.
[25] Fichtner Feigl S, Young CA, Kitani A, Geissler EK, Schlitt HJ, Strober W, IL-13 signaling via IL-13R alpha2
rn
2008;135:1-7.
al
induces major downstream fibrogenic factors mediating fibrosis in chronic TNBS colitis. Gastroenterology
Jo u
[26] Strober W, Fuss IJ, Heller F, Blumberg RS, Methods of treating and preventing colitis involving IL-13 and NK-T cells. U.S. Patent 7,666,411. 2010-2-23. [27] Kumar A, Wu H, Collier Hyams LS, Hansen JM, Li T, Yamoah K, et al. Commensal bacteria modulate cullin-dependent signaling via generation of reactive oxygen species. Embo J 2007;26:4457-66. [28] Atreya I, Atreya R, Neurath MF, NF-kappaB in inflammatory bowel disease. J Intern Med 2008;263:591-6. [29] Yan F, Wang L, Shi Y, Cao H, Liu L, Washington MK, et al. Berberine promotes recovery of colitis and inhibits inflammatory responses in colonic macrophages and epithelial cells in DSS-treated mice. Am J Physiol Gastrointest Liver Physiol 2011;302:G504-G514.
21
Journal Pre-proof
Highlights GOS ameliorated DSS induced colitis.
GOS could regulate intestinal flora and balance Th17/Treg cells.
GOS inhibited NF-κB activation, reduce secretion of inflammatory cytokines.
GOS might act as a protective candidate for acute colitis induced by DSS.
Jo u
rn
al
Pr
e-
pr
oo
f
22