Gastric Cancer and the High Combination Prevalence of Host Cytokine Genotypes and Helicobacter pylori in Honduras

CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2006;4:1103–1111

Gastric Cancer and the High Combination Prevalence of Host Cytokine Genotypes and Helicobacter pylori in Honduras DOUGLAS R. MORGAN,* RICARDO L. DOMINGUEZ,‡ TEMITOPE O. KEKU,* PARIS E. HEIDT,* CHRISTOPHER F. MARTIN,* JOSEPH A. GALANKO,* OLUWASEUN A. OMOFOYE,* and ROBERT S. SANDLER* *Department of Gastroenterology and Hepatology, University of North Carolina School of Medicine, Chapel Hill, North Carolina; and ‡Western Regional Hospital, Santa Rosa de Copan, Honduras

Background & Aims: Inflammatory cytokine polymorphisms are associated with gastric adenocarcinoma in Helicobacter pylori–infected patients in Europe and Asia. We investigated the cytokine profile in the Latino population, specifically Honduras, a high-incidence region, and the use of the combination prevalence of H pylori and genotypes in identifying high-risk populations. Methods: A population-based case-control study identified 170 incident gastric cancer cases and 162 healthy village controls. Interleukin (IL)-I␤-511, IL-1RN, IL-10-1082, and tumor necrosis factor-␣-308 genotypes were determined. We define the combination prevalence index (CPI) as the product of H pylori and IL-1␤511T⫹ genotype prevalence in healthy subjects. Medline identified gastric cancer studies to facilitate country-specific CPI calculations. Results: In healthy, population-based Honduran controls, IL1␤-511T⫹ prevalence was 81% (95% confidence interval, 75%– 87%; CT, 57%; TT, 25%), which was among the highest reported. IL-101082A⫹ prevalence was 93% (95% confidence interval, 88%–97%), mirroring Asian populations. Seventeen percent were homozygous for both proinflammatory cytokines (TT/AA), with increased risk among cases (odds ratio, 2.6; 95% confidence intervals, 1.0 – 6.8). Tumor necrosis factor-␣ polymorphisms were nearly absent. Endemic H pylori infection (85%) was confirmed. Importantly, the CPI association with country incidence is highly significant (P ⫽ .0057), based on 16 global populations and Honduras. Sensitivity analysis confirms a robust CPI. Conclusions: The CPI, based on IL-1␤ genotypes, has a strong association with country-specific gastric cancer incidence. The CPI correlation supports the chronic inflammation carcinogenesis model, and may explain the geographic variation. We report a novel cytokine profile in Honduras that mirrors Asian populations and explains the high incidence rates. This may have dyspepsia management and screening implications for the growing US Latino population.

G

astric cancer is a significant worldwide health problem, second only to lung cancer as the leading cause of cancer mortality, with approximately 800,000 new cases and 630,000 deaths annually.1–3 There is significant geographic variability. Areas of high incidence include Asia, Latin America, and Eastern Europe. In Latin America, the incidence ranges between 7 and 41 per 105 for men and between 4 and 31 per 105 for women.4 Western Honduras has been characterized as a region of high incidence with estimated standardized gastric cancer incidence rates for males and females of 39 and 21, respectively (per 105 world standard population, year 2000).5 In this 10-year analysis, nearly one quarter of cases occurred in people younger than the age of 50, with about 12% younger

than the age of 35. Approximately 40% of cases were advanced at the time of diagnosis, marked by pyloric obstruction. The true incidence may be higher given that a large percentage of the base population did not seek medical care and given the lack of a cancer screening program. Inflammatory cytokine polymorphisms have emerged as an important host factor in noncardia gastric adenocarcinoma in Helicobacter pylori–infected patients in Europe and Asia.6,7 The principal cytokines with functional single-nucleotide polymorphisms (SNPs) are interleukin 1␤ (IL-1␤), IL-1RN, IL-10, and tumor necrosis factor ␣ (TNF-␣).8 –10 The IL-10-1082 polymorphism may be the central functional IL-10 polymorphism, with the IL-10-1082A allele genotype labeled as the low producer, or proinflammatory phenotype.11 The current gastric adenocarcinoma multistage model proposes that the combination of the proinflammatory cytokine profile with childhood H pylori infection leads to sustained mucosal inflammation and hypochlorhydria. This combination, as well as additional downstream host and environmental factors, predisposes to gastric atrophy, intestinal metaplasia, and adenocarcinoma.12,13 Models of chronic inflammation with downstream factors leading directly to adenocarcinoma also have been proposed. Concurrent H pylori infection is vital to the attributable risk of these cytokine genotypes as a host factor.14 –16 In addition, carriage of multiple risk alleles, either homozygous variants or from multiple genes, increases gastric cancer risk from a relative risk of 2–3 with 1 allele, to 5 and 25 for 2 and 3 alleles, respectively.14 The background prevalence of polymorphisms in healthy populations of the United States and Europe is modest. For example, the prevalence of IL-I␤-511T⫹ is about 50% (TC, 10%–35%; TT, 4%–15%), and IL-10-1082A is less than 50% (AG, 5%–25%; AA, 5%–28%).14,17,18 IL-I␤ polymorphisms potentially represent the central host risk factor for gastric cancer in the setting of H pylori infection, with the remaining cytokine SNPs providing incremental risk.14,15,19 In addition, the promoter region IL-1␤ polymorphisms (-31C, -511T) have biologic plausibility, with demonstrated decreased acid production and increased mucosal IL-1␤ levels in human and animal models.10,20,21 In the majority of Abbreviations used in this paper: CPI, combination prevalence index; ELISA, enzyme-linked immunosorbent assay; IL, interleukin; PCR, polymerase chain reaction; SNP, single-nucleotide polymorphism; TNF, tumor necrosis factor. © 2006 by the American Gastroenterological Association (AGA) Institute 1542-3565/06/$32.00 doi:10.1016/j.cgh.2006.05.025

1104

MORGAN ET AL

CLINICAL GASTROENTEROLOGY AND HEPATOLOGY Vol. 4, No. 9

Table 1. Primer and Probe Sequences for Cytokine Genes Gene

SNP

dbSNP rs#

IL-1␤

C-511T

rs 16944

IL-1␤ RFLP assay

C-511T RFLP

IL-10-1082 A39G

A-1082G

rs 1800896

TNF-␣

G-308A

rs 1800629

IL1-RN RFLP assay

VNTR

Primer/probe

Sequence

Forward Reverse Probe 1 Probe 2 Forward Reverse Forward Reverse Probe 1 Probe 2 Forward Reverse Probe 1 Probe 2 Forward Reverse

GAGGCTCCTGCAATTGACAGA TCTCTACCTTGGGTGCTGTTCT VIC-CTGCCTCGGGAGCT FAM-CTGCCTCAGGAGCT 5= TGG CAT TGA TCT GGT TCA TC 3= 5= GTT TAG GAA TCT TCC CAC TT 3= CCAAGACAACACTACTAAGGCTTCT GCTGGATAGGAGGTCCCTTACTTTT VIC-CCCTACTTCCCCTTCCCAA FAM-CCCTACTTCCCCCTCCCAA CCAAAAGAAATGGAGGCAATAGGTT GGACCCTGGAGGCTGAAC VIC-CCCGTCCTCATGCC FAM-CCCGTCCCCATGCC 5=CTCAGCAACACTCCTAT3= 5=TCCTGGTCTGCAGGTAA3=

RFLP, restriction fragment length polymorphism.

studies, there is strong linkage disequilibrium between the -31C and -511T SNPs.6,20 The Lejondal H pylori – Gastric Cancer Task Force recently has recommended further investigation in other ethnic groups to confirm these observations and potentially identify important at-risk populations.22,23 The role of inflammatory cytokine polymorphisms in the Hispanic population is largely unknown.24,25 Population-based studies, particularly in the high gastric cancer incidence areas of Latin America and MesoAmerica (Mexico, Central America) are limited. We examined the prevalence of these host factors and H pylori infection to gain insight into the high rate of gastric cancer in Honduras. We characterize the Combination Prevalence Index (CPI) of population cytokine polymorphism and H pylori prevalence, and examine its use in predicting gastric cancer risk in Honduras and other global populations.

Materials and Methods Study Subjects We conducted a population-based case-control study centered in the Western province of Honduras, Central America. Subjects were enrolled between June, 2002 and September, 2004. This mountainous region has a racial mix of primarily Hispanic Mestizo (95%). Two small indigenous groups constitute the remaining 5% of the population (Lenca, Chorti). The Western Regional Hospital in Santa Rosa de Copan (Honduras) serves as the district facility for the region, with a catchment area of approximately 5000 square miles. Gastric cancer cases were enrolled in a prospective fashion from the Western Regional Hospital Endoscopy Unit. The diagnosis of gastric cancer was based on endoscopic appearance and confirmatory histopathology. For recruitment of healthy controls, a strict sampling protocol was used. Municipality mapping based on imagery from the United Nations Educational, Scientific and Cultural Organization (UNESCO), available through the Honduras Municipality Community Development Department, was used to facilitate systematic household identification and population-based sampling. Villages within a 50-mile radius of Western Regional

Hospital, with populations ranging from 3000 to 50,000, were included in the current study. The first appearing adult in every fifth household was enrolled. Household interviews were performed to obtain demographic data, health history, and risk factor assessment. Subjects with significant comorbidities, cancer history, gastrointestinal disease, or family history of stomach cancer were excluded. The current study was approved by the institutional review boards of the University of North Carolina and the Western Regional Hospital of Honduras.

Helicobacter pylori Infection H pylori status was determined by enzyme-linked immunosorbent assay (ELISA) immunoglobulin G serology (Premier H pylori; Meridian Bioscience, Cincinnati, OH). Serology may be the optimal measure of lifetime H pylori exposure with respect to gastric cancer risk.26,27 The accurate performance of the ELISA serology has been documented in high-prevalence populations and in Latin America.28 –30 In addition, a local external validation of the H pylori ELISA was performed in 44 healthy subjects. The gold standard for active infection was a positive biopsy examination result with either the rapid urease test (PyloriTek; Serin Research Corp, Elkhart, IN) or histology. The concordance between serology and biopsy examination methods was 85%, with only 1 false-positive ELISA result noted.

Genotyping Genomic DNA was extracted from peripheral blood lymphocytes using the PureGene DNA isolation kit (Gentra Systems, Minneapolis, MN). The IL-10-1082 A⬎G and TNF-␣308 G⬎A polymorphisms were genotyped using the 5= exonuclease TaqMan assay (Applied Biosystems, Foster City, CA). Primer and probe sequences are listed in Table 1. Probes were labeled on the 5= end with either VIC or FAM (PE Biosystems, Foster City, CA). Probes were labeled on the 3= end with quencher dye 6-carboxy-N,N,N=N,-tetramethylrhodamine. Polymerase chain reactions (PCRs) were performed in 15 ␮L reaction volume. Reactions contained .7⫻ Applied Biosystems universal master mix, 200 nmol/L of each allele-specific probe, 900 mmol/L of each primer, and 15 ng of genomic DNA. Amplifications were performed using Perkin-Elmer (Wellesley, MA)

September 2006

gene amp 9700. Reaction conditions were 50°C for 2 minutes, 95°C for 10 minutes, 40 cycles of 92°C for 15 seconds, and 60°C for 1 minute. Samples that failed to amplify were repeated and were scored as missing after a failed second amplification attempt. Genotyping was repeated on a random 10% sample for each gene and results were identical to original genotype calls. Genomic DNA samples from the Coriell tissue repository (http://coriell.umdnj.edu; Coriell Institute for Medical Research, Camden, NJ) that had been sequenced for the cytokine gene loci of interest were included in each assay as positive controls. Negative controls also were included in each assay run. Genetic sequences for the cytokines were obtained from journal publications and web resources (Database of Single Nucleotide Polymorphisms (dbSNP), http://www.ncbi.nlm.nih.gov/SNP/; SNP 500 Cancer, http://snp500cancer.nci.nih.gov). For IL-1␤-511C⬎T polymorphism, the initial assays on the first 100 specimens were performed by restriction length polymorphism using described methods.31–33 A fragment containing the -511 IL-1␤ polymorphism was amplified by PCR using the oligonucleotide primers listed in Table 1. PCR conditions were as follows: initial cycling at 95°C for 5 minutes, 35 cycles of 94°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, and finally 72°C for 7 minutes. Nontemplate controls and 3 positive amplification/genotype controls were included within each experimental run. The PCR products were subjected to Ava I restriction enzyme digestion for 3 hours at 37°C and analyzed by agarose gel (3%) electrophoresis. The IL-1␤-511 genetic polymorphism CC genotype was represented by 2 bands of 114 and 190 bp; IL-1␤-511 CT genotype was represented by 114-, 190-, and 304-bp bands; IL-1␤-511 TT genotype was represented by a single 304-bp band. Two reviewers who were blinded to the case/control status of the subjects determined the genotypes independently. The remaining samples were genotyped by the Taqman 5= exonuclease assay described earlier. In a subset of samples we compared the restriction fragment length polymorphism and the Taqman 5= exonuclease assay for IL-1␤511, with 100% concordant results. The intron 2 of the IL-1RN gene has an 86-bp variable number of tandem repeat polymorphism.32 The IL-1RN genotyping was performed by restriction fragment length polymorphism assay using a modification of published methods.31,33 The IL-1RN primers listed in Table 1 were used for PCR amplification under the following PCR cycling conditions: initial cycling at 94°C for 3 minutes, 2 cycles of 94°C for 1 minute, 63°C for 1 minute, 72°C for 1 minute, and 40 cycles of 94°C for 1 minute, 60°C for 1 minute, 72°C for 1 minute, and final extension at 72°C for 5 minutes. The PCR products were analyzed by agarose gel electrophoresis and the IL-1RN alleles were sized relative to a DNA ladder in steps of 100 bp and scored as follows: allele 1 ⫽ 410 bp (4 repeats), allele 2 ⫽ 240 bp (2 repeats), allele 3 ⫽ 500 bp (5 repeats), allele 4 ⫽ 325 bp (5 repeats), and allele 5 ⫽ 595 bp (6 repeats).

Combination Prevalence Index We propose the combined prevalence of H pylori infection and IL-1␤ proinflammatory alleles as a measure of cumulative exposure to identify populations at risk for gastric cancer. The CPI is defined as the product of the H pylori infection prevalence and the IL-1␤-511T⫹ allele prevalence in the population expressed as a percentage. Ideally, both are

LATINO GASTRIC CANCER GENETIC SUSCEPTIBILITY

1105

measured in healthy population-based controls. We calculated the CPI for other global populations and used linear regression to assess the correlation with gastric cancer incidence rates. A Medline search was used to identify Englishlanguage gastric cancer studies with sufficient information regarding H pylori and cytokine genotype prevalence in the control population. The Centers for Disease Control HuGENet database was used to corroborate existing studies. Studies with fewer than 100 subjects, with inpatient controls, and those of expatriate populations were excluded.25,34,35 Country- and region-specific gastric cancer incidence rates for males and females were obtained from the International Agency for Research on Cancer, using the GLOBOCAN 2002 and CI 5–VIII databases.4,36 Specific studies also were used to verify the regional incidence in China and Taiwan.7,37,38

Statistical Analysis Descriptive statistics were generated for categoric and continuous variables. Cases and controls were compared using a t test for continuous variables and the Fisher exact test for categoric variables. Logistic regression models were fit and odds ratios and 95% confidence intervals were generated for gene and allele effects. The ␹2 test was used to assess whether the frequencies of each polymorphism were in Hardy–Weinberg equilibrium. Statistical analyses were performed with SAS (version 8.1; SAS Institute, Cary, NC).

Results The descriptive characteristics of the study population are shown in Table 2. We enrolled 170 cancer patients and 162 population-based adult controls. The mean age of the gastric cancer patients was 62.8 years, with a 2.2:1 male:female ratio. The age of the patients ranged from 22 to 91 years. The majority of incident cancers were distal, localized in the antrum (51%), antrum/body (20%), and body (27%). Only 3 proximal cancers involving the cardia were observed. Nearly half of the patients presented with an element of pyloric obstruction, either complete (25%) or incomplete (21%). On histologic analysis, cases were divided evenly between diffuse (47%) and intestinal (47%), with 6% mixed subtype. The control population was weighted toward younger females, which reflects study volunteerism among healthy subjects in many cultures. Endemic H pylori infection in this region

Table 2. Descriptive Characteristics of Honduras Study Population Characteristics Mean age, y (range) ⬍45 45–59 ⬎60 Sex (%) Male Female H pylori infection (%) Positive Negative

Controls (n ⫽ 163)

Cases (n ⫽ 170)

52.9 (18–89) 53 (33%) 52 (32%) 57 (35%)

62.8 (22–91) 15 (9%) 45 (27%) 109 (64%)

68 (42) 94 (58)

116 (69) 53 (31)

122 (85) 22 (15)

131 (80) 33 (20)

1106

MORGAN ET AL

CLINICAL GASTROENTEROLOGY AND HEPATOLOGY Vol. 4, No. 9

Table 3. Cytokine Allele Frequencies Among Cases and Controls in Honduras

Cytokine IL-1␤-511 Genotype

Allele IL-10-1082 Genotype

Allele TNF␣-308 Genotype

Allele IL-1RN Genotype

Allele

Odds ratio Controls (%) Cases (%) (95% confidence Genotype n ⫽ 162 n ⫽ 170 interval)

CC CT TT CT⫹ TT C T

30 (18%) 92 (57%) 40 (25%) 132 (82%) 152 (47%) 172 (53%)

39 (23%) 73 (43%) 58 (34%) 131 (77%) 151 (44%) 189 (56%)

1.0 (reference) .6 (.3–1.1) 1.1 (.6–2.1) .8 (.4–1.3)

GG AG AA AG⫹AA A G

11 (7%) 49 (30%) 101 (63%) 150 (93%) 251 (78%) 71 (22%)

7 (4%) 42 (25%) 121 (71%) 163 (96%) 284 (84%) 56 (16%)

1.0 (reference) 1.3 (.5–3.8) 1.9 (.7–5.0) 1.7 (.6–4.5)

GG AG AA G A

149 (93%) 12 (7%) 0 (0%) 310 (96%) 12 (4%)

151 (90%) 17 (10%) 0 (0%) 319 (95%) 17 (5%)

1.0 (reference) 1.4 (.65–3.0) —

LL L2 22 L 2

56 (72%) 13 (17%) 9 (11%) 125 (80%) 31 (20%)

38 (54%) 22 (31%) 11 (15%) 98 (69%) 44 (31%)

1.0 (reference) 2.5 (1.1–5.6) 1.8 (.7–4.8)

NOTE. The sample size for IL-1RN is 71 cases and 78 controls randomly selected.

of Central America is evident, with 85% of controls positive, and without a difference noted between sexes. The H pylori prevalence remained stable across generations, with 83%, 94%, and 77% positive among those younger than age 45, 45– 60, and older than 60 years, respectively. This suggests early infection and lack of a cohort effect. The slightly lower prevalence among patients was not statistically significant (P ⫽ .30).

Cytokine Profile of Population-Based Controls The genotype frequencies for patients and controls for each analyzed cytokine are listed in Table 3. The prevalence of risk alleles observed in the general Honduran population is among the highest reported. The IL-1␤-511T⫹ prevalence in the control population was 82% (95% confidence interval, 75%– 87%) with CT 57%, TT 25%. The population IL-10-1082A⫹ prevalence was also very high, 93% (95% confidence interval, 88%–97%) with GA 30%, AA 63%. Gene– gene analysis showed that 89% of the general population in western Honduras carried at least 1 at-risk allele. More than 17% of the population was homozygotic for both at-risk alleles (TT/AA), and therefore at increased risk for gastric adenocarcinoma based on current literature.9,14 Only 1.2% carried low-risk genotypes (CC/GG). TNF-␣ polymorphisms were nearly absent in this Latino population. The TNF-␣-308AG prevalence was 7% among healthy controls, and without homozygotes (AA) found among cases or controls. Genetic data for the IL-1RN polymorphisms was limited to 71 patients and 78 controls, which were performed on a random subset.

The distributions for the cytokine polymorphisms among controls were reviewed for deviation from the Hardy–Weinberg equilibrium. The assays for IL-1␤-511, IL-10-1082, and TNF-␣308 were in Hardy–Weinberg equilibrium. Borderline deviation was noted for IL-1RN (P ⫽ .04). The IL-1RN assay was repeated on a random subset (10%) and found to be in 100% agreement.

Cytokine Profile of Gastric Cancer Patients Table 3 summarizes the potential associations between the cytokine alleles and gastric cancer in the Honduran population. No significant associations were found between individual risk alleles and gastric cancer. In addition, associations were absent between either the intestinal or diffuse subtypes of gastric cancer and the cytokine alleles. The exception is IL1RN⫹L2, for which associations with both gastric cancer overall (P ⫽ .065) and the intestinal subtype (P ⫽ .024) were observed, similar to previous studies in Europe and the United States.6,9,14 Differences between the sexes in allele frequencies were not observed either among cases or controls. Examination of the association of multiple IL-1␤ and IL-10 allele carriage and cancer is condensed in Table 4. The point estimates suggest a trend of increasing cancer risk with the presence of multiple risk alleles, although the statistical test for linear trend was not significant. As noted earlier, 17% of the population was homozygous for both risk alleles, which was associated with an odds ratio for cancer of 2.6 (95% confidence interval, 1.0 – 6.8). The width of the confidence interval reflects the high prevalence of risk alleles in this population relative to the sample size.

Combination Prevalence Index There were 24 distinct populations reported in 22 gastric cancer studies identified in the English literature per the outlined criteria.5–7,14,17,18,24,34,37–50 Sufficient information was available to calculate the CPI in 14 populations, including the current one, which is summarized in Table 5. Most of the control subjects were recruited as volunteers, screening program participants, or blood donors. Only 2 other studies used a population-based design. Most of the investigations used serology to determine H pylori prevalence. The linear regression of gastric cancer incidence vs CPI is presented in Figure 1. Portugal and Poland also are included in Figure 1, using EUROGAST Study Group H pylori prevalence data to calculate the CPI.51 A strong association was observed (P ⫽ .0057), with a CPI based on IL-1␤-511T⫹ prevalence. Limiting the analysis to

Table 4. Risk of Gastric Cancer and Multiple Allele Carriage for IL-1␤-511 and IL-10-1082 Risk allele combinations

Controls (%)

Cases (%)

Odds ratio (95% confidence interval)

Low risk Moderate risk High risk (TT/AA)

15 (9%) 119 (74%) 27 (17%)

9 (5%) 119 (70%) 42 (25%)

1.0 (reference) 1.7 (.7–4.0) 2.6 (1.0–6.8)

NOTE. Allele combinations for IL-1␤-511C ⬎ T and IL-10-1082G ⬎ A, respectively. Low-risk haplotypes are defined as CC with GG or GA, high risk is the TT/AA haplotype. Moderate risk is defined by the intermediate gene– gene combinations: CC/AA, CT/G⫹ or A⫹, and TT/G⫹.14

September 2006

LATINO GASTRIC CANCER GENETIC SUSCEPTIBILITY

1107

Table 5. Global Gastric Cancer Incidence Versus Combination Prevalence Index IL-1␤-511 genotype Country Honduras United States Jiangsu, China Guangdong, China Shanxi, China Taiwan South Korea Shangdong, China Brazil Southern Italy Northern Italy Mexico Germany Japan Poland Portugal Portugal Portugal South Korea South Korea China

Author

El Omar 2003 Yang Zeng Zeng Chen Chang Lu Rocha Perri Perri Garza-Gonzalez Rad Kato El-Omar 2000 Machado 2003 Machado 2001 Figueiredo SG Lee KA Lee Zhang

Control recruitment

Sample size

H pylori prevalence

TT, %

T⫹, %

CPI

Combined gastric cancer incidence

A A A B B B B B B B B C C C B B

162 210 258 192 169 164 434 300 536 150 216 215 210 324 429 306

85 40 63.6 34.9 49.1 48.2 62.4 65 68.5 68 71 54 27.9 64.8 NR NR

25 4 25.2 14.4 22.5 22.6 23.5 23.3 30.2 6.5 13 20.7a 9 24.4 10.7 13.1

82 50 77.9 54.7 79.9 79.3 80 77.6 79.3 54.4 59 61.2a 51.4 77.1 49.4 55.2

70 20 49.5 19.1 39.2 38.2 49.9 50.5 54.3 37 41.9 33 14.3 50 (38.4) (34.8)

30.0 5.3 30.2 12.3 18.5 13.5 48.3 30.2 14.7 9.0 20.5 11.3 12 44.1 14.3 20.6

B

220

NR

14.2

54.1

—

C B B B

136 172 331 166

NR NR NR NR

NR 22.1a 30.0 31.3

55.1 76.8a 78.1 74.1

— — — —

NOTE. The Combination Prevalence Index (CPI) is calculated as the product of the control population prevalence of H pylori infection and IL-1␤-511T⫹ prevalence expressed as a percentage. Country- and region-specific gastric cancer incidence for males and females is from the IARC, expressed as combined annual standardized incidence per 105 population. The CPI is calculated for Poland and Portugal using H pylori prevalence data from EUROGAST, as noted in the text. Control group recruitment: A, population based; B, asymptomatic subjects (volunteers, blood donors, screening program); C, symptomatic subjects undergoing endoscopy (dyspepsia, etc). NR, not reported. aPolymorphism frequencies are reported for IL-1␤-31C.

the 14 populations with complete control population information did not change the strength of the correlation (P ⫽ .01). In general terms, a CPI of more than 40% predicts a moderate- to high-risk gastric cancer population. The correlation likely becomes nonlinear for CPIs greater than 55% and combined cancer incidences greater than 40 per 105 (⬎50 per 105 in males). A sensitivity analysis was performed with respect to alleles, sex, and region for the 14 populations. The correlation remained significant with the CPI calculation based on IL-1␤511TT prevalence (P ⫽ .16). The CPI relationship is robust with respect to total rates, and male and female regional gastric cancer incidence rates (P ⫽ .010, .014, and .0054, respectively). The inclusion or exclusion of single countries did not affect the strength of the relationship. Importantly, in this group of studies, the association with region-specific cancer incidence is strongest for the combination prevalence (P ⫽ .010), vs either H pylori prevalence alone (P ⫽ .071) or IL-1␤-551T⫹ prevalence alone (P ⫽ .032). This sensitivity analysis was unchanged with the inclusion of Poland and Portugal.

Discussion Gastric cancer is an important global public health problem, representing the second leading cause of cancer mortality. The association of proinflammatory cytokine genotypes with gas-

tric cancer has elucidated the important gene– environment interaction early in the carcinogenesis pathway. The IL-1␤ polymorphisms, acting in concert with H pylori infection, are central in setting up sustained chronic inflammation and hypochlorhydria, to facilitate downstream host and environmental risk factors.13,16 We show that cytokine polymorphisms, important in Asia, Europe, and the United States, also are associated with gastric adenocarcinoma in Latin America. We also show that the combination of host genotype and H pylori infection prevalence is predictive of gastric cancer risk in global populations. This underscores host– bacteria synergy in the chronic inflammation to cancer model.

Gastric Cancer in Honduras Population-based studies of gastric cancer–associated cytokine polymorphisms in Latin America and the Westernhemisphere Latino population are limited. In the general Honduran population, we observed a surprisingly high prevalence of the risk alleles IL-1␤-511T and IL-10-1082A in combination with endemic H pylori infection. More than 17% of the general population carries all 4 risk alleles (TT, AA), with significant cancer risk (odds ratio, ⬎10) based on the global literature.7,14 This characterizes this Central American population as one with endemic gastric cancer susceptibility,

1108

MORGAN ET AL

CLINICAL GASTROENTEROLOGY AND HEPATOLOGY Vol. 4, No. 9

Figure 1.

Correlation between population gastric cancer incidence and the CPI. The CPI is defined as the product of the H pylori prevalence and the IL-1␤-511T⫹ prevalence, expressed as a percentage, in the population of interest. A significant association is noted between the country-specific CPI and gastric cancer incidence for 16 populations (P ⫽ .0057). Gastric cancer incidence, combined for males and females, is obtained from the International Agency for Research on Cancer. GU, Guangdong; SX, Shanxi; JI, Jiangsu; SH, Shangdong; N, northern Italy; S, southern Italy. ●, Country; —, fitted values (F ⫽ 10.60, P ⫽ .0057).

and underscores the importance of cytokine polymorphisms in Latino populations in the Western hemisphere. We did not find significant associations between individual proinflammatory alleles and gastric cancer. An absence of independent risk for these alleles has been observed in other populations with a high incidence of stomach cancer. In the study by Zeng et al,7 in high- and low-incidence gastric cancer regions in China, a significant association for IL-1␤-511T was observed only in the low-incidence area. This is caused, at least in part, by the larger sample size required in populations with a high background prevalence of at-risk genotypes. In Latin America, Garza-Gonzalez et al24 found a positive association of IL-1␤-31 polymorphisms and gastric cancer in a lower-incidence region in Mexico by using a symptomatic referral control group. Recently, Sicinschi et al25 reported borderline associations of cytokine polymorphisms (IL-1␤-31 P ⫽ .15, and IL-10-592 P ⫽ .05) with intestinal gastric cancer in a pooled hospital-based case-control study from 3 regions in Mexico. However, a significant association with the intestinal subtype was noted in subjects with multiple risk alleles (P ⫽ .01), and in subjects who were both IL-1␤-31C and H pylori cagA positive (P ⫽ .02). Our results are consistent with these observations. We did, however, observe significantly increased risk (odds ratio, 2.6; 95% confidence interval, 1.0 – 6.8) for persons with multiple risk alleles in Honduras (IL-1␤-511TT, IL10-1082AA). This supports a dose-effect model of proinflammatory at-risk alleles promoting carcinogenesis in the presence of high population H pylori exposure. The odds ratio of 2.6 likely underestimates the true strength of the interaction because it does not incorporate H pylori exposure in the model. We were unable to estimate this interaction reliably because any estimate is likely

to be unstable given the high prevalence of H pylori, leading to small numbers of unexposed patients and controls. The A allele of the functional IL-10-1082 polymorphism is related to the IL-10 low-producer phenotype. It occurs in strong linkage disequilibrium with other IL-10 SNPs, -592 C⬎A and -819 C⬎T. This Hispanic population has a high prevalence of the proinflammatory phenotype because 93% of the population has an -1082A⫹ genotype. This is similar to the reported allelic frequencies in the Asian populations, and distinct from Caucasian populations.11,14,39 This supports the notion that regions of MesoAmerica were populated from Asia in early human migrations. It also suggests that gastric cancer screening should mirror Asian programs in parts of MesoAmerica and for the US Hispanic immigrant population from these regions. The TNF-␣-308A allele, given its rarity (3.7%), is not a strong determinant of gastric cancer susceptibility in this population. Again, this is similar to certain Asian regions, and in contrast to Western populations, in which TNF-␣-308A⫹ prevalence is 20%–30%.14,39 The frequency of the IL-1–receptor antagonist SNPs in the Honduran population is similar to that in the US and European Caucasian populations, and may confer risk in individuals, but not the general population. High-risk populations such as Honduras present an ideal setting to investigate additional etiologic factors and cancer promoters that are detrimental in the setting of chronic gastric inflammation arising from H pylori and inflammatory allele polymorphisms. For instance, dietary and other environmental factors that do not affect risk in persons without H pylori exposure or cytokine mutations can be investigated adequately only in settings in which these exposures are highly endemic.

September 2006

Clearly other risk factors must be operative given the consistent worldwide gender differences.

Limitations This study was limited in its ability to accurately estimate the strength of the interaction between H pylori and proinflammatory alleles. Given the high prevalence of both factors, our sample size was capable only of detecting strong interactions. Even for the less common IL-1␤-511TT–H pylori interaction, our sample was capable of detecting an interaction of 6 times the expected risk for the combined exposure. In addition, the current analysis did not incorporate bacterial factors, such as cagA and vacA. Virulence factors have been shown to increase risk, although they may not overshadow the combination of host genetics and infection.16,47 In addition, the study did not evaluate the role of helminth infections in this population. Helminthic parasites may modulate the proinflammatory T-cell response and in turn gastric cancer susceptibility in the developing-nation setting.52 Our statistical power also was affected by potential misclassification of H pylori exposure among patients owing to limitations of H pylori diagnosis and the ELISA serology in the setting of gastric cancer, particularly advanced cases. Serology remains the optimal measure of cumulative H pylori exposure in gastric cancer.26,27 Although this test is reliable in our healthy controls, as confirmed by our external validation using ELISA, as well as in other high-prevalence populations, the presence of disease can lead to false-negative results.28,53,54 Organism loss occurs with the onset and progression of cancer because the mucosal microenvironment becomes less favorable to bacteria survival.6,40,55,56 In addition, seroreversion may occur with cancer-related immunosuppression or advancing age.3,16,57 In our patient population from rural central America, the majority of the patients present with advanced disease with presumptive immunosuppression. In summary, the lower rate of H pylori infection among cancer patients, albeit nonsignificant, was expected. This, along with the high background risk cytokine prevalence, precludes the estimation of the strength of the interaction between H pylori and individual proinflammatory alleles at the subject level in our population.

Combination Prevalence Index The postulated interaction between H pylori and proinflammatory risk alleles suggests a useful framework to assess and compare population risk for gastric cancer. We report a strong correlation between the CPI and regional gastric cancer incidence in Figure 1 (P ⫽ .01). The sensitivity analysis shows the robust nature of the relationship. The significant CPI correlation is stronger than for either factor alone, and argues for enhanced inflammation in the host genetic-bacteria interaction. This may help explain the H pylori African enigma and Asian paradox, more accurately labeled the gastric cancer geographic paradox.58 – 60 Validation of the CPI will require population-based dual-prevalence studies in specific regions. Incorporation of other cytokines or bacterial virulence factors may improve the model. This index may have a use for identifying at-risk subgroups (eg, dyspepsia) in specific countries in an efficient manner.

LATINO GASTRIC CANCER GENETIC SUSCEPTIBILITY

1109

Implications for the Latino Population The identification of endemic genetic susceptibility in this region has important public health implications. We have shown that identification of a high-risk population is possible in a rural area in the context of limited resources of a developing nation. A gastric cancer prevention program, appropriate to the resources of the region, is imperative. Within the framework of a demonstration project or permanent program this may take various forms, such as screening endoscopy, H pylori eradication, or an H pylori vaccine trial. The findings may have gastric cancer screening and dyspepsia management implications for the US Latino population. The 2003 US Census documents that 83% of the US Hispanic population has immigrated from MesoAmerica. This trend will continue, and by 2040, approximately 25% of the US population will be of Latino origin. Our study population is 95% Mestizo, with presumptive racial, cultural, and genetic similarities to a significant percentage of recent immigrants. Gastric cancer screening with endoscopy may be warranted for immigrants from high-incidence regions of MesoAmerica. The cytokine polymorphism pattern that mirrors Asian populations underscores this notion. In addition, the algorithm for the management of dyspepsia might include early endoscopy or “Test and Scope” (H pylori testing with endoscopy for positive patients) as an option for this population. In summary, we have shown endemic gastric cancer genetic susceptibility in Honduras, explaining the high rates of gastric cancer in the region. In addition, we define the CPI, incorporating H pylori and cytokine genotype status, and showed that it is predictive of global gastric cancer incidence. If validated, targeted determination of the CPI for Latino populations in the United States may be worthwhile, and appropriate for evaluation in the setting of a future study. References 1. Parkin DM, Pisani P, Ferlay J. Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer 1999;80:827– 841. 2. Parkin DM, Pisani P, Ferlay J. Global cancer statistics. CA Cancer J Clin 1999;49:1, 33– 64. 3. Hohenberger P, Gretschel S. Gastric cancer. Lancet 2003;362: 305–315. 4. Ferlay J, Bray F, Pisani P, et al. GLOBOCAN 2002: cancer incidence, mortality and prevalence worldwide. IARC CancerBase no. 5, version 2.0. Lyon, France: IARC Press, 2004. 5. Dominguez R, Morgan DR. High incidence of gastric cancer in western Honduras. Fourth International Gastric Cancer Congress. A322. International Gastric Cancer Association, New York, NY, 2001. 6. El-Omar EM, Carrington M, Chow WH, et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature 2000;404:398 – 402. 7. Zeng ZR, Hu PJ, Hu S, et al. Association of interleukin 1B gene polymorphism and gastric cancers in high and low prevalence regions in China. Gut 2003;52:1684 –1689. 8. El-Omar EM, Chow WH, Gammon MD, et al. Pro-inflammatory genotypes of IL-1B, TNF-a, and IL-10 increase the risk of gastric cancer but not cardia or esophageal adenocarcinoma. Gastroenterology 2001;120(Suppl 1):A86. 9. Peek RM Jr, Blaser MJ. Helicobacter pylori and gastrointestinal tract adenocarcinomas. Nat Rev 2002;2:28 –37. 10. Peek RM Jr. Helicobacter pylori strain-specific modulation of gas-

1110

11.

12. 13. 14.

15.

16. 17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

MORGAN ET AL

tric mucosal cellular turnover: implications for carcinogenesis. J Gastroenterol 2002;37(Suppl 13):10 –16. Rees LE, Wood NA, Gillespie KM, et al. The interleukin-10-1082 G/A polymorphism: allele frequency in different populations and functional significance. Cell Mol Life Sci 2002;59:560 –569. Correa P, Piazuelo MB, Camargo MC. The future of gastric cancer prevention. Gastric Cancer 2004;7:9 –16. Merchant JL. Inflammation, atrophy, gastric cancer: connecting the molecular dots. Gastroenterology 2005;129:1079 –1082. El-Omar EM, Rabkin CS, Gammon MD, et al. Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology 2003;124:1193– 1201. Yang J, Hu Z, Xu Y, et al. Interleukin-1B gene promoter variants are associated with an increased risk of gastric cancer in a Chinese population. Cancer Lett 2004;215:191–198. Kikuchi S. Epidemiology of Helicobacter pylori and gastric cancer. Gastric Cancer 2002;5:6 –15. Rad R, Prinz C, Neu B, et al. Synergistic effect of Helicobacter pylori virulence factors and interleukin-1 polymorphisms for the development of severe histological changes in the gastric mucosa. J Infect Dis 2003;188:272–281. Garcia-Gonzalez MA, Lanas A, Savelkoul PH, et al. Association of interleukin 1 gene family polymorphisms with duodenal ulcer disease. Clin Exp Immunol 2003;134:525–531. Chen A, Li CN, Hsu PI, et al. Risks of interleukin-1 genetic polymorphisms and Helicobacter pylori infection in the development of gastric cancer. Aliment Pharmacol Ther 2004;20:203– 211. Hwang IR, Kodama T, Kikuchi S, et al. Effect of interleukin 1 polymorphisms on gastric mucosal interleukin 1beta production in Helicobacter pylori infection. Gastroenterology 2002;123: 1793–1803. Takashima M, Furuta T, Hanai H, et al. Effects of Helicobacter pylori infection on gastric acid secretion and serum gastrin levels in Mongolian gerbils. Gut 2001;48:765–773. Malfertheiner P, Sipponen P, Naumann M, et al. Helicobacter pylori eradication has the potential to prevent gastric cancer: a state-of-the-art critique. Am J Gastroenterol 2005;100: 2100 –2115. Furuta T, Shirai N, Sugimoto M. Controversy in polymorphisms of interleukin-1beta in gastric cancer risks. J Gastroenterol 2004; 39:501–503. Garza-Gonzalez E, Bosques-Padilla FJ, El-Omar E, et al. Role of the polymorphic IL-1B, IL-1RN and TNF-A genes in distal gastric cancer in Mexico. Int J Cancer 2005;114:237–241. Sicinschi LA, Lopez-Carrillo L, Camargo MC, et al. Gastric cancer risk in a Mexican population: role of Helicobacter pylori CagA positive infection and polymorphisms in interleukin-1 and -10 genes. Int J Cancer 2006;118:649 – 657. Storskrubb T, Aro P, Ronkainen J, et al. A negative Helicobacter pylori serology test is more reliable for exclusion of premalignant gastric conditions than a negative test for current H. pylori infection: a report on histology and H. pylori detection in the general adult population. Scand J Gastroenterol 2005;40:302–311. Kokkola A, Rautelin H, Puolakkainen P, et al. Diagnosis of Helicobacter pylori infection in patients with atrophic gastritis: comparison of histology, 13C-urea breath test, and serology. Scand J Gastroenterol 2000;35:138 –141. Chiba N, Veldhuyzen van Zanten SJ. 13C-Urea breath tests are the noninvasive method of choice for Helicobacter pylori detection. Can J Gastroenterol 1999;13:681– 683. Garza-Gonzalez E, Bosques-Padilla FJ, Tijerina-Menchaca R, et al. Comparison of endoscopy-based and serum-based methods for the diagnosis of Helicobacter pylori. Can J Gastroenterol 2003; 17:101–106. Hodgson MI, Pantoja H, Latorre JJ, et al. Helicobacter pylori-

CLINICAL GASTROENTEROLOGY AND HEPATOLOGY Vol. 4, No. 9

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

associated gastroduodenal disease in symptomatic Chilean children: diagnostic value of serological assay. J Pediatr Gastroenterol Nutr 1995;21:263–268. Furuta T, El-Omar EM, Xiao F, et al. Interleukin 1beta polymorphisms increase risk of hypochlorhydria and atrophic gastritis and reduce risk of duodenal ulcer recurrence in Japan. Gastroenterology 2002;123:92–105. Mansfield JC, Holden H, Tarlow JK, et al. Novel genetic association between ulcerative colitis and the anti-inflammatory cytokine interleukin-1 receptor antagonist. Gastroenterology 1994;106: 637– 642. Tarlow JK, Blakemore AI, Lennard A, et al. Polymorphism in human IL-1 receptor antagonist gene intron 2 is caused by variable numbers of an 86-bp tandem repeat. Hum Genet 1993;91: 403– 404. Gatti LL, Burbano RR, de Assumpcao PP, et al. Interleukin-1beta polymorphisms, Helicobacter pylori infection in individuals from Northern Brazil with gastric adenocarcinoma. Clin Exp Med 2004; 4:93–98. Uno M, Ito LS, Oba-Shinjo SM, et al. Possible association of interleukin 1B C-31T polymorphism among Helicobacter pylori seropositive Japanese Brazilians with susceptibility to atrophic gastritis. Int J Mol Med 2004;14:421– 426. Parkin DM, Whelan SL, Ferlay J, et al. Cancer incidence in five continents. Vol. I to VII, IARC Cancer Base No. 7, Lyon, France, 2005. Chen CJ, You SL, Lin LH, et al. Cancer epidemiology and control in Taiwan: a brief review. Jpn J Clin Oncol 2002;32(Suppl):S66 – S81. Yang L, Parkin DM, Ferlay J, et al. Estimates of cancer incidence in China for 2000 and projections for 2005. Cancer Epidemiol Biomarkers Prev 2005;14:243–250. Lu W, Pan K, Zhang L, et al. Genetic polymorphisms of interleukin (IL)-1B, IL-1RN, IL-8, IL-10 and tumor necrosis factor ␣ and risk of gastric cancer in a Chinese population. Carcinogenesis 2005; 26:631– 636. Kato S, Onda M, Yamada S, et al. Association of the interleukin-1 beta genetic polymorphism and gastric cancer risk in Japanese. J Gastroenterol 2001;36:696 – 699. Chang YW, Jang JY, Kim NH, et al. Interleukin-1B (IL-1B) polymorphisms and gastric mucosal levels of IL-1beta cytokine in Korean patients with gastric cancer. Int J Cancer 2005;114:465– 471. Rocha GA, Guerra JB, Rocha AM, et al. IL1RN polymorphic gene and cagA-positive status independently increase the risk of noncardia gastric carcinoma. Int J Cancer 2005;115:678 – 683. Perri F, Piepoli A, Bonvicini C, et al. Cytokine gene polymorphisms in gastric cancer patients from two Italian areas at high and low cancer prevalence. Cytokine 2005;30:293–302. Machado JC, Figueiredo C, Canedo P, et al. A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology 2003;125:364 –371. Zambon CF, Basso D, Navaglia F, et al. Helicobacter pylori virulence genes and host IL-1RN and IL-1beta genes interplay in favouring the development of peptic ulcer and intestinal metaplasia. Cytokine 2002;18:242–251. Machado JC, Pharoah P, Sousa S, et al. Interleukin 1B and interleukin 1RN polymorphisms are associated with increased risk of gastric carcinoma. Gastroenterology 2001;121:823– 829. Figueiredo C, Machado JC, Pharoah P, et al. Helicobacter pylori and interleukin 1 genotyping: an opportunity to identify high-risk individuals for gastric carcinoma. J Natl Cancer Inst 2002;94: 1680 –1687. Lee KA, Ki CS, Kim HJ, et al. Novel interleukin 1beta polymorphism increased the risk of gastric cancer in a Korean population. J Gastroenterol 2004;39:429 – 433. Lee SG, Kim B, Choi W, et al. Lack of association between pro-inflammatory genotypes of the interleukin-1 (IL-1B -31 C/⫹

September 2006

50.

51.

52.

53.

54. 55.

56. 57.

58.

and IL-1RN *2/*2) and gastric cancer/duodenal ulcer in Korean population. Cytokine 2003;21:167–171. Zhang WH, Wang XL, Zhou J, et al. Association of interleukin-1B (IL-1B) gene polymorphisms with risk of gastric cancer in Chinese population. Cytokine 2005;30:378 –381. EUROGAST. An international association between Helicobacter pylori infection and gastric cancer. The EUROGAST Study Group. Lancet 1993;341:1359 –1362. Fox JG, Beck P, Dangler CA, et al. Concurrent enteric helminth infection modulates inflammation and gastric immune responses and reduces helicobacter-induced gastric atrophy. Nat Med 2000;6:536 –542. Ho B, Marshall BJ. Accurate diagnosis of Helicobacter pylori. Serologic testing. Gastroenterol Clin North Am 2000;29:853– 862. Vaira D, Vakil N. Blood, urine, stool, breath, money, and Helicobacter pylori. Gut 2001;48:287–289. Tang YL, Gan RL, Dong BH, et al. Detection and location of Helicobacter pylori in human gastric carcinomas. World J Gastroenterol 2005;11:1387–1391. McGuigan JE. Helicobacter pylori: the versatile pathogen. Dig Dis 1996;14:289 –303. Fabris P, Bozzola L, Benedetti P, et al. H. pylori infection in HIV-positive patients. A serohistological study. Dig Dis Sci 1997; 42:289 –292. Matsukura N, Yamada S, Kato S, et al. Genetic differences in

LATINO GASTRIC CANCER GENETIC SUSCEPTIBILITY

1111

interleukin-1 betapolymorphisms among four Asian populations: an analysis of the Asian paradox between H. pylori infection and gastric cancer incidence. J Exp Clin Cancer Res 2003;22:47–55. 59. Holcombe C. Helicobacter pylori: the African enigma. Gut 1992; 33:429 – 431. 60. Agha A, Graham DY. Evidence-based examination of the African enigma in relation to Helicobacter pylori infection. Scand J Gastroenterol 2005;40:523–529.

Address reprint requests to: Douglas Morgan, MD, MPH, CB#7080, University of North Carolina—Chapel Hill, Chapel Hill, North Carolina 27599-7080. e-mail: [email protected]. Supported by National Institutes of Health grant P30 DK 034987, GlaxoSmithKline Institute for Digestive Health, and a National Institutes of Health Mentored Scholars Research Award (K12 RR17667). The authors wish to express gratitude for the significant support from the following individuals and institutions: Hospital de Occidente and Ministry of Health (Marco Bones, Director; Gloria Fajardo, Nydia Alarcón, Carmen Ramos, Aidé Hernandez, and Carlos Claudino), Pathology (Francisco Herrera, Amado Rodriguez), Central American Medical Outreach (Kathy Tschiegg, Director; Lesby Castellanos, Norma Lemos), Research Staff (Beth Lynn Hocutt, Dara McGinn, Michael Clark-Pearson, Kayla Feld), and the City of Santa Rosa de Copan (Juan Carlos Elvir, Mayor).