GATA4 Is Sufficient to Establish Jejunal Versus Ileal Identity in the Small Intestine

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

ORIGINAL RESEARCH GATA4 Is Sufficient to Establish Jejunal Versus Ileal Identity in the Small Intestine Q34

Cayla A. Thompson,1 Kevin Wojta,1 Kirthi Pulakanti,2 Sridhar Rao,1,2,3 Paul Dawson,4 and Michele A. Battle1 1

Department of Cell Biology, Neurobiology and Anatomy, 3Division of Pediatric Hematology, Oncology, and Blood and Marrow Transplant, Medical College of Wisconsin, Milwaukee, Wisconsin; 2Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin; 4Department of Pediatrics, Emory University, Atlanta, Georgia

SUMMARY GATA4 establishes jejunal enterocyte identity and represses ileal enterocyte identity in the intestine, likely through direct activation and repression of expression of key regional-specifying genes. One important GATA4 target is fibroblast growth factor 15, a key regulator of enterohepatic bile acid cycling.

Q5

BACKGROUND & AIMS: Patterning of the small intestinal epithelium along its cephalocaudal axis establishes 3 functionally distinct regions: duodenum, jejunum, and ileum. Efficient nutrient assimilation and growth depend on the proper spatial patterning of specialized digestive and absorptive functions performed by duodenal, jejunal, and ileal enterocytes. When enterocyte function is disrupted by disease or injury, intestinal failure can occur. One approach to alleviate intestinal failure would be to restore lost enterocyte functions. The molecular mechanisms determining regionally defined enterocyte functions, however, are poorly delineated. We previously showed that GATA4 is essential to define jejunal enterocytes. The goal of this study was to test the hypothesis that GATA4 is sufficient to confer jejunal identity within the intestinal epithelium.

METHODS: To test this hypothesis, we generated a novel Gata4 conditional knock-in mouse line and expressed GATA4 in the ileum, where it is absent. RESULTS: We found that GATA4-expressing ileum lost ileal identity. The global gene expression profile of GATA4expressing ileal epithelium aligned more closely with jejunum and duodenum rather than ileum. Focusing on jejunal vs ileal identity, we defined sets of jejunal and ileal genes likely to be regulated directly by GATA4 to suppress ileal identity and promote jejunal identity. Furthermore, our study implicates GATA4 as a transcriptional repressor of fibroblast growth factor 15, which encodes an enterokine that has been implicated in an increasing number of human diseases. CONCLUSIONS: Overall, this study refines our understanding of an important GATA4-dependent molecular mechanism to pattern the intestinal epithelium along its cephalocaudal axis by elaborating on GATA4’s function as a crucial dominant molecular determinant of jejunal enterocyte identity. Microarray data from this study have been deposited into NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) and are accessible through GEO series accession number GSE75870. (Cell Mol Gastroenterol Hepatol 2017;-:-–-; http://dx.doi.org/10.1016/ j.jcmgh.2016.12.009)

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:51 pm
ce DVC

59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116

2

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

Keywords: Transcriptional Regulation; Jejunal Identity; 117 Enterohepatic Signaling; Fgf15; FXR. 118 119 120 he small intestine is composed of duodenum, 121 Q6 jejunum, and ileum. Enterocytes within each 122 123 Q7 perform specialized functions dictated by their position 124 Q8 along the cephalocaudal axis to mediate digestion and assimilation absorption of nutrients, vitamins, and fluids to 125 sustain growth, hydration, and electrolyte balance. 126 Duodenal enterocytes are specialized to complete the 127 digestive process.1 Enzymes secreted from the pancreas as 128 well as bile synthesized by liver and stored by the gall 129 bladder enter the duodenum and combine with enzymes 130 secreted by the duodenal enterocytes to facilitate digestion. 131 Jejunal enterocytes accomplish the bulk of nutrient uptake 132 by absorbing digestive products, namely lipid–bile acid 133 emulsions, sugars, and oligopeptides/amino acids.1,2 In 134 addition to absorbing vitamin B12, ileal enterocytes play a 135 critical role in maintaining the enterohepatic circulation of 136 bile acids and in regulating bile acid metabolism.1,2 Ileal 137 enterocytes absorb bile acids from the intestinal lumen, and 138 bile acids travel via the portal circulation from the intestine 139 to the liver, where they are taken up and re-secreted 140 into bile. Uptake of bile acids by ileal enterocytes activates 141 farnesoid X receptor (FXR)-mediated transactivation of 142 genes encoding proteins required for enterocyte bile acid 143 transport including fatty acid binding protein 6 (Fabp6), 144 solute carrier (Slc)51a (Osta), Slc51b (Ostb), and the 145 secreted enterokine fibroblast growth factor (Fgf)15/19.3–6 146 Binding of FGF15/19 to its receptors on hepatocytes 147 represses expression of cytochrome P450 family 7 sub148 family A member 1 (Cyp7a1), the rate-limiting enzyme in 149 conversion of cholesterol to bile acids, to control hepatic bile 150 acid synthesis.4,5 Moreover, bile acids and FGF15/19 may 151 function in the regulation of energy expenditure and lipid 152 and carbohydrate metabolism.7–9 As such, the importance of 153 bile acid enterohepatic cycling and homeostasis extends 154 beyond intestinal function, and defects in enterohepatic 155 FGF15/19 signaling have been linked to human diseases 156 including cholestatic liver disease, nonalcoholic fatty liver 157 disease, type 2 diabetes, metabolic syndrome, Crohn’s dis158 ease, bile acid malabsorption, and bile acid diarrhea.7–11 159 Disruption of enterocyte functions caused by Crohn’s 160 disease and other inflammatory bowel diseases, intestinal 161 tumors, trauma, necrotizing enterocolitis, and congenital 162 defects, along with surgical interventions used to treat 163 these disorders, can result in intestinal failure or short164 bowel syndrome (SBS).12,13 High morbidity and mortality 165 are associated with SBS, and the economic and quality-of166 life costs for SBS patients are high.12,14 Better SBS thera167 pies are needed, particularly interventions that restore lost 168 function to remaining intestinal tissue, as well as novel 169 tissue engineering approaches to overcome small-bowel 170 organ shortages for transplant. To make these advances a 171 reality, it will be necessary to understand how duodenal, 172 jejunal, and ileal epithelial identities are patterned along 173 the cephalocaudal axis of the small intestine. Currently, the 174 molecular mechanisms underlying establishment and 175

T

-,

No.

-

maintenance of enterocyte populations with regionally 176 defined functions are delineated poorly. Extrinsic cues such 177 as luminal contents and hormones can influence expression 178 of regional-specific enterocyte markers, but tissue trans- 179 plantation and isograft experiments show that regionalized 180 gene expression programs are intrinsic to the epi- 181 thelium.15–17 More recently, using a long-term organoid 182 culture model, Middendorp et al18 showed that adult small 183 intestinal stem cells maintain regional identity and 184 regionally defined gene expression programs in a cell 185 autonomous manner. We propose that the repertoire of 186 transcription factors expressed in duodenal, jejunal, and 187 ileal enterocytes drives patterning by activating and 188 repressing expression of the set of downstream targets 189 defining each region. GATA4, a zinc-finger–containing 190 transcription factor with a spatially restricted expression 191 pattern along the cephalocaudal axis of the small intestine, 192 represents one such factor. 193 GATA4 is expressed in enterocytes of the duodenal and 194 jejunal epithelium but absent from enterocytes of the ileal 195 epithelium.19–21 Studies of mouse intestinal development 196 show that GATA4 initially is expressed throughout the 197 developing intestinal epithelium and that it becomes 198 excluded from the ileal domain relatively early at 199 embryonic day (E)12.5–13.5.22 GATA4 plays a role in early Q9200 intestinal development, regulating intestinal epithelial cell 201 proliferation.23 Specifically, GATA4 deletion in the intestinal 202 epithelium via Sonic hedgehog–Cre transiently reduces 203 cellular proliferation in the intestinal epithelium 204 (E10.5–E11.5), resulting in a shorter intestine with 205 decreased epithelial girth. Furthermore, the onset of villus 206 morphogenesis is delayed in the intestine of Gata4 Sonic 207 hedgehog–Cre conditional knockout embryos, perhaps 208 because of reduced epithelial cell proliferation, and villus 209 structure also is abnormal. In adult mice, GATA4 is essential 210 for jejunal function.19,21 Elimination of GATA4 from the 211 intestinal epithelium using Villin-Cre causes a global shift in 212 regional identity within the jejunum.21 In the absence of 213 jejunal GATA4, expression of a wide array of jejunal-specific 214 genes is lost, including expression of genes encoding 215 proteins with important roles in uptake, transport, and 216 processing of cholesterol and lipids.21 Moreover, expression 217 of numerous ileal-specific genes is gained, including 218 219 220 221 222 Abbreviations used in this paper: bio-ChIP-seq, biotin-mediated chromatin immunoprecipitation with high-throughput sequencing; bp, 223 base pair; cDNA, complementary DNA; cKI, conditional knock-in; cKO, 224 conditional knockout; Cyp7a1, cytochrome P450 family 7 subfamily A member 1; dATP, deoxyadenosine triphosphate; E, embryonic day; 225 EMSA, electromobility shift assay; Fabp6, fatty acid binding protein 6; 226 Fgf, fibroblast growth factor; FXR, farnesoid X receptor; lnl, loxPflanked PGK-Neo-3xSV40 polyadenylation sequence; mRNA, 227 messenger RNA; OSTa/b, organic solute transporter a/b; pA, poly228 adenylation; PCR, polymerase chain reaction; qRT, quantitative reverse-transcription; SBS, short-bowel syndrome; Slc, solute carrier; 229 TSS, transcription start site; xiFABP, Xenopus I-FABP. 230 © 2017 The Authors. Published by Elsevier Inc. on behalf of the AGA 231 Institute. This is an open access article under the CC BY-NC-ND 232 license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 2352-345X 233 http://dx.doi.org/10.1016/j.jcmgh.2016.12.009 234

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293

2017

GATA4 Regionalizes the Intestine

expression of genes encoding proteins required for bile acid absorption.21 These sweeping changes in gene expression from a jejunal to an ileal pattern also have important functional consequences, disrupting the normal spatial pattern of the digestive process and causing malabsorption of dietary fat and cholesterol.21 Deletion of Gata4 in the jejunal epithelium of adult mice via an inducible conditional knockout strategy similarly alters jejunal gene expression, shifting it away from a jejunal profile and toward an ileal profile.19 Comparison of jejunal phenotypes between Gata4 and Gata6 Villin-Cre conditional knockout mice further indicates that GATA control of jejunal-ileal epithelial identity is a GATA4-specific function because expression of key jejunal and ileal markers is not altered in GATA6-deficient jejunum.22,24 Taken together, these studies show that GATA4 is necessary for execution of the enterocyte gene expression program in the jejunum. The goal of the present study was to test the hypothesis that GATA4 is sufficient to confer jejunal fate within the intestinal epithelium. To test this hypothesis, we used a conditional knock-in approach to generate mice expressing GATA4 in the ileal epithelium, where it normally is absent. If GATA4 is sufficient to drive jejunal identity, the ileal enterocyte gene expression profile should shift from ileal to jejunal. Indeed, we found that the global gene expression profile of GATA4-expressing ileal epithelium differed significantly from control ileal epithelium, aligning more closely with jejunum rather than ileum. We also observed overlap between GATA4-expressing ileum and duodenum, suggesting that ectopic GATA4 expression within the ileum also can induce duodenal gene expression, thereby conferring a more proximal-type intestinal identity with both jejunal and duodenal character. Focusing on jejunal vs ileal identity, gene expression changes in the presence or absence of GATA4 and GATA4 chromatin immunoprecipitation experiments strongly suggest that GATA4 patterns regional-specific functions by directly activating expression of genes defining jejunum and by directly repressing expression of genes defining ileum. We further show that enterohepatic signaling was altered in mice expressing GATA4 in the ileum. Taken together, these data extend our understanding of GATA4 as a crucial dominant molecular determinant of enterocyte identity and regulator of enterohepatic signaling. Considering that GATA4 is necessary and sufficient to promote jejunal identity and repress ileal identity, GATA4 represents a logical candidate to consider as a therapeutic target for intestinal failure.

Materials and Methods Animals To generate Gata4 conditional knock-in mice (Gt(ROSA) 26Sortm1(Gata4)Bat, MGI: 5707906), the coding sequence of mouse Gata4 was amplified by polymerase chain reaction (PCR) using the Expand High Fidelity PCR system (Roche, Madison, WI). The forward primer contained a XhoI restriction site, and the reverse primer contained a SacI restriction site for cloning into the XhoI/SacI sites in the

3

multiple cloning site of the pBigT plasmid25 to create pBigT- 294 Gata4 (Figure 1A). Primer sequences are listed in Table 1. A 295 cassette containing the adenovirus splice acceptor, a loxP- 296 flanked PGK-Neo-3xSV40 polyadenylation sequence (LNL), Q10297 the Gata4 coding sequence, and the bovine growth hormone Q11298 polyadenylation (pA) sequence was excised from pBigT- 299 Gata4 with PacI and AscI. This fragment was inserted into 300 the PacI/AscI sites in the plasmid pROSA26PA25 to create 301 the pROSA26PA-Gata4 targeting vector (Figure 1A). Tar- 302 geting vector, linearized by digestion with Asp718, was 303 introduced into R1 mouse ES cells by electroporation.26 ES Q12304 cell colonies resistant to 350 mg/mL G418 (Life Technolo- 305 gies, Grand Island, NY) were genotyped by Southern blot 306 and PCR. Chimeric animals were generated by aggregation 307 of CD1 morulae with R1 mouse ES cells containing the 308 modified allele (Gt(ROSA)26Sortm1(Gata4)Bat, designated 309 ROSA26lnlG4), as described previously.27 The modified 310 ROSA26 lnlG4 allele was propagated through the germline by 311 breeding chimeras to CD1 mice, and germline transmission 312 of the modified ROSA26 lnlG4 allele was confirmed by 313 Southern blot (Figure 1B). Heterozygous ROSA26 lnlG4/þ an- 314 imals were crossed to generate homozygous ROSA26lnlG4/lnlG4 315 mice that were crossed with Villin-Cre (Tg(Vil-cre)997Gum) 316 mice28 to generate heterozygous Gata4 conditional knock-in 317 mice (Gata4 cKI) with the genotype ROSA26lnlG4/þVillin-Cre. 318 For conditional knockout of Gata4 in the jejunum, Gata4loxP 319 mice (Gata4tm1.1Sad)29 were crossed with Villin-Cre mice to 320 produce Gata4loxP/loxPVillin-Cre mice. CD-1 mice (Charles Q13 321 River Laboratories, Wilmington, MA) were used as wild-type 322 control. For biotin-mediated chromatin immunoprecipitation 323 (bio-ChIP) studies, the Gata4flbio/flbio(Gata4tm3.1Wtp) and 324 ROSA26BirA(Gt[ROSA]26SorTm1[birA]Mejr) mouse lines were 325 used to generate Gata4flbio/flbio::ROSA26BirA/BirA and 326 ROSA26BirA/BirA mice for bio-ChIP.30,31 Primers used for PCR 327 genotyping of ear punch DNA are listed Table 1. Studies with 328 ROSA26lnlG4/þ, ROSA26lnlG4/þVillin-Cre, Gata4loxP/loxPVillin-Cre, 329 and CD-1 mice were performed with 6- to 8-week-old male 330 mice. Studies with Gata4flbio/flbio::ROSA26BirA/BirA and 331 ROSA26BirA/BirA were performed with epithelial cells from 332 4- to 6-month-old male mice. In all studies, duodenum was 333 collected from no more than 8 cm adjacent to the stomach, 334 jejunum was collected 10 cm from the stomach, and ileum 335 was collected from no more than 5 cm adjacent to the cecum. 336 The Medical College of Wisconsin Institutional Animal Care 337 and Use Committee approved all animal procedures. 338 339 340 Southern Blot Genomic DNA was isolated from mouse tails by digesting 341 tissue in lysis buffer (4 mol/L urea, 10 mmol/L CDTA, 0.5% Q14 342 sarkosyl, 0.1 mol/L Tris HCl pH 8.0, 0.2 mol/L NaCl, and 2 343 mg proteinase K) at 55 C overnight followed by DNA pre- 344 cipitation. Southern blot was performed using standard 345 conditions with EcoRV or BamHI digested DNA and probes 346 illustrated in Figure 1A. Probe 1 was generated by PCR 347 using primers listed in Table 1 and the plasmid pROSA26-5’ 348 as the template.25,32 Probe 2 was generated by isolating a 349 381–base pair (bp) product from HindIII digestion of the 350 351 plasmid pROSA26PA.25 352

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

4

Cellular and Molecular Gastroenterology and Hepatology Vol.

Epithelial Cell Isolation Epithelial cells (crypt and villus) were isolated from duodenum, jejunum, and ileum following a protocol modified from Guo et al33 in 2009. Briefly, intestine was everted on a glass rod and placed in a conical tube containing BSS buffer (11.5 mmol/L KCl, 96 mmol/L NaCl, 27 mmol/L sodium citrate, 8 mmol/L KH2PO4, 5.6 mmol/L Na2HPO4, and 15 mmol/L EDTA) with 200 mmol/L

-,

No.

-

phenylmethylsulfonyl fluoride. After 25 minutes of vortexing at 4 C to release epithelial cells from villi and crypts, remaining mesenchymal and muscle tissues were removed. Epithelial cell isolates, containing both crypt and villus cells, were pelleted by centrifuging at 2000 rpm for 10 minutes at 4 C. Cells were washed twice with 1 phosphate-buffered saline containing 200 mmol/L phenylmethylsulfonyl fluoride and used for RNA or protein extraction.

web 4C/FPO

353 354 355 356 357 Q15 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411

Thompson et al

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470

-

471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 Q16 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529

2017

GATA4 Regionalizes the Intestine

5

530 531 Duodenal, jejunal, and ileal tissue (0.5 cm) was fixed in 532 4% paraformaldehyde overnight, processed, and paraffin- 533 embedded. H&E staining was performed per standard pro- 534 cedures. Citric acid antigen retrieval was performed for 535 immunohistochemistry. Staining was visualized using R.T.U. 536 Vectastain Elite ABC reagent (Vector Labs, Burlingame, CA) 537 and a Metal Enhanced DAB substrate kit (Thermo Scientific, 538 Rockford, IL). For immunofluorescence, fresh-frozen sec- 539 tions were fixed with 4% paraformaldehyde before antibody 540 staining. Sections from at least 3 control (ROSA26lnlG4/þ) and 541 3 Gata4 cKI animals (ROSA26lnlG4/þ Villin-Cre) were 542 analyzed. Histochemistry and immunohistochemistry slides 543 were scanned using a NanoZoomer slide scanner (Hama- 544 matsu, Bridgewater, NJ), and images from scanned slides 545 were captured using NDP.view 2 software (Hamamatsu). 546 Fluorescent images were captured on a Nikon Eclipse 80i 547 microscope (Melville, NY), using a Nikon digital smart 548 549 DS-QiMc camera. Table 2 shows antibody details. 550 551 552 Immunoblotting Nuclear and cytoplasmic protein extracts were prepared 553 from duodenal, jejunal, and ileal epithelial isolates from 554 control ROSA26lnlG4/þ and Gata4 cKI (ROSA26lnlG4/þVillin- 555 Cre) mice using the NE-PER Nuclear and Cytoplasmic 556 Extraction Reagents (Thermo Scientific) and HALT Protease 557 and Phosphatase Inhibitor cocktails without EDTA (Thermo 558 Scientific). Whole-cell lysates were prepared from jejunal 559 and ileal epithelial isolates from control ROSA26lnlG4/þ and 560 561 562 Figure 1. (See previous page). Gata4 conditional knock-in mice express GATA4 in the ileum. (A) Schematic illustrating the 563 strategy used to generate a conditional Gata4 knock-in mouse line. The coding sequence of the mouse Gata4 gene was 564 amplified by PCR and inserted into XhoI/SacI sites in the multiple cloning site (MCS) of pBig-T to generate pBigT-Gata4. The 565 targeting cassette consisting of an adenoviral splice acceptor (SA), a loxP flanked PGK-neomycin resistance gene and 3  SV40 pA sequence (loxP-PGK-Neo-3  SV40pA-loxP, LNL), the Gata4 coding sequence, and a bovine growth hormone Q25566 polyadenylation sequence was excised from pBigT-Gata4 with PacI/AscI and inserted into the PacI/AscI sites in pROSA26PA 567 to create pROSA26PA-Gata4. Homologous recombination between pROSA26PA-Gata4 and the endogenous ROSA26 locus 568 in mouse R1 ES cells yielded the targeted locus Gt(ROSA)26Sortm1(Gata4)Bat, designated ROSA26lnlG4. After Cre recombination 569 to excise the LNL cassette, Gata4 is expressed. BamHI (B) and EcoRV (E) restriction sites used for Southern blot analysis, the 570 position of Southern blot probes, and relevant BamHI and EcoRV restriction digest fragments identified by Southern blot are 571 shown. Arrows mark sites of genotyping primers (Table 1, primers). (B) Southern blot analysis confirmed germline transmission of the ROSA26lnlG4 allele. Representative Southern blot analysis of EcoRV or BamHI digested genomic DNA harvested from a 572 wild-type mouse (ROSA26þ/þ) or a mouse heterozygous for the modified ROSA26 allele (ROSA26lnlG4/þ). We observed the 573 expected fragments representing the wild-type and modified alleles (EcoRV digest, 11.5-kb wild-type allele and 4.0-kb 574 modified allele; BamHI digest, 5.8-kb wild-type allele and 4.7-kb modified allele). (C) qRT-PCR showed that Gata4 mRNA 575 was induced in ileum of ROSA26lnlG4/þVillin-Cre (designated Gata4 cKI) mice compared with ileum of control mice 576 (ROSA26lnlG4/þ). Gata6 mRNA remained unchanged in the ileum of Gata4 cKI mice compared with controls (n ¼ ileum of 5 577 control and 6 Gata4 cKI animals; experiments performed in triplicate). Glyceraldehyde-3-phosphate dehydrogenase was used 578 for normalization. Error bars show SEM. P values were determined by 2-sample Student t test: *P  .05. (D) Immunohistochemistry showed nuclear GATA4 protein (brown staining) in ileal epithelium of Gata4 cKI mice and in the jejunal epithelium of 579 control mice whereas GATA4 protein was absent from ileal epithelium of control mice. Sections from at least 3 control and 3 580 Gata4 cKI animals were evaluated. Hematoxylin was used to counterstain tissue. Scale bars: 100 mm. (E) Immunoblot analysis 581 of nuclear extracts from jejunal and ileal epithelial cells of control mice and from ileal epithelial cells of Gata4 cKI mice was used 582 to quantify GATA4 protein in ileum of Gata4 cKI mice and to compare GATA4 abundance between control jejunum and 583 GATA4-expressing ileum. The blot shown contains nuclear protein extracts from 3 control and 3 Gata4 cKI animals and is 584 representative of analysis of more than 24 control and Gata4 cKI animals. To quantify protein expression, signal was measured 585 using quantitative infrared immunoblotting (LI-COR) and National Institutes of Health ImageJ software. GATA4 protein levels Q26 were normalized to TATA binding protein (TBP) levels. GATA4 expression in ileum of Gata4 cKI mice was 27% the level 586 observed in control jejunum. Molecular weight marker locations are indicated. Error bars show SEM. P values determined by 587 Q27 588 2-sample Student t test: *P  .05, **P  .001. KS, ____________.

Reverse-Transcription PCR

Total RNA was isolated from duodenal, jejunal, and ileal epithelial cells and from liver (RNeasy; Qiagen, Valencia, CA). Complementary DNA (cDNA) was generated from DNase-treated RNA as previously described.34,35 Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) and RT-PCR using [a-32P] deoxyadenosine triphosphate (dATP) were performed as previously described.22,35,36 For qRT-PCR and radioactive RT-PCR, glyceraldehyde-3-phosphate dehydrogenase (Gapdh) expression was used for normalization. A Storm820 Phosphor Imager (Amersham Biosciences, Pittsburgh, PA) was used to quantitate band intensities from radioactive RT-PCR. Each gene was assayed in at least 3 independent experiments. For TaqMan qRT-PCR of gene expression in duodenum and jejunal epithelium, cDNA from 3 control ROSA26lnlG4/þ and 3 GATA4-expressing ROSA26lnlG4/þVillinCre mice were used. For TaqMan qRT-PCR of gene expression in ileal epithelium, cDNA from 5 control ROSA26lnlG4/þ and 6 GATA4-expressing ROSA26lnlG4/þVillin-Cre mice were used. For RT-PCR with [a-32P] dATP to determine gene expression in ileal epithelium, cDNA from 3 control ROSA26lnlG4/þ and 3 GATA4-expressing ROSA26lnlG4/þVillinCre mice were used. For all RT-PCR of gene expression in jejunal epithelium (TaqMan qRT-PCR and RT-PCR with [a-32P] dATP), cDNA from 3 control Gata4loxP/loxP and 3 mutant Gata4loxP/loxPVillin-Cre mice were used. Statistical analysis was performed using StatPlus Software (AnalystSoft, Inc). Error bars represent the SEM. P values were determined by 2-sample Student t test. Table 1 contains primer sequences and TaqMan assay identifiers.

Histochemistry, Immunohistochemistry, and Immunofluorescence

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 6

Table 1.Primer Sequences for Southern Probes, Genotyping, RT-PCR, and Bio-ChIP–PCR Gene

Forward

Q31

Reverse

Size, bp

aaagtcgctctgagttgttat

gcgaagagtttgtcctcaacc

311, transgene

VillinCre Gata4loxP

aaagtcgctctgagttgttat caagcctggctcgacggcc cccagtaaagaagtcagcacaaggaaac

ggagcgggagaaatggatatg cgcgaacatcttcaggttct agactattgatcccggagtgaacatt

603, wt w350 355, wt

Gata4 exon7

cagtgctgtctgctctgaagctgt

ccaaggtgggcttctctgtaagaac

455, loxP 378, wt

BirAJax 14/15 BirAJax 16/17 Gata4cds

ttcagacactgcgtgact gtgtaactgtggacagaggag tactcgagGGGGCGatgtaccaaagcctg

ggctccaatgactatttgc gaacttgatgtgtagaccagg atgagctcttacgcggtgattatgtcccc

550, flagbio 500 400, wt 1348

RT-PCR Aadac Abi3bp Acot12 Asah2 Cd74 Dfna5 Dnase1 Enpp7 Ereg Gapdh Nos2 Pik3ap Prss23 Rragd Slc23a1 Slc25a48 Tmigd1

ggcttagccccaaaacacca atgaaacattggctttaccagcaga accacaagatctcacagccctactg tggccatttttgccatagcc ggcttgagactggtgtctgtttcat tgggaaaccagaaatgctacttgag tggctgtgaaccctgtggaa catggtgaagcaggtagacaggact tgttttgacctcaaagctgggaata gatgcccccatgtttgtgat ctcagcccaacaatacaagatgacc atgcgacatcctcatcttctacagc agggctggagaatggctaagtagtg agtgatcaaaggtgaacaccaccat tggattccaacccaggtgct ctttaaggtgtttttcaggggcatc ttttgcatcaagaccatctcgattt

caagagcctgaagggcagga aaagcactagacagggtgggcttag actcatcaggttttagcccaccatt accactctgggctccacgac gaaatgggggttccctttagatagc cactggaattgccccagacataata gtcctccaggccccactttt agtccaacagctcaaactggatgtc ttttaaaacatgttcacccgacacc ggtcatgagcccttccacaat tgtggtgaagagtgtcatgcaaaat gtatgtctgcgtcttctggctacga gcaaggaccatcagtcctcctatct tgggaggctcaatcttacatttcaa taccatgcccatcccaaagg tcctgatacctcattcgcttctcac tttctattctgaacccttgcccatt

241 124 188 161 115 150 190 197 151 150 184 109 144 103 236 140 180

bio-ChIP–PCR Aadac bs Abi3bp bs Acot12 bs Asah2_1 bs Asah2_2 bs Alb (nc) Cd36 bs Cd74 bs Cdk4 (nc)a Dfna5 bs Dll1 nc Dnase1 bs Enpp7 bs Ereg bs Fabp1 bs

agctgagctgtgaacagaaaggaac tggattcttatctggggtggcttat aggagagctgtctgtgcctctttct tctcctggccatgtttggtctacta aggacagctgccttatcttatcctt tacttaacatagggacgagatggta gccacactgtcgtaaggagtattgg agcctctaatctggaaaagggttcc catacagtggcttattatatttcc cccacttccttgtcaacaatgtctc tggcaagggagagaaggaagca gtggccatgagtcatccgtcta taaaagccatcccagcatcaca caggaaagagagtgaagcgagtgag tatctctttcggtctggttgcactc

ttcaatggctcggcttatgaagtag aagtcttcccagaggactcgtgttt ctccaacagatcgttgatgggatag agggatggtgagggtaagattttca aaaaccacccaaacattatagctg catactaaacgtagacaagttggcc ttttgcacattaatcccttcgtgat gcagctctcttcccctacacacata ctccaccgccatggggaaacattc tttcttggctgatgctatggtttgt acagccttggtctgttcagtgt gagggaaaggcttcccacagat caaagtcccagggtcagacagg gaatgaagtttcaatgcagctcctg agagaggccattatgtgaagctgtg

101 145 183 165 109 221 100 197 259 126 158 146 108 192 123

No.

Genotyping ROSA26Gata4

137

-,

tccggctgtctcacagaacggc

Cellular and Molecular Gastroenterology and Hepatology Vol.

ctctggctcctcagagagcctc

Thompson et al

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

Southern probes pROSA26 5’ probe

-

648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706

707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 -

Gene

Reverse

agagttctgggccaatctggtctac ccagttgtccatatgaattctcca agcgcaagttgaatctgc gaaatcggagatttgaggtcacttg tctctgtttctgaggggaaccaa ctggcagcgcatgattaagttg tccctttgggtagcctgaatga agatgattgatcggggctttca atggccaaggcaacttagagaagag ctggagctcaactgtaccacaggat gaattaagcccaaccacacagt gtacaatgatgggctgaatggg ggtctgttaaacaaagggcaaacaa tcctgaagagcagcaatggtga gattcattcctggaggaggaaaatg cagctgcttctggtaatgagtgaca atcaggtaggttttcccaagccagt ttaataagcctctcaggtggctgtg aactctcttgagctccgtgtctttg gaatcagagaggcaaaatgaagtcc

tgagttacattaaatgctcagctgctt ggctgatggcactgagacagag agcgacaatctaccagag cagaactatcccgctcctctttctc catcgaccaagactgtcagcatc tgggaggcagtcttcattgtga tcgtggtgactcccaaccataa ggtagaggcagcaggcaacaag tttgtgcttgggatttaaggtctga aagcaatccctgcaggaaaatagac ttttaaccccgtctttcctctact ctcagatactttaacccacaggca agctcagtgttcacccaaccagata gggccagagtctacagggtgaa gttggggtgtcatcttgctaacctt cacaggaccaatcttgttttccatc tggctttctctttcctccaatactgt gcagtgctagatccttccctttgat gtttcgcaaagattgagggtttgtt aaatcatgttgcattccattgatattt

Size, bp 112 118 219 104 183 199 148 106 122 173 150 201 133 143 141 140 122 135 104 143

TaqMan ID

Gene

ID

Akr1b8

Gene

Mm00484314_m1

Lactase

Mm01285112_m1

Cck

Mm00446170_m1

Mep1a

Mm00484970_m1

Cd36

Mm01135198_m1

Pdx1

Mm00435565_m1

Cyp7a1

Mm00484150_m1

Rnf180

Mm01304501_m1

Fabp1

Mm00444340_m1

Slc10a2

Mm00488258_m1

Fabp6

Mm00434316_m1

Sqrdl

Mm00502443_m1

Fgf15

Mm00433278_m1

Sst

Mm00436671_m1

Gapdh

Mm99999915_g1

Suox

Mm00620388_g1

Gata4

Mm00484689_m1

Trpm6

Mm00463112_m1

Gata6

Mm00802636_m1

Ugt2a3

Mm00472170_m1

Hsd17b6

Mm00457343_m1

bs, binding site; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; Lct, lactase; nc, negative control. a,b Previously published binding site primers.46,38

Q32

GATA4 Regionalizes the Intestine

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

Fabp6 bs Fgf15 bs Hprt nc Hsd17b6 bs Il33 bs Lct bs Mep1a bs Prss23 nc Prss23 bs Rnf180 bs Slc10a2_1 bsb Slc10a2_2 bsb Slc10a2 nc Slc23a1 bs Slc25a48 bs Sqrdl bs Suox bs Tmigd1 bs Ugt2a3 bs Ugt2a3 nc

Forward

2017

Table 1. Continued

7

766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824

8

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

Table 2.Antibodies Antibody

Dilution

Manufacturer

Immunohistochemistry and immunofluorescence GATA4 C-20 (goat polyclonal) ASBT/SLC10A2 (rabbit polyclonal) LCT T-14 (goat polyclonal) ECAD (mouse polyclonal) Biotinylated rabbit anti-goat (HþL) IgG Biotinylated goat anti-rabbit (HþL) IgG

1:250 1:4000 1:50 1:4000 15 ml/mL 15 ml/mL

Santa Cruz Biotechnology, Santa Cruz, CA Gift from Paul Dawson Santa Cruz Biotechnology BD Transduction Laboratories Vector Labs Vector Labs

sc-1237

Immunoblotting GATA4 C-20 (goat polyclonal) TATA binding protein ASBT/SLC10A2 (rabbit polyclonal) OSTa OSTb LCT T-14 (goat polyclonal) IRDye 800CW donkey anti-goat IgG (HþL) IRDye 680RD donkey anti-mouse IgG (HþL) IRDye 800CW donkey anti-rabbit IgG (HþL)

1:1000 1:1000 1:1500 1:1000 1:1000 1:1000 1:15,000 1:15,000 1:15,000

Santa Cruz Biotechnology Abcam, Cambridge, MA Gift from Paul Dawson Gift from Paul Dawson Gift from Paul Dawson Santa Cruz Biotechnology LI-COR Biosciences LI-COR Biosciences LI-COR Biosciences

sc-1237 ab818

Gata4 cKI (ROSA26lnlG4/þVillin-Cre) mice using a 1 NP40 lysis buffer (0.5% NP40, 50 mmol/L Tris pH 8, 10% glycerol, 0.1 mmol/L EDTA pH 8, and 250 mmol/L NaCl) containing HALT Protease and Phosphatase Inhibitor cocktails without EDTA (Thermo Scientific, Rockford, IL). Nuclear proteins (5 mg), cytoplasmic proteins (25 mg), or whole-cell lysates (10 mg) were separated using Nu-PAGE Bis-Tris 4%–

Catalog number

sc-240614 610181 BA-5000 BA-4000

sc-240614 926-32214 926-68072 926-32213

12% gradient gels (Invitrogen, Carlsbad, CA), and transferred to an Immobilon-FL polyvinylidene difluoride membrane (Millipore, Darmstadt, Germany). Immunoblots were visualized using an Odyssey Infrared Imaging System (LICOR, Lincoln, NE) and quantitated using National Institutes of Health ImageJ software (Bethesda, MD). Table 2 shows antibody details.

web 4C=FPO

825 826 827 828 829 830 831 832 Q33 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883

Thompson et al

Figure 2. Duodenal and jejunal epithelial cells in Gata4 cKI mice express normal levels of GATA4. (A) Immunohistochemistry showed nuclear GATA4 protein (brown staining) in duodenal and jejunal epithelium of Gata4 cKI mice at similar staining intensity compared with controls. Sections from at least 3 control and 3 Gata4 cKI animals were evaluated. Hematoxylin was used to counterstain tissue. Scale bars: 100 mm. (B) qRT-PCR showed that Gata4 mRNA was unchanged in epithelial cells of the duodenum and jejunum of ROSA26lnlG4/þVillin-Cre (designated Gata4 cKI) mice compared with control mice (ROSA26lnlG4/þ) (n ¼ 3 per genotype; experiments performed in triplicate). Glyceraldehyde-3-phosphate dehydrogenase was used for normalization. Error bars show SEM. P values were determined by 2-sample Student t test. (C) Immunoblot analysis of nuclear extracts from duodenal and jejunal epithelial cells of control and Gata4 cKI mice was used to quantify GATA4 protein (n ¼ 3 per genotype). To quantify protein expression, signal was measured using quantitative infrared immunoblotting (LI-COR) and National Institutes of Health Image software. GATA4 protein levels were normalized to TATA binding protein (TBP) levels. GATA4 expression was unchanged in duodenum and jejunum of Gata4 cKI animals compared with control. Molecular weight marker locations are indicated. Error bars show SEM. P values were determined by 2-sample Student t test.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942

-

943 Q17 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001

2017

GATA4 Regionalizes the Intestine

Affymetrix Oligonucleotide Array Analysis Total RNA was extracted from duodenal, jejunal, or ileal epithelial cells (RNeasy; Qiagen) harvested from wild-type CD1 control (n ¼ 3 each duodenum, jejunum, and ileum), ROSA26lnlG4/þ control (n ¼ 3 ileum), Gata4 cKI (ROSA26lnlG4/þ Villin-Cre, n ¼ 3 ileum), and Gata4 conditional knockout (cKO) (Gata4loxP/loxPVillin-Cre, n ¼ 3 jejunum) animals. The standard manufacturer’s procedure for GeneChip Mouse Gene 1.0 ST Arrays (Affymetrix, Santa Clara, CA) was

9

followed. Arrays were scanned using a 7G Affymetrix GeneChip Scanner (Affymetrix). Data were analyzed using Partek Genomics Suite software version 6.6 (Partek, Inc, St. Louis, MO). A threshold of at least 2.0-fold change with an unadjusted P value of .05 or less was used to identify transcripts of interest for all comparisons. To generate gene sets with regionally enriched expression, we performed comparisons between duodenum and jejunum, jejunum and ileum, and duodenum and ileum. By using these 3 comparisons,

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060

10

1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086Q18 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

sonication using a Misonix Sonicator 3000 (Misonix, Inc, 1120 Farmingdale, NY). Bio-ChIP was performed per previously 1121 published protocols with modifications described here- 1122 in.36,41 Pull-downs were performed at 4 C using magnetic 1123 streptavidin beads (M-280 Dynabeads; Life Technologies) 1124 after preclearing chromatin with protein A magnetic beads 1125 (Dynabeads). Bead-chromatin complexes were washed for 5 1126 minutes twice with 2% sodium dodecyl sulfate buffer, twice 1127 with a high-salt buffer, once with LiCl buffer, and twice with 1128 TE buffer before chromatin elution in sodium dodecyl sul- Q19 1129 fate–ChIP elution buffer overnight at 70 C. Eluted chromatin 1130 was treated with proteinase K and ribonuclease A followed 1131 by phenol-chloroform extraction and ethanol precipitation. 1132 GATA4 occupancy was detected by PCR with primers within 1133 the GATA4 binding peaks and [a-32P] dATP. PCR products 1134 were separated by 4% polyacrylamide gels in 0.5  Tris- 1135 borate-EDTA buffer and visualized by autoradiography us- 1136 ing a Storm820 Phosphor Imager (Amersham Biosciences). 1137 Band intensity was measured in ImageQuant 5.2 (Molecular 1138 Dynamics, Sunnyvale, CA). Percentage enrichment was 1139 calculated by dividing the band intensity for the ChIP sample 1140 Bio-ChIP Sequencing Re-analysis Previously published and publicly available alignment by 10 the band intensity for the input sample to account 1141 files for the input and GATA4–bio-ChIP with high-throughput for the 1:10 dilution of input sample used in the PCR reac- 1142 sequencing (GATA4–bio-ChIP-seq) (GSE6895738) were used tion. A 2-sample Student t test was used to compare means. 1143 1144 for peak calling with model-based analysis of ChIP 1145 sequencing v1.0 using a P value of 10-5.39 The remaining Electromobility Shift Assay 1146 parameters were set to the default. The nearest RefSeq gene A double-stranded oligonucleotide probe containing an 1147 for each peak within 100 kb was annotated using experimentally validated consensus GATA4-binding site 1148 CisGenome.40 from the Xenopus I-FABP (xiFABP) gene42,43 was radio- Q201149 labeled using Klenow fragment and [a-32P] dATP. Electro- 1150 Bio-ChIP mobility shift assay (EMSA) reactions contained 1 shift 1151 Epithelial cell extracts were obtained from the jejunum of buffer (4% Ficoll, 20 mmol/L HEPES pH 7.9, 0.1 mmol/L 1152 Gata4flbio/flbio::ROSA26BirA/BirA and ROSA26BirA/BirA (n ¼ 6 per ethylene glycol-bis(b-aminoethyl ether)-N,N,N0 ,N0 -tetraacetic 1153 genotype).30,31 Cells were fixed in 1% formaldehyde for 10 acid, 0.5 mmol/L dithiothreitol), 2 mg nonspecific DNA pol- 1154 minutes with rocking followed by 5 minutes quenching in y(dIdC), approximately 1 ng of radiolabeled xiFABP GATA4 1155 125 mmol/L glycine. Cell pellets were frozen before probe, and approximately 1 mg nuclear extract from 293T 1156 1157 1158 Figure 3. (See previous page). Identification of high-confidence GATA4 targets that define jejunal vs ileal enterocyte 1159 identity. (A) We used Affymetrix oligonucleotide array analysis with RNA from wild-type (WT) CD1 duodenal, jejunal, and ileal 1160 epithelial cells (n ¼ 3) to identify sets of regionally enriched transcripts and with RNA from ileal epithelial cells of control 1161 (Rosa26lnlG4/þ) and Gata4 cKI (Rosa26lnlG4/þVillin-Cre) mice (n ¼ 3 per genotype) to identify transcripts altered in GATA4expressing (GATAþ) ileum compared with control ileum. A threshold of at least a 2-fold change and an unadjusted P value 1162  .05 was used for comparisons. We determined overlap between transcripts differentially expressed in GATA4þ ileum (136) Q281163 and those identified as either duodenal-enriched, jejunal/duodenal-enriched, jejunal-enriched, or ileal-enriched (bolded text). 1164 We found that 47% of transcripts with altered expression in GATA4þ ileum overlapped with proximal-enriched (duodenal, 1165 jejunal/duodenal, and jejunal sets, indicated by bracket) or ileal-enriched transcript sets (64 of 136, 32 proximal-enriched, 32 1166 ileal-enriched). (B) Of the 32 proximal-enriched transcripts identified, the expression of 21 was increased in GATA4þ ileum. Of 1167 the 32 ileal-enriched transcripts identified, the expression of 29 was decreased in GATA4þ ileum. (C) Focusing on the jejunal1168 enriched set (17 transcripts, including 15 jejunal-enriched and 12 jejunal/duodenal-enriched) and the ileal-enriched set (29 transcripts), we reasoned that high-confidence GATA4 direct targets would show converse expression changes in the 1169 presence or absence of GATA. Therefore, to identify transcripts differentially expressed in GATA4-deficient jejunum, we used 1170 Affymetrix oligonucleotide array analysis with RNA from jejunal epithelial cells of Gata4 cKO (Gata4loxP/loxPVillin-Cre) mice (n ¼ 1171 3) and WT CD1 mice (n ¼ 3, same arrays as in panel A). A threshold of at least a 2-fold change and an unadjusted P value  .05 1172 was used. We determined overlap between the 46 jejunal- or ileal-enriched transcripts and those transcripts differentially 1173 expressed in GATA4-deficient jejunum (466). We found that 15 of 17 jejunal-enriched transcripts with increased expression in 1174 GATA4þ ileum and 18 of 29 ileal-enriched transcripts with decreased expression in GATA4þ ileum overlapped with those 1175 altered in GATA4-deficient jejunum and that all 33 overlapping transcripts showed a converse expression pattern in GATA4deficient jejunum compared with GATA4þ ileum (ie, expression of all 15 jejunal-enriched transcripts was decreased in GATA4- 1176 deficient jejunum and expression of all 18 ileal-enriched transcripts was increased in GATA4-deficient jejunum). Specific 1177 jejunal- and ileal-enriched transcripts are listed in the box. Those bolded are important in the enterohepatic circulation 1178 duodenal-enriched transcripts were defined as those with 2.0-fold (P  .05) enrichment over both the jejunum and ileum; jejunal-enriched transcripts were defined as those with 2.0-fold (P  .05) enrichment over both duodenum and ileum; and ileal-enriched transcripts were defined as those with 2.0-fold (P  .05) enrichment over both duodenum and jejunum. In addition, jejunal/duodenal-enriched transcripts were those with equivalent expression between jejunum and duodenum but with 2.0-fold (P  .05) enrichment over ileum. Lists of genes with enriched expression in duodenum, jejunum/duodenum, jejunum, or ileum (Supplementary Table 1) and CEL files from Affymetrix oligonucleotide analysis of ileal epithelium of control and Gata4 cKI mice were used for Gene Set Enrichment Analysis, and normalized enrichment scores were calculated using default parameters.37 Microarray data from this study have been deposited into NCBI Gene Expression Omnibus (http://www. ncbi.nlm.nih.gov/geo) and are accessible through GEO series accession number GSE75870.

pathway.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

2017

GATA4 Regionalizes the Intestine

11

web 4C=FPO

1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 Figure 4. GATA4-expressing ileum loses ileal identity. Transcripts identified as having enriched expression in the epithelium of duodenum, jejunum/duodenum, jejunum, or ileum of wild-type animals (Figure 3A and Supplementary Table 1) were used as 1223 reference gene sets in gene set enrichment analysis. CEL files for microarrays performed with RNA isolated from ileal epithelial 1224 cells of control (Rosa26lnlG4/þ) and Gata4 cKI (Rosa26lnlG4/þVillin-Cre) mice (n ¼ 3 per genotype) were tested for enrichment of 1225 gene sets by gene set enrichment analysis. The top panels and bottom left panel show gene set enrichment analysis using 1226 transcripts enriched in duodenal (top left), jejunal/duodenal (top right), or jejunal (bottom left) epithelium as the reference gene 1227 set; the bottom left panel shows gene set enrichment analysis using transcripts enriched in ileal epithelium as the reference 1228 gene set. Proximal transcripts were highly enriched (normalized enrichment score [NES] ¼ þ2.27, þ2.84, and þ1.92) 1229 in GATA4-expressing (GATA4þ) ileum, whereas ileal transcripts were enriched in control ileum (NES ¼ -3.63). All were statistically significant by P value and false-discovery rate (FDR). 1230 1231 1232 cells expressing exogenous mouse GATA4 from plasmid- sites within approximately 100 bp of each other within the 1233 Q21 containing DNA-GATA4 (plasmid, gift from Stephen Duncan). peak of interest. Each reaction was incubated for 20 minutes 1234 Each competition EMSA reaction contained a 200-fold molar at room temperature. A 4% polyacrylamide gel in 0.5  Tris1235 excess of a specific cold competitor double-strand oligonu- borate-EDTA buffer, pre-electrophoresed at 300 V for 1236 cleotide probe. Two distinct probes were designed for the approximately 2 hours at 4 C, was loaded with 5 L of the 1237 Fgf15 gene because there were 2 consensus GATA4 binding reaction and run at 300 V for 1.5 hours at 4 C. After drying

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296

12

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355

-,

No.

-

1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

1415 1416Q22 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473

2017

GATA4 Regionalizes the Intestine

the gel, bands were visualized by autoradiography. Probe sequences are provided in Figure 8.

Results GATA4 Is Expressed Ectopically in the Ileal Epithelium of ROSA26lnlGata4/þVillin-Cre Mice We used a conditional knock-in approach to generate mice that ectopically expressed GATA4 in the ileal epithelium (Figure 1A). We targeted the Gata4 conditional knock-in allele to the ROSA26 locus because ROSA26 promoter activity is ubiquitous and its disruption results in no adverse phenotype.32,44,45 The targeted allele consisted of the mouse Gata4 coding sequence downstream of a loxP flanked neomyocin resistance gene expression cassette containing a triple polyadenylation (3pA) signal sequence (LNL cassette). The 3pA sequence blocks transcriptional read-through to prevent Gata4 expression in the absence of Cre (Figure 1A). GATA4 expression, therefore, was activated by Cre-mediated excision of the LNL cassette (Figure 1A). Southern blot analysis confirmed germline transmission of the conditional knock-in allele (Gt(ROSA) 26Sortm1(Gata4)Bat, designated hereafter as ROSA26lnlG4) (Figure 1B). ROSA26lnlG4 mice were crossed with heterozygous Villin-Cre mice to activate GATA4 expression within the ileal epithelium. Villin-Cre is expressed in all epithelial cells of the small intestine beginning at E13.5.22,28 To verify GATA4 expression in ileum of ROSA26lnlG4/þVillin-Cre mice (designated Gata4 cKI), we analyzed Gata4 messenger RNA (mRNA) levels by qRT-PCR and GATA4 protein levels by immunohistochemistry and immunoblot. Gata4 mRNA was increased significantly in ileum of Gata4 cKI mice compared with that of controls (Figure 1C). Gata6 transcript levels were equivalent between ileum from control and Gata4 cKI mice, showing that GATA4 induction in the ileum did not affect Gata6 expression (Figure 1C). Immunohistochemistry staining of ileal tissue sections and immunoblot analysis of ileal epithelial cell nuclear protein fractions showed nuclear GATA4 protein within the ileal epithelium of Gata4 cKI mice and its absence within nuclei of control ileal epithelial cells (Figure 1D and E). GATA4 protein levels also were assessed in jejunal samples from control mice to compare protein levels between normal jejunum and GATA4expressing ileum. Quantification of immunoblots showed the level of GATA4 in Gata4 cKI ileum to be approximately 27% of control jejunal level (Figure 1E). In contrast to ileum, we observed no significant increase in GATA4 mRNA or protein in the epithelium of the duodenum or jejunum from Gata4 cKI mice (Figure 2). This may reflect the strength of the ROSA26 promoter, or it may indicate that there are post-transcriptional and/or post-translational mechanisms in place in the duodenum and jejunum to regulate the total level of GATA4.

13

GATA4-Expressing Ileum Loses Ileal Identity To determine the extent to which GATA4 expression in the ileum altered cellular identity, we defined gene sets with regionally enriched expression along the cephalocaudal axis of the normal intestine and compared these sets of regionally enriched transcripts with the gene expression profile of GATA4-expressing ileal epithelium. By using Affymetrix oligonucleotide array analysis, we compared gene expression among epithelial cell populations from the duodenum, jejunum, and ileum. We included duodenal epithelial cells in our analysis to comprehensively characterize regional gene expression along the cephalocaudal intestinal axis. To identify genes with regionally enriched expression in the intestine, we measured differential gene expression between regions (duodenum vs jejunum, jejunum vs ileum, and duodenum vs ileum) using a 2-fold change threshold and an unadjusted P value of .05 or less (Figure 3A and Supplementary Table 1). We performed gene set enrichment analysis using jejunal-enriched (130), jejunal/duodenalenriched (288), duodenal-enriched (846), and ilealenriched (212) gene sets (Figure 3A) and Affymetrix microarray data profiling gene expression of ileal epithelial cells from Gata4 cKI and control mice. Gene set enrichment analysis offers an unbiased computational method to determine whether a defined gene set (jejunal-, jejunal/duodenal-, duodenal-, or ileal-enriched gene sets) shows significant enrichment in 1 of 2 biological states (ileal epithelium of Gata4 cKI vs control mice).37 We found that the global gene expression profile of Gata4 cKI ileal epithelium differed significantly from that of control ileal epithelium, aligning more closely with jejunum and duodenum rather than ileum (Figure 4). We conclude that GATA4-expressing ileum loses ileal identity and that ectopic GATA4 expression within the ileum shifts the ileal transcriptome toward a more proximal identity characteristic of jejunum and duodenum. Based on the phenotype of GATA4-deficient jejunum, which gained ileal character at the expense of jejunal character,21 we predicted that transcripts characteristic of proximal intestine (jejunal, jejunal/duodenal, duodenal) would be induced and that transcripts characteristic of distal intestine (ileum) would be reduced in the presence of GATA4 in the ileum. Of the 136 transcripts identified as differentially expressed by at least 2-fold (P  .05) between control and GATA4-expressing ileum, 47% (64 of 136) were defined as genes with proximal-enriched (32 transcripts) or distal-enriched (32 transcripts) expression (Figure 3A and Supplementary Table 2). Among these 64 genes, expression of 78% (50 of 64) behaved as predicted, 66% (21 of 32) of the identified jejunal-, jejunal/duodenal-, and duodenalenriched transcripts increased in ileum of Gata4 cKI mice

Figure 5. (See previous page). Validation of converse gene expression patterns for jejunal- or ileal-enriched transcripts in GATA4-expressing (GATA4D) ileum and GATA4-deficient (GATA4-) jejunum. RT-PCR was used to determine transcript abundance for the 30 jejunal- and ileal-enriched transcripts, identified as having GATA4 binding peaks by bio-ChIP-seq, in ileal epithelial cells from Gata4 cKI (ROSA26lnlG4/þVillin-Cre) and control (ROSA26lnlG4/þ) mice and in jejunal epithelial cells from Gata4 cKO (Gata4loxP/loxPVillin-Cre) and control (WT CD1) mice. The 26 genes confirmed to have converse gene expression patterns in GATA4þ ileum and GATA4- jejunum are shown in bold. Glyceraldehyde-3-phosphate dehydrogenase was used for normalization. Expression of each gene was assayed in at least 3 independent experiments using cDNA from n ¼ 3–6 for control, Gata4 cKI, and Gata4 cKO animals. Error bars represent SEM. *P  .05. **P  .01. IL, interleukin.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532

14

1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

Figure 6. GATA4 occupies sites in jejunal- and ileal-enriched genes, suggesting GATA4 directly regulates expression of jejunal- and ileal-enriched genes in the jejunum to define jejunal enterocyte identity. Bio-ChIP–PCR showed GATA4 enrichment at GATA4 binding sites within genes expressed in jejunum (top panel) and within genes repressed in jejunum (middle panel). No GATA4 enrichment was observed at sites lacking GATA4 bio-ChIP-seq binding sites (Dll1, Hprt, Prss23, Slc10a2, and Ugt2a3) or in genes identified as GATA4 targets in other tissues but that are either equivalently expressed in ileum of control and Gata4 cKI mice (Cdk4) or absent in ileum of control and Gata4 cKI mice (Alb) (bottom panel). Audioradiographic band intensity was measured using a Storm820 Phosphor Imager and ImageQuant software. Representative autoradiographs for each site assayed are shown in Figure 7. Enrichment per sample was normalized to input (n ¼ 6 Gata4flbio/flbio::ROSA26BirA/BirA mice, designated GATA4-FlagBio/BirA, and 6 ROSA26BirA/BirA mice, designated GATA4-WT/ BirA). Error bars show SEM. P values were determined by 2-sample Student t test: *P  0.05, **P  .005. P values > .05 are listed on graphs. GATA4 occupancy at the binding sites in the Slc10a2 gene (Slc10a2_1 and Slc10a2_2) was analyzed previously by qPCR.38

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650

-

1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709

2017

GATA4 Regionalizes the Intestine

15

Figure 7. Representative autoradiographs of bioChIP–PCR. Bio-ChIP–PCR was used to evaluate GATA4 occupancy at predicted binding sites in the 26 high-confidence direct targets we identified and in 7 negative controls (Alb, Cdk4, Dll1, Hprt, Prss23, Slc10a2, and Ugt2a3). GATA4 occupied chromatin was isolated by performing streptavidin pull-down with chromatin from jejunal epithelial cells of GATA4-FlagBio/BirA or GATA4-WT/BirA mice. As representative data, PCR with chromatin from 2 mice per genotype is shown here. Input PCR confirmed that equivalent chromatin amounts were used in pulldowns. In all, 6 mice per genotype were assayed by bio-ChIP–PCR.

compared with controls (Figure 3B an Table 3), and 91% (29 of 32) of the identified ileal-enriched transcripts decreased in ileum of Gata4 cKI mice compared with controls (Figure 3B and Table 3). Within the set of proximalenriched transcripts up-regulated in GATA4-expressing ileum, 81% (17 of 21) were among the top 25% most duodenal or jejunal-enriched transcripts (Table 3). Within the set of ileal-enriched transcripts down-regulated in GATA4-expressing ileum, 45% (13 of 29) were among the top 25% most ileal-enriched transcripts (Table 3). Because

the remaining 62 genes identified as differentially expressed between controls and Gata4 cKI mice were expressed equivalently along the intestinal cephalocaudal axis in wildtype animals, these were not included in subsequent analyses. Of course, it is possible that GATA4 could contribute to regulation of these genes for a purpose other than defining regional specificity. Our next goal was to identify among these genes those most likely to be regulated directly by GATA4 to establish regional specificity along the cephalocaudal intestinal axis.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768

16

1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

Figure 8. GATA4 binds to GATA consensus binding sites in jejunal-enriched genes and in ileal-enriched genes regulated by GATA4 expression in the intestine. (A) Table shows double-stranded oligonucleotide EMSA probes (5’ to 3’). Underlined sequences identify the location of GATA4 consensus binding sites within probes. Nucleotides mutated to eliminate GATA4 consensus binding sites in mutant probes are indicated. Two distinct probes were designed for the Fgf15 gene because there were 2 consensus GATA4 binding sites within approximately 100 bp of each other within the peak of interest. (B) Immunoblot analysis of nuclear extracts from 293T cells transfected with either control empty plasmid or GATA4 containing plasmid (pcDNA-GATA4) shows overexpression of GATA4 in pcDNA-GATA4–transfected cells. GATA4 protein levels were normalized to TATA binding protein (TBP) levels. Molecular weight marker locations are indicated. (C) Representative EMSA competition assay is shown. Nuclear extract from pcDNA-GATA4–transfected 293T cells was incubated with radiolabeled xiFABP probe in the absence (lane 1) or presence (lanes 2–11) of 200-fold molar excess of unlabeled competitors. A bracket indicates the location of GATA4-bound xiFABP probe. Data are representative of 3 independent assays.

Because we previously identified a functional defect in jejunum lacking GATA4,21 we chose to focus the remainder of our analysis on GATA4’s regulation of jejunal vs ileal gene expression. Therefore, we focused subsequent analyses

on the ileal-enriched genes with repressed expression in GATA4-expressing ileum (29 genes) (Table 3) and the jejunalenriched genes with induced expression in GATA4expressing ileum (17 genes) (Table 3). For this analysis,

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886

-

1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945

2017

GATA4 Regionalizes the Intestine

Table 3.Duodenal- and Jejunal-Enriched Transcripts With Increased Expression and Ileal-Enriched Transcripts With Decreased Expression in GATA4þ Ileum Duodenal/jejunal transcripts increased in GATA4+ ileum Gene symbol

cKI fold change

Jejunal fold enrichment

Fabp1a

6.03

292.04

Lctb

6.93

140.53

Cd36a

2.87

45.39

Dnase1b

2.93

38.10

Enpp7b

2.98

33.69

Hsd17b6a

3.25

27.78

Slc23a1b

2.79

25.06

Aadaca

3.74

24.56

Ugt2a3a

3.37

23.52

Acot12a

3.28

18.37

Gata4a

2.61

15.24

b

Asah2

3.00

14.75

Gstm3a

2.75

8.55

Il33b

2.79

7.95

Rragdb

2.21

7.89

AY761184a

2.18

2.78

Gm10409/Gm3020/Gm3194b

2.28

2.34

Duodenal fold enrichment Cd59a

2.19

7.49

Slc16a12

2.11

6.22

Lmcd1

2.07

5.30

Akr1b8

2.47

3.32

Ileal transcripts decreased in GATA4+ ileum Gene symbol

cKI fold change

Ileal fold enrichment

Fabp6

-3.35

-310.51

Slc10a2

-3.26

-112.94

Tmigd1

-3.51

-26.15

Suox

-3.53

-24.13

Nos2

-2.14

-13.47

Slc25a48

-3.63

-11.92

Scd1

-3.84

-6.30

Sqrdl

-2.32

-5.87

Dfna5

-2.05

-4.54

Bex1

-2.03

-4.41

Prss23

-2.45

-4.39

Mep1a

-2.05

-4.33

Ly6a

-2.65

-4.18

Mfhas1

-2.69

-3.99

Pik3ap1

-2.17

-3.90

Rnf180

-2.77

-3.72

Abi3bp

-4.13

-3.67

Trpm6

-2.53

-3.64

Ereg

-2.01

-3.52

Fgf15

-5.56

-3.42

17

Table 3. Continued Ileal transcripts decreased in GATA4+ ileum Gene symbol

cKI fold change

Ileal fold enrichment

Acta2

-2.76

-3.10

Ebf1

-2.08

-2.58

Marcksl1

-2.07

-2.30

Cd74

-2.02

-2.30

Cd53

-2.62

-2.20

Mapk4

-2.04

-2.15

Dcn

-2.34

-2.15

Nlrc5

-2.15

-2.09

Ighv1-63

-2.52

-2.07

Lct, lactase. a Jejunal/duodenal-enriched transcripts expressed between duodenum and jejunum). b Jejunal-enriched transcripts.

(equivalently

jejunal-enriched transcripts were defined as those enriched specifically in the jejunum compared with the duodenum and ileum (8 jejunal-enriched genes) (Table 3) and those equivalently enriched in both the duodenum and jejunum over the ileum (9 jejunal/duodenal-enriched genes) (Table 3). To identify high-confidence GATA4 targets among these 46 genes, we filtered our data further to identify those with converse expression changes in the presence or absence of GATA4 in the jejunum (ie, increased in Gata4 cKO jejunal epithelium/decreased in Gata4 cKI ileal epithelium or decreased in Gata4 cKO jejunal epithelium/increased in Gata4 cKI ileal epithelium). We determined gene expression changes in jejunal epithelium lacking GATA4 using Affymetrix oligonucleotide array analysis to compare jejunal epithelium of Gata4 cKO (Gata4loxP/loxPVillin-Cre) mice with that of CD1 control mice (Figure 3C and Supplementary Table 3). Of the 17 jejunal-enriched transcripts upregulated in Gata4 cKI ileum, we identified 15 as also down-regulated in the GATA4-null jejunum (Figure 3C). Of the 29 ileal-enriched transcripts down-regulated in Gata4 cKI ileum, we found 18 as also up-regulated in the GATA4null jejunum (Figure 3C). In sum, these analyses identified 33 genes as putative high-confidence GATA4 direct targets.

GATA4 Activates and Represses Gene Expression Within the Intestine to Distinguish Jejunal and Ileal Epithelial Regional Identities To determine whether GATA4 has the capacity to directly regulate expression of the 33 genes with altered expression in both GATA4-expressing ileum and GATA4-deficient jejunum, we obtained publically available GATA4 bio-ChIPseq data38 and identified GATA4 chromatin occupancy using model-based analysis of ChIP-seq for peak calling with a 2-sided and increased P value threshold to reduce identification of false-positive peaks.39 Peaks within 100 kb upstream or downstream of the nearest transcription start site (TSS) were annotated (Supplementary Table 4), and GATA4

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004

18

2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

binding peaks were identified in 30 of the 33 genes. We subsequently eliminated any genes that failed RT-PCR validation for differential expression between ileum of Gata4 cKI and control or between jejunum of Gata4 cKO and control (Figure 5), reducing the set to 26 potential high-confidence GATA4-regulated targets (Table 4). We performed bioChIP–PCR using sonicated chromatin from isolated jejunal epithelial cells of Gata4flbio/flbio::ROSA26BirA/BirA mice and ROSA26BirA/BirA mice30,31,41 (Figure 6). Biotinylation of endogenous GATA4 protein in Gata4flbio/flbio::ROSA26BirA/BirA mice allows precipitation of GATA4-chromatin complexes with streptavidin.30,31,41 We performed 3 independent streptavidin pull-downs, each including chromatin harvested from 2 Gata4flbio/flbio::ROSA26BirA/BirA animals and 2 ROSA26BirA/BirA animals (n ¼ 6 animals of each genotype assayed by bio-ChIP–PCR). We identified the GATA4 binding

Table 4.High-Confidence GATA4 Regulated Targets Jejunal-enriched transcripts cKI Ileum fold change

cKO jejunum fold change

Lct

6.93

-19.17

Fabp1

6.03

-10.84

Aadac

3.74

-2.76

Ugt2a3

3.37

-2.89

Acot12

3.28

-3.75

Hsd17b6

3.25

-18.32

Asah2

3.00

-3.31

Enpp7

2.98

-6.80

Dnase1

2.93

-17.57

Cd36

2.87

-29.24

Slc23a1

2.79

-15.73

Il33

2.79

-5.02

Gene symbol

Ileal-enriched transcripts Gene symbol

cKI Ileum fold change

cKO jejunum fold change

Fgf15

-5.56

8.48

Abi3bp

-4.13

10.40

Slc25a48

-3.63

7.38

Suox

-3.53

22.73

Tmigd1

-3.51

23.35

Fabp6

-3.35

308.59

Slc10a2

-3.26

80.81

Rnf180

-2.77

3.32

Prss23

-2.45

4.77

Sqrdl

-2.32

4.83

Dfna5

-2.05

2.79

Mep1a

-2.05

4.68

Cd74

-2.02

2.07

Ereg

-2.01

2.72

Lct, lactase.

-,

No.

-

peak closest to each gene’s TSS and verified that each con- 2064 tained at least 1 consensus GATA4 binding site (WGATAR). Q232065 Primers flanking the tallest point of the bio-ChIP-seq peak 2066 were used for PCR. For negative controls, we designed 2067 primers to assay GATA4 occupancy at regions in intestinal- 2068 expressed genes that lack GATA4 bio-ChIP-seq peaks (Dll1, 2069 Hprt, Prss23, Slc10a2, and Ugt2a3) and to assay GATA4 2070 occupancy at sequences in genes identified as GATA4 targets 2071 in other tissues but that are either equivalently expressed in 2072 ileum of control and Gata4 cKI mice (Cdk4)46 or absent in 2073 ileum of control and Gata4 cKI mice (Alb).47,48 GATA4 2074 enrichment at putative binding sites in jejunal chromatin 2075 from Gata4flbio/flbio::ROSA26BirA/BirA animals compared with 2076 that of controls was measured and expressed as a percent- 2077 age of input (Figure 6, Figure 7 shows representative PCR 2078 autoradiographs for each site assayed). We observed GATA4 2079 binding at 9 of 12 regions identified as encoding jejunal- 2080 enriched transcripts up-regulated in GATA4-expressing 2081 ileum and at 13 of 14 regions identified within genes 2082 encoding ileal-enriched transcripts down-regulated in 2083 GATA4-expressing ileum (Figure 6). For the 4 genes lacking 2084 statistically significant GATA4 enrichment at the peaks 2085 residing closest to the gene’s TSS, we examined GATA4 bio- 2086 ChIP-seq data to identify the next GATA4 binding peak 2087 containing at least 1 consensus GATA binding site (WGA- 2088 TAR). We identified such peaks in 2 of the 4 genes (Slc10a2, 2089 peak w68 kb downstream of TSS within an intron; Asah2, 2090 peak w26 kb upstream of the TSS) and assayed GATA4 2091 occupancy at these regions by bio-ChIP-PCR. We observed 2092 GATA4 binding to both regions (Figure 6). Taken together, 2093 we found that GATA4 binds to sites in all genes identified as 2094 encoding ileal-enriched transcripts down-regulated in 2095 GATA4-expressing ileum and that GATA4 binds to sites in 10 2096 of 12 genes (83%) identified as encoding jejunal-enriched 2097 transcripts up-regulated by expression of GATA4 in the 2098 ileum (Figure 7). As expected, GATA4 was not enriched at 2099 any negative control sequence queried (0 of 7) (Figure 6). 2100 As proof in principle that our methodology identified 2101 bona fide GATA4 binding sequences, we selected 2 genes 2102 with jejunal-enriched expression (lactase and Cd36) and 2 2103 with ileal-enriched (Fgf15 and Slc10a2) expression and 2104 used an EMSA to test GATA4 binding to its binding 2105 sites within these genes (Figure 8). Nonradiolabeled 2106 probes containing gene-specific GATA4 consensus 2107 sequence(s) previously queried by bio-ChIP-PCR 2108 (Figure 8A) were tested for their ability to compete with 2109 a well-characterized GATA4 binding site from the Xenopus 2110 I-FABP gene42,43 for binding to exogenous GATA4 protein 2111 (Figure 8B). We also introduced mutations into each 2112 GATA4 consensus sequence (Figure 8A) and tested the 2113 ability of each mutant to compete for GATA4 binding by 2114 EMSA. The unlabeled xiFABP sequence as well as every 2115 unlabeled wild-type GATA4 consensus binding site from 2116 the targets tested inhibited GATA4 binding to the radio- 2117 labeled xiFABP probe (Figure 8C). In contrast, all mutated 2118 GATA4 consensus sequences failed to compete with or 2119 minimally competed with the radiolabeled xiFABP probe 2120 for GATA4 binding (Figure 8C). Taken together, GATA4 2121 binding data (EMSA and ChIP) and our observation of 2122

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160 2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181

2017

GATA4 Regionalizes the Intestine

converse changes in gene expression in ileum expressing GATA4 and jejunum lacking GATA4 strongly suggest that GATA4 regulates regional gene expression within the intestine by directly binding to genes encoding jejunal transcripts to activate transcription and to genes encoding ileal transcripts to repress transcription. Of course, to definitively prove direct regulation of these genes by GATA4, it would be necessary to mutate the GATA4 binding sites within these targets and show that such mutations abolish GATA4-dependent regulation of target gene expression within mouse jejunal epithelium.

Expression of GATA4 Jejunal Targets Is Not Increased in Jejunum of Gata4 cKI Mice We compared the expression of the 10 jejunal-enriched targets occupied by GATA4 in jejunal epithelium from control and Gata4 cKI mice by qRT-PCR. We found expression of only Fabp1 to be increased significantly between these groups (Figure 9A). Although expression of interleukin 33 was increased, the P value for this change was just outside the significance cut-off value of P < .05. We also used qRTPCR to compare expression of 4 transcripts identified by our analysis as duodenal-enriched (Akr1b8, Cck, Pdx1, and Sst) (Supplementary Table 1) in duodenal epithelium from control and Gata4 cKI mice. We observed no difference in expression of these markers between control and Gata4 cKI mice (Figure 9B). Although the expression of Cck and Sst trended toward slightly higher levels in the duodenum of Gata4 cKI mice compared with controls, the P value for these was outside of the significance cut-off value of P < .05. These results were not unexpected because we showed earlier that GATA4 protein was not increased significantly in the duodenum or jejunum of Gata4 cKI mice compared with controls (Figure 2).

Enterohepatic Circulation Is Altered in Gata4 cKI Mice Among the set of GATA4 targets repressed in GATA4expressing ileum were those involved in regulating an important enterohepatic circulation pathway. Uptake of luminal bile acids by ileal enterocytes occurs via the bile acid transporter SLC10A2.49 Within enterocytes, bile acids bind to the intracellular bile acid binding protein FABP6 and ultimately are transported from the enterocyte into the circulation by the basolateral heterodimeric organic solute transporter (OST), which consists of OSTa and OSTb proteins.6,50 Bile acids also act as ligands for the nuclear receptor FXR.6 Bile acid–bound FXR promotes Fgf15 expression, and secretion of FGF15 into the portal venous circulation results in FGF receptor 4 activation on hepatocytes.4,5 This activation inhibits expression of Cyp7a1, the gene encoding the rate-limiting enzyme in bile acid synthesis.4 Genes encoding proteins involved in this pathway that were decreased significantly in GATA4-expressing ileum included Slc10a2, Fabp6, and Fgf15 (Table 3 and Figure 3). Moreover, by relaxing the fold-change criterion in analyzing transcripts altered in GATA4-expressing ileum, we

19

found expression of 3 additional transcripts encoding ilealenriched bile acid uptake pathway proteins to be decreased: Nr1h4 (Fxr), -1.4-fold, P  .05; Slc51a (Osta), -1.7-fold, P  .01; and Slc51b (Ostb), -1.6-fold, P  .05. To determine if changes in mRNA abundance correlated with changes in protein abundance, we performed immunohistochemistry to compare SLC10A2 levels in ileum between Gata4 cKI mice and control mice. Overall, we observed decreased SLC10A2 protein at the epithelial brush border of ileum from Gata4 cKI mice compared with control mice (n ¼ 7 control, n ¼ 14 Gata4 cKI) (Figure 10A). In some regions, SLC10A2 was undetectable (Figure 10A, bottom panel); in other regions, SLC10A2 levels were greatly reduced (Figure 10A, middle panel). We used immunoblot to quantify total SLC10A2, OSTa, and OSTb proteins in GATA4-expressing ileal enterocytes and control ileal enterocytes and found that ileum of Gata4 cKI mice contained only 9% of SLC10A2 protein typical of control tissue (Figure 10B) and only 26% and 19% of OSTa and OSTb proteins, respectively (Figure 10C). Because we observed lower levels of transcripts and proteins encoded by genes required for bile acid uptake and enterohepatic signaling, we examined the expression of hepatic Cyp7a1. We found Cyp7a1 mRNA expression to be increased significantly in livers of Gata4 cKI mice compared with that of controls (Figure 10D). These findings are consistent with decreased Cyp7a1 expression observed in livers of Gata4 cKO animals.21 Therefore, we conclude that enterohepatic signaling was altered in mice expressing GATA4 in the ileum.

Lactase Protein Is Induced in the Ileum of Gata4 cKI Mice The finding that changes in ileal-specific gene transcription affected ileal-specific protein expression led us to examine the status of jejunal protein expression in GATA4-expressing ileum. Because lactase, a well-documented marker of jejunal function, was identified as the top jejunal target induced by expression of GATA4 in the ileum (Table 3), we chose to examine lactase protein expression in ileum of control and Gata4 cKI mice. We used immunostaining and immunoblot analyses to examine lactase protein expression in ileum from control and Gata4 cKI mice. We observed brush-border expression of lactase protein only in GATA4-expressing ileum (Figure 11A). Immunoblot analysis further showed induction of lactase protein in ileal epithelial cells of Gata4 cKI mice and not in cells of control mice (Figure 11B). These data show that GATA4-expressing ileal cells can express jejunal proteins and suggest that these cells would be capable of accomplishing jejunal functions.

Discussion Together, our data show that GATA4 is sufficient to confer jejunal identity and to repress ileal identity in the small intestinal epithelium. These findings refine our understanding of GATA4’s critical function in patterning the intestinal epithelium along its cephalocaudal axis, initially uncovered through studies with Gata4 cKO mice.19,21,24 Moreover, we identified a novel mechanism through which

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220 2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240

20

2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292 2293 2294 2295 2296 2297 2298 2299

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340 2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 Figure 9. Expression of jejunal and duodenal transcripts is unchanged in Gata4 cKI animals. (A) qRT-PCR was used to 2351 determine transcript abundance of the 10 jejunal-enriched transcripts, identified as having enriched GATA4 binding by bio- 2352 ChIP–PCR (Figure 7). (B) In jejunal epithelial cells from control and Gata4 cKI mice, qRT-PCR was used to determine transcript Q29 2353 abundance of 4 duodenal transcripts in duodenal epithelial cells from control and Gata4 cKI mice. (A and B) Glyceraldehyde- 2354 3-phosphate dehydrogenase was used for normalization. Expression of each gene was assayed in at least 3 independent 2355 experiments (n ¼ 3 per genotype). Error bars represent SEM. P values were determined by 2-sample Student t test. 2356 2357 2358

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

GATA4 Regionalizes the Intestine

21

web 4C=FPO

2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400 2401 2402 2403 2404 2405 2406 2407 2408 2409 2410 2411 2412 2413 2414 2415 2416 2417

2017

Figure 10. Enterohepatic signaling is altered in animals expressing GATA4 in the ileum. (A) Immunohistochemistry for SLC10A2 (brown stain) shows SLC10A2 protein lining the brush border of control ileum (n ¼ 7, upper panel). In contrast, SLC10A2 staining was faint to nearly absent along the brush border of ileum from Gata4 cKI mice (n ¼ 14, 7 of 14 faint SLC10A2 staining, middle panel, and 7 of 14 low to no SLC10A2 staining, lower panel). Immunohistochemistry from 2 independent Gata4 cKI mice is shown as representative of the 2 types of SLC10A2 staining observed. (B) Immunoblot using whole-cell extracts from ileal epithelium of control and Gata4 cKI mice was used to measure expression of SLC10A2 protein. To quantify protein expression, signal was measured using quantitative infrared immunoblotting (LI-COR) and National Institutes of Health Image software. SLC10A2 protein levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels. SLC10A2 expression in ileum of Gata4 cKI mice (ROSA26lnlG4/þVillin-Cre) was 9% of the level observed in control ileum (ROSA26lnlG4/þ; n ¼ 3 animals per genotype). Arrowhead indicates the SLC10A2 band measured. Molecular weight marker locations are indicated. Error bars show SEM. P values were determined by 2-sample Student t test: *P  .05. (C) Immunoblot using whole-cell extracts from ileal epithelium of control and Gata4 cKI mice was used to measure expression of OSTa and OSTb proteins. To quantify protein expression, signal was measured using quantitative infrared immunoblotting (LI-COR) and National Institutes of Health Image software. OSTa and OSTb protein levels were normalized to GAPDH levels. Expression of OSTa and OSTb proteins in ileum of Gata4 cKI mice (ROSA26lnlG4/þVillin-Cre) was 26% and 19% of the level observed in control ileum (ROSA26lnlG4/þ), respectively (n ¼ 3 animals per genotype). Molecular weight marker locations are indicated. Error bars show SEM. P values were determined by 2-sample Student t test: *P  .05. (D) qRT-PCR shows increased Cyp7a1 expression in liver from Gata4 cKI mice (ROSA26lnlG4/þVillin-Cre) compared with control mice (ROSA26lnlG4/þ; n ¼ 3 animals per genotype). Error bars represent SEM. *P  .05.

GATA4 directly may repress Fgf15 expression to influence enterohepatic signaling. Although the level of GATA4 protein expressed in Gata4 cKI ileal epithelium was only 27% of that expressed in jejunal epithelium, it nevertheless was sufficient to alter the global ileal gene expression profile such that it aligned more closely with jejunum and duodenum rather than ileum. Of the genes with expression changed by addition of GATA4 to the ileum, roughly half were genes with proximal-enriched (jejunal and duodenal) or ileal-enriched expression patterns. Moreover, gene expression not only was affected positively by the presence of GATA4 but also was affected negatively, implying that GATA4 normally patterns the jejunal-ileal boundary by activating and repressing transcription.

Our approach to identify and to validate GATA4 transcriptional targets among those genes encoding jejunal-enriched or ileal-enriched transcripts was stringent. The fact that we confirmed GATA4 occupancy in all but 2 of the 26 genes (92%) we identified and that we showed GATA4 binding to its consensus sites within a subset of these genes show the validity of our approach to identify GATA4 targets involved in regulating jejunal vs ileal identity. Because we limited our analysis of GATA4 binding sites to those satisfying specific and stringent criteria, we cannot exclude the possibility that additional important GATA4 targets involved in determining jejunal vs ileal identity exist and were omitted by our analysis. The number of genes encoding jejunal- or ileal-enriched transcripts regulated by

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

2418 2419 2420 2421 2422 2423 2424 2425 2426 2427 2428 2429 2430 2431 2432 2433 2434 2435 2436 2437 2438 2439 2440 2441 2442 2443 2444 2445 2446 2447 2448 2449 2450 2451 2452 2453 2454 2455 2456 2457 2458 2459 2460 2461 2462 2463 2464 2465 2466 2467 2468 2469 2470 2471 2472 2473 2474 2475 2476

22

web 4C=FPO

2477 2478 2479 2480 2481 2482 2483 2484 2485 2486 2487 2488 2489 2490 2491 2492 2493 2494 2495 2496 2497 2498 2499 2500 2501 2502 2503 2504 2505 2506 2507 2508 2509 2510 2511 2512 2513 2514 2515 2516 2517 2518 2519 2520 2521 2522 2523 2524 2525 2526 2527 2528 2529 2530 2531 2532 2533 2534 2535

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

-,

No.

-

2536 2537 2538 2539 2540 2541 2542 2543 2544 2545 2546 2547 2548 2549 2550 2551 2552 2553 2554 2555 2556 2557 2558 2559 2560 Figure 11. Lactase protein is expressed in Gata4 cKI ileum. (A) Immunostaining (IF) showed LCT protein (green) at the brush Q30 2561 border in ileal epithelium of Gata4 cKI mice, whereas LCT protein was absent from ileal epithelium of control mice. Sections 2562 from at least 3 control and 3 Gata4 cKI animals were evaluated. E-cadherin (red) was used to stain epithelial cell membranes. 2563 40 ,6-diamidino-2-phenylindole (DAPI) (blue)-stained nuclei. Scale bars: 100 mm. (B) Immunoblot analysis of protein extracts 2564 from ileal epithelial cells of control and Gata4 cKI mice was used to quantify LCT protein (n ¼ 3). To quantify protein 2565 expression, signal was measured using quantitative infrared immunoblotting (LI-COR) and National Institutes of Health Image software. Arrowhead indicates the LCT band measured. LCT protein levels were normalized to glyceraldehyde-3-phosphate 2566 dehydrogenase (GAPDH) levels. Molecular weight marker locations are indicated. Error bars show SEM. P values were 2567 2568 determined by 2-sample Student t test: *P  .05. 2569 2570 GATA4 to define the jejunal-ileal boundary, therefore, likely amount of GATA4 present in ileum of Gata4 cKI mice was 2571 was under-represented by this analysis. Nevertheless, we insufficient to reduce expression of some targets by the 2572 conclude that GATA4 patterns the intestinal jejunal-ileal 2-fold threshold. In fact, by relaxing the fold-change crite- 2573 boundary by activating and repressing transcription of key rion in analyzing transcripts altered in GATA4-expressing 2574 regional-defining transcripts within the jejunum. ileum, we identified 3 additional key bile acid pathway 2575 An important consequence of patterning discrete jejunal genes—Nr1h4 (Fxr), Slc51a (Osta), and Slc51b (Ostb)— 2576 and ileal domains is the restriction of bile acid absorption to with decreased expression in GATA4-expressing ileum. 2577 the ileum. We conclude that GATA4 controls spatial Moreover, expression of Nr1h4, Slc51a, and Slc51b was 2578 patterning of bile acid absorption along the cephalocaudal increased in GATA4-deficient jejunum (Supplementary 2579 axis of the small intestine by repressing expression of key Table 3 and Battle et al21), and each contains GATA4 bind- 2580 genes encoding proteins essential for bile acid homeostasis. ing peaks (Supplementary Table 4), suggesting these genes 2581 Our work supports a model in which GATA4 prevents as additional possible direct GATA4 targets. These data 2582 inappropriate proximal absorption of bile acids by directly suggest that GATA4 coordinates the repression of expres- 2583 suppressing Slc10a2, Fabp6, and Fgf15 expression; exclu- sion of multiple genes required for bile acid absorption, 2584 sion of GATA4 from the terminal ileum thereby provides a thereby excluding this function from the jejunum, which is 2585 permissive environment for transcription of these same important for efficient lipid uptake by the jejunum. 2586 By contributing to spatial regulation of bile acid ho- 2587 genes and, therefore, for bile acid uptake. Additional important regulators of bile acid homeostasis also may be meostasis, GATA4 influences FGF15-mediated enterohepatic 2588 repressed directly by GATA4 in jejunum, but not identified signaling. FGF15 functions as a hormone with a primary 2589 in our study. Our strategy required 2-fold changes in gene target being the liver where it controls hepatic expression of 2590 expression in both GATA4-deficient jejunum and GATA4- Cyp7a1, the gene encoding the rate-limiting enzyme for 2591 expressing ileum. The level of GATA4 reconstituted in synthesis of bile acids from cholesterol.3,4,6,51–53 Supporting 2592 mutant ileum, however, was not equivalent to that normally a role for GATA4 in modulating FGF15-mediated enter- 2593 expressed in jejunum. Therefore, it is possible that the ohepatic signaling, we found that hepatic Cyp7a1 levels 2594

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

-

2595 2596 2597 2598 2599 2600 2601 2602 2603 2604 2605 2606 2607 2608 2609 2610 2611 2612 2613 2614 2615 2616 2617 2618 2619 2620 2621 2622 2623 2624 2625 2626 2627 2628 2629 2630 2631 2632 2633 2634 2635 2636 2637 2638 2639 2640 2641 2642 2643 2644 2645 2646 2647 2648 2649 2650 2651 2652 2653

2017

GATA4 Regionalizes the Intestine

were increased 4-fold in Gata4 cKI mice, which express little to no intestinal Fgf15. This agrees with our previous finding that Gata4 intestinal cKO mice, which overexpress Fgf15 in the jejunum, have decreased hepatic Cyp7a1 transcript.21 GATA4 likely influences Fgf15 levels through direct and indirect mechanisms. GATA4 repression of Slc10a2 expression would suppress cellular bile acid uptake and downstream bile acid activation of FXR-mediated Fgf15 transcription.4,5,52,53 Moreover, as described earlier, GATA4 also directly may repress transcription of Fxr itself, and in this way could reinforce silencing of Fgf15 and other FXR transcriptional targets such as Fabp6, Slc51a, and Slc51b in the jejunum.50,54 Importantly, we show that GATA4 likely directly represses Fgf15 expression by binding to a consensus GATA4 regulatory element in intron 2 of the Fgf15 gene. These sites are approximately 140-bp upstream of a consensus FXR binding site shown to be important for Fgf15 expression.4 The proximity of GATA4 and FXR binding sites within the Fgf15 gene suggests that GATA4 potentially could modulate FXR binding to Fgf15. Because defects in enterohepatic FGF15/19 signaling have been linked to human diseases including cholestatic liver disease, nonalcoholic fatty liver disease, type 2 diabetes, metabolic syndrome, Crohn’s disease, bile acid malabsorption, and bile acid diarrhea,7–9,11 it is important to understand how Fgf15 is regulated, and our study contributes a novel mechanism through which GATA4 represses Fgf15 transcription within the proximal intestine to maintain appropriate FGF15 levels. Our finding that lactase protein was expressed in the brush border of ileal enterocytes in Gata4 cKI mice implies that in addition to changing the ileal transcriptome, GATA4 expression in the ileum has the capacity to confer jejunal function to the ileum. Directly showing enhanced jejunal function in Gata4 cKI mice, however, would be virtually impossible given that the endogenous jejunal domain is fully intact and fully functional in Gata4 cKI mice. The jejunum is very efficient in performing its digestive and absorptive tasks. For example, we previously have shown that wildtype mice absorb approximately 97% of dietary fat.21 Given the saturated level of jejunal function in mice with an intact jejunum, it would be quite difficult to experimentally detect an enhancement of jejunal function. It is likely that detection of a measurable enhancement of jejunal function in the ileum of Gata4 cKI mice would require disruption of endogenous jejunal function, which is beyond the scope of this study. In summary, we show that GATA4 is sufficient to establish jejunal enterocyte identity and to repress ileal enterocyte identity in the intestinal epithelium. Not only are key jejunal- and ileal-enriched transcript levels changed in GATA4-expressing ileum, but levels of jejunal- and ilealenriched proteins also are altered in GATA4-expressing ileum. Changes in liver gene expression in Gata4 cKI mice, downstream of bile acid and Fgf15 signaling, show that there are important physiological consequences resulting from the addition of GATA4 to the ileum. This study hones our understanding of a key GATA4-dependent molecular mechanism that patterns the intestinal epithelium along its cephalocaudal axis by elaborating on GATA4’s critical

23

function as an essential dominant molecular determinant of jejunal enterocyte identity. Future studies to determine how GATA4 discriminates between targets that it activates or represses will be important. Genetic evidence suggests that FOG1 is essential for GATA4-mediated repression of at least Slc10a2 and Fabp6.24 GATA4-dependent inhibition of histone H3 lysine 27 acetylation also has been implicated as a mechanism through which GATA4 represses transcription.38 Finally, as a factor that is both necessary and sufficient to program jejunal enterocyte identity, GATA4 represents a logical candidate to consider in developing therapies to treat intestinal failure, particularly for those designed to restore lost functions to remaining intestinal tissue or for tissueengineering approaches to overcome small-bowel organ shortages for transplant.

References 1. Binder HJ, Reuben A. Nutrient digestion and absorption. In: Boron WF, Boulpaep EL, eds. Medical physiology: a cellular and molecular approach. Updated ed. Philadelphia: Elsevier Saunders, 2005:947–974. 2. Davis RA, Attie AD. Deletion of the ileal basolateral bile acid transporter identifies the cellular sentinels that regulate the bile acid pool. Proc Natl Acad Sci U S A 2008;105:4965–4966. 3. Landrier JF, Eloranta JJ, Vavricka SR, et al. The nuclear receptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am J Physiol Gastrointest Liver Physiol 2006;290: G476–G485. 4. Inagaki T, Choi M, Moschetta A, et al. Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2005;2:217–225. 5. Song KH, Li T, Owsley E, et al. Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7alpha-hydroxylase gene expression. Hepatology 2009;49:297–305. 6. Grober J, Zaghini I, Fujii H, et al. Identification of a bile acid-responsive element in the human ileal bile acidbinding protein gene. Involvement of the farnesoid X receptor/9-cis-retinoic acid receptor heterodimer. J Biol Chem 1999;274:29749–29754. 7. Jahn D, Rau M, Hermanns HM, et al. Mechanisms of enterohepatic fibroblast growth factor 15/19 signaling in health and disease. Cytokine Growth Factor Rev 2015; 26:625–635. 8. Kliewer SA, Mangelsdorf DJ. Bile acids as hormones: the FXR-FGF15/19 pathway. Dig Dis 2015;33:327–331. 9. Owen BM, Mangelsdorf DJ, Kliewer SA. Tissue-specific actions of the metabolic hormones FGF15/19 and FGF21. Trends Endocrinol Metab 2015;26:22–29. 10. Ferrebee CB, Dawson PA. Metabolic effects of intestinal absorption and enterohepatic cycling of bile acids. Acta Pharm Sin B 2015;5:129–134. 11. Keely SJ, Walters JRF. The farnesoid X receptor: good for BAD. Cell Mol Gastroenterol Hepatol 2016;2: 725–732. 12. Gutierrez IM, Kang KH, Jaksic T. Neonatal short bowel syndrome. Semin Fetal Neonatal Med 2011;16:157–163.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

2654 2655 2656 2657 2658 2659 2660 2661 2662 2663 2664 2665 2666 2667 2668 2669 2670 2671 2672 2673 2674 2675 2676 2677 2678 2679 2680 2681 2682 2683 2684 2685 2686 2687 2688 2689 2690 2691 2692 2693 2694 2695 2696 2697 2698 2699 2700 2701 2702 2703 2704 2705 2706 2707 2708 2709 2710 2711 2712

24

2713 2714 2715 2716Q24 2717 2718 2719 2720 2721 2722 2723 2724 2725 2726 2727 2728 2729 2730 2731 2732 2733 2734 2735 2736 2737 2738 2739 2740 2741 2742 2743 2744 2745 2746 2747 2748 2749 2750 2751 2752 2753 2754 2755 2756 2757 2758 2759 2760 2761 2762 2763 2764 2765 2766 2767 2768 2769 2770 2771

Thompson et al

Cellular and Molecular Gastroenterology and Hepatology Vol.

13. Helmrath MA, Deonarine K. Clinical small intestine. In: Gumucio DL, Samuelson LC, Spence JR, eds. Translational gastroenterology: organogenesis to disease. John Wiley & Sons, 2014:99. 14. Wales PW, de Silva N, Kim J, et al. Neonatal short bowel syndrome: population-based estimates of incidence and mortality rates. J Pediatr Surg 2004;39:690–695. 15. Sanderson IR. Dietary regulation of genes expressed in the developing intestinal epithelium. Am J Clin Nutr 1998; 68:999–1005. 16. Spence JR, Lauf R, Shroyer NF. Vertebrate intestinal endoderm development. Dev Dyn 2011;240:501–520. 17. van den Brink GR. Hedgehog signaling in development and homeostasis of the gastrointestinal tract. Physiol Rev 2007;87:1343–1375. 18. Middendorp S, Schneeberger K, Wiegerinck CL, et al. Adult stem cells in the small intestine are intrinsically programmed with their location-specific function. Stem Cells 2014;32:1083–1091. 19. Bosse T, Piaseckyj CM, Burghard E, et al. Gata4 is essential for the maintenance of jejunal-ileal identities in the adult mouse small intestine. Mol Cell Biol 2006; 26:9060–9070. 20. Fang R, Olds LC, Sibley E. Spatio-temporal patterns of intestine-specific transcription factor expression during postnatal mouse gut development. Gene Expr Patterns 2006;6:426–432. 21. Battle MA, Bondow BJ, Iverson MA, et al. GATA4 is essential for jejunal function in mice. Gastroenterology 2008;135:1676–1686.e1. 22. Walker EM, Thompson CA, Kohlnhofer BM, et al. Characterization of the developing small intestine in the absence of either GATA4 or GATA6. BMC Res Notes 2014;7:902. 23. Kohlnhofer BM, Thompson CA, Walker EM, et al. GATA4 regulates epithelial cell proliferation to control intestinal growth and development in mice. Cell Mol Gastroenterol Hepatol 2016;2:189–209. 24. Beuling E, Bosse T, aan de Kerk DJ, et al. GATA4 mediates gene repression in the mature mouse small intestine through interactions with friend of GATA (FOG) cofactors. Dev Biol 2008;322:179–189. 25. Srinivas S, Watanabe T, Lin CS, et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 2001;1:4. 26. Nagy A, Rossant J, Nagy R, et al. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A 1993; 90:8424–8428. 27. Wood SA, Allen ND, Rossant J, et al. Non-injection methods for the production of embryonic stem cellembryo chimaeras. Nature 1993;365:87–89. 28. Madison BB, Dunbar L, Qiao XT, et al. Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J Biol Chem 2002;277:33275–33283. 29. Watt AJ, Battle MA, Li J, et al. GATA4 is essential for formation of the proepicardium and regulates cardiogenesis. Proc Natl Acad Sci U S A 2004;101:12573–12578.

-,

No.

-

30. Driegen S, Ferreira R, van Zon A, et al. A generic tool for biotinylation of tagged proteins in transgenic mice. Transgenic Res 2005;14:477–482. 31. He A, Shen X, Ma Q, et al. PRC2 directly methylates GATA4 and represses its transcriptional activity. Genes Dev 2012;26:37–42. 32. Soriano P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 1999;21:70–71. 33. Guo J, Longshore S, Nair R, et al. Retinoblastoma protein (pRb), but not p107 or p130, is required for maintenance of enterocyte quiescence and differentiation in small intestine. J Biol Chem 2009;284:134–140. 34. Bondow BJ, Faber ML, Wojta KJ, et al. E-cadherin is required for intestinal morphogenesis in the mouse. Dev Biol 2012;371:1–12. 35. Duncan SA, Nagy A, Chan W. Murine gastrulation requires HNF-4 regulated gene expression in the visceral endoderm: tetraploid rescue of Hnf-4(-/-) embryos. Development 1997;124:279–287. 36. Walker EM, Thompson CA, Battle MA. GATA4 and GATA6 regulate intestinal epithelial cytodifferentiation during development. Dev Biol 2014;392:283–294. 37. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 2005;102:15545–15550. 38. Aronson BE, Rabello Aronson S, Berkhout RP, et al. GATA4 represses an ileal program of gene expression in the proximal small intestine by inhibiting the acetylation of histone H3, lysine 27. Biochim Biophys Acta 2014; 1839:1273–1282. 39. Zhang Y, Liu T, Meyer CA, et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 2008;9:R137. 40. Ji H, Jiang H, Ma W, et al. An integrated software system for analyzing ChIP-chip and ChIP-seq data. Nat Biotechnol 2008;26:1293–1300. 41. He A, Pu WT. Genome-wide location analysis by pull down of in vivo biotinylated transcription factors. Curr Protoc Mol Biol 2010, Chapter 21: Unit 21.20. 42. Gao X, Sedgwick T, Shi YB, et al. Distinct functions are implicated for the GATA-4, -5, and -6 transcription factors in the regulation of intestine epithelial cell differentiation. Mol Cell Biol 1998;18:2901–2911. 43. van Wering HM, Bosse T, Musters A, et al. Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4. Am J Physiol Gastrointest Liver Physiol 2004; 287:G899–G909. 44. Friedrich G, Soriano P. Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev 1991; 5:1513–1523. 45. Zambrowicz BP, Imamoto A, Fiering S, et al. Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of betagalactosidase in mouse embryos and hematopoietic cells. Proc Natl Acad Sci U S A 1997;94:3789–3794. 46. Rojas A, Kong SW, Agarwal P, et al. GATA4 is a direct transcriptional activator of cyclin D2 and Cdk4 and is required for cardiomyocyte proliferation in anterior heart

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC

2772 2773 2774 2775 2776 2777 2778 2779 2780 2781 2782 2783 2784 2785 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2809 2810 2811 2812 2813 2814 2815 2816 2817 2818 2819 2820 2821 2822 2823 2824 2825 2826 2827 2828 2829 2830

-

2831 2832 2833 2834 2835 2836 2837 2838 2839 2840 2841 2842 2843 2844 2845 2846 2847 2848 2849 2850 2851 2852 2853 2854 2855 2856 2857 2858 2859 2860 2861 2862 2863 2864 2865 2866 2867 2868 2869 2870 2871 2872 2873 2874 2875 2876 2877 2878 2879 2880 2881 2882 2883 2884 2885 2886 2887 2888 2889

2017

47.

48.

49. 50.

51. 52.

53.

54.

GATA4 Regionalizes the Intestine

field-derived myocardium. Mol Cell Biol 2008; 28:5420–5431. Bossard P, Zaret KS. Repressive and restrictive mesodermal interactions with gut endoderm: possible relation to Meckel’s diverticulum. Development 2000; 127:4915–4923. Zheng R, Rebolledo-Jaramillo B, Zong Y, et al. Function of GATA factors in the adult mouse liver. PLoS One 2013; 8:e83723. Hagenbuch B, Dawson P. The sodium bile salt cotransport family SLC10. Pflugers Arch 2004;447:566–570. Dawson PA, Hubbert M, Haywood J, et al. The heteromeric organic solute transporter alpha-beta, OstalphaOstbeta, is an ileal basolateral bile acid transporter. J Biol Chem 2005;280:6960–6968. Lee FY, Lee H, Hubbert ML, et al. FXR, a multipurpose nuclear receptor. Trends Biochem Sci 2006;31:572–580. Kim I, Ahn SH, Inagaki T, et al. Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res 2007;48:2664–2672. Jung D, Inagaki T, Gerard RD, et al. FXR agonists and FGF15 reduce fecal bile acid excretion in a mouse model of bile acid malabsorption. J Lipid Res 2007;48:2693–2700. Landrier JF, Grober J, Zaghini I, et al. Regulation of the ileal bile acid-binding protein gene: an approach to determine its physiological function(s). Mol Cell Biochem 2002;239:149–155.

25

2890 2891 Correspondence 2892 Address correspondence to: Michele A. Battle, PhD, Department of Cell 2893 Biology, Neurobiology and Anatomy, Medical College of Wisconsin, 8701 2894 Watertown Plank Road, Milwaukee, Wisconsin 53226. e-mail: Q1 [email protected]; fax: (414) 955-6517. 2895 2896 Acknowledgments The authors thank Drs Stephen Krasinski and Boaz Aronson (Division of 2897 Gastroenterology and Nutrition, Department of Medicine, Children’s 2898 Hospital Boston, and Harvard Medical School, Boston, MA) for providing Gata4flbio/flbio::ROSA26BirA/BirA and ROSA26BirA/BirA mouse lines, and Dr Frank 2899 Costantini (Columbia University, New York, NY) for providing pBigT and 2900 pROSA26PA plasmids. The authors thank Jixuan Li and Dr Roman 2901 Stavniichuk (Department of Cell Biology, Neurobiology, and Anatomy, Medical College of Wisconsin, Milwaukee, WI) for expert technical assistance and Dr 2902 Stephen Duncan (Department of Regenerative Medicine and Cell Biology, 2903 Medical University of South Carolina, Charleston, SC) for providing the pcDNA-GATA4 plasmid and for helpful discussions and input into the project. 2904 Cayla A. Thompson contributed to the experimental design, performed most 2905 of the experiments, analyzed data, and prepared the manuscript draft; Kevin Wojta generated the Gata4 conditional knock-in mouse line; Kirthi Pulakanti 2906 and Sridhar Rao analyzed the bioChIP-seq data and contributed to 2907 manuscript preparation; Paul Dawson contributed to the experimental design and reviewed the manuscript; and Michele A. Battle conceived and 2908 coordinated the project, contributed to the experimental design and data 2909 analysis, prepared figures, and prepared the final version of the manuscript. 2910 All authors read and approved the final manuscript. 2911 Conflicts of interest 2912 Q2 The authors disclose no conflicts. 2913 Funding 2914 Supported by the US National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases (DK087873 to M.A.B. and DK047987 to 2915 P.D.), Advancing a Healthier Wisconsin (M.A.B.), Hyundai Hope on Wheels Q3 2916 Q4 Award (S.R.), and the Midwest Athletes against Childhood Cancer fund (S.R.). 2917 2918 2919 2920 2921 2922 2923 2924 2925 2926 2927 2928 2929 2930 2931 2932 2933 2934 2935 2936 2937 2938 2939 2940 2941 2942 2943 2944 2945 2946 2947 2948 Received March 7, 2016. Accepted December 29, 2016.

FLA 5.4.0 DTD
JCMGH201 proof
11 February 2017
5:52 pm
ce DVC