GCMB gene, a master regulator of parathyroid gland development, expression, and regulation in hyperparathyroidism

GCMB gene, a master regulator of parathyroid gland development, expression, and regulation in hyperparathyroidism Electron Kebebew, MD, Miao Peng, MD, Mariwil G. Wong, BS, David Ginzinger, PhD, Quan-Yang Duh, MD, and Orlo H. Clark, MD, San Francisco, Calif

Background. The glial cell missing gene, GCMB, encodes a transcription factor, which is a master regulator of parathyroid development. We postulated that the GCMB gene might play a role in parathyroid tumorigenesis in hyperparathyroidism. Methods. We used real-time quantitative reverse transcriptase polymerase chain reaction to study GCMB mRNA expression in parathyroid tissue: normal (n = 3), hyperplastic (n = 16), adenomas (n = 19), and cancers (n = 8). In primary parathyroid culture, the effect of CaCl2 on parathyroid hormone secretion and GCMB mRNA expression was studied by using enzyme-linked immunosorbent assay and reverse transcriptase polymerase chain reaction, respectively. Results. GCMB mRNA expression was lower in normal (0.4 ± 0.1, mean ± standard error of mean) parathyroid glands as compared to adenoma (3.5 ± 1.7), hyperplasia (3.2 ± 1.3 primary hyperparathyroidism [n = 11] and 7.6 ± 4.8 secondary hyperparathyroidism [n = 5]), and cancer (3.6 ± 1.3) (P = .001). There was no difference in the level of GCMB mRNA expression between parathyroid adenoma, hyperplasia, and cancer. In primary culture of parathyroid adenoma (n = 9) and hyperplasia (n = 2), parathyroid hormone secretion was increased 2- to 15-fold with low calcium concentration (0.5 to 4.0 mmol/L CaCl2 from 2 to 6 hours, P < .005). The level of GCMB mRNA expression was downregulated with lower extracellular CaCl2 concentration (P < .005). Conclusions. GCMB expression is upregulated in abnormal parathyroid glands of hyperparathyroidism and decreases in response to hypocalcemia. The GCMB transcription factor might mediate the effect of calcium on parathyroid cell parathyroid hormone expression/secretion. (Surgery 2004;136:1261-6.) From the Department of Surgery, University of California, San Francisco, and UCSF Comprehensive Cancer Center, San Francisco, Calif

THE GLIAL CELL MISSING (gcm) gene was initially identified and found to regulate differentiation of neuroepithelial precursors cells in Drosophila.1 Gcm encodes a transcription factor with a novel DNA-binding domain.2 There are 2 mammalian Presented at the 25th Annual Meeting of the American Association of Endocrine Surgeons, Charlottesville, Virginia, April 4-6, 2004. Supported by grants from the Harold Amos Medical Faculty Development Program of the Robert Wood Johnson Foundation and the Hellman Family Award for Early Career Faculty (E.K.) and in part by the Sanford and Helen Diller Foundation, the Albert Clark Family Foundation, and Mount Zion Health systems. Reprint requests: Electron Kebebew, MD, University of California, San Francisco, Department of Surgery, Box 1674, San Francisco, CA 94143-1674. 0039-6060/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.surg.2004.06.056

homologues of the Drosophila gcm gene, in mouse (gcm1 and gcm2) and humans (GCMA and GCMB).3 GCMB is located on chromosome 6p2324, which consists of 5 exons and shares a significant homology with the Drosophila orthologe.4 Unlike in Drosophila, mammalian gcm1 and gcm2 are important in placental and parathyroid gland development, respectively.5,6 Double-knockout gcm2 mice lack parathyroid glands and develop severe hypocalcemia and hyperphosphatemia.6 In humans, a germline homozygous deletion in the GCMB gene, spanning exons 1 to 4, has been observed in a proband with familial isolated hypoparathyroidism with parents who were heterozygous for the deletion.7 Recent studies suggest that GCMB expression might be primarily restricted to the parathyroid glands.4,8,9 Mice deficient in gcm2 lack parathyroid glands, and in humans, similarly, GCMB deficiency is associated with hypoparathyroidism, and GCMB expression SURGERY 1261

1262 Kebebew et al

Surgery December 2004

Table I. Clinicopathologic characteristic and GCMB mRNA expression level in parathyroid tissue GCMB mRNA expression level Primary HPT Adenoma (n = 19)* Hyperplasia (n = 11)y Cancer (n = 8)z Secondary HPT Hyperplasia (n = 5) Normal parathyroid glands (n = 3)

Sex (M/F)

Age (y)

Serum total calcium (mg/dL)

PTH (intact, ng/mL)

62.5 ± 2.9 63.1 ± 4.2 53.2 ± 4.3

11.1 ± 0.7 10.7 ± 0.3 13.0 ± 0.6

245.9 ± 73.4 138.5 ± 15.7 607.1 ± 163.1

46.8 ± 5.0 61.7 ± 1.2

9.7 ± 0.4 NA

912.7 ± 171.3 NA

14/24 3.5 ± 1.7 3.2 ± 1.3 3.6 ± 1.3 4/1 7.6 ± 4.8 0.4 ± 0.1

2/1

HPT, Hyperparathyroidism; NA, not applicable. *One patient had familial HPT, 2 patients had a double adenoma, and the remaining patients had sporadic solitary adenoma. yTwo patients had MEN 1, and the remaining were sporadic cases. zOne patient had parathyromatosis.

appears to be restricted to parathyroid glands. Thus, the GCMB gene has been proposed to be a master regulator of mammalian parathyroid development.4 The genetic factors involved in parathyroid tumorigenesis are not clearly understood. Two genes currently have established roles in the development of primary hyperparathyroidism.10 First, a chromosomal rearrangement of the cyclinD1 gene to the PTH gene loci occurs in about 18% of sporadic parathyroid tumors.10 The cyclinD1, part of the cyclin-dependent kinase cell cycle regulatory complex, is overexpressed in up to 40% of sporadic parathyroid adenomas. Biallelic loss of the MEN1 tumor suppressor gene, menin, has also been observed in up to 20% of sporadic parathyroid adenomas.11-13 We postulated that the GCMB gene might play a role in parathyroid tumorigenesis and characterized its expression in parathyroid tissue from patients with primary and secondary hyperparathyroidism. GCMB mRNA expression was significantly lower in normal parathyroid tissue as compared to parathyroid adenomas, hyperplasia (causing both primary and secondary hyperparathyroidism), and cancer. Furthermore, low calcium concentration down-regulated GCMB mRNA expression in parathyroid adenoma and hyperplasia primary cultures. METHODS Parathyroid tissue samples. Parathyroid tissue samples including clinical and histopathologic data were obtained for 46 patients with approval of the Committee on Human Research at the University of California, San Francisco. Forty-one patients had primary hyperparathyroidism: 19 adenomas, 14 hyperplasias, and 8 cancers (Table I). Five patients had secondary hyperparathyroidism as a result of chronic renal failure. Parathyroid tissue was snap frozen immediately after resection

and stored at ÿ80°C. Parathyroid tissue diagnoses were confirmed by permanent histologic evaluation, operative findings, and follow-up calcium and parathyroid hormone (PTH) levels. The 3 normal parathyroid gland samples were obtained from biopsy specimens at the time of neck exploration (n = 2) and parathyroidectomy, or after cryopreservation (n = 1). Real-time quantitative reverse transcriptase polymerase chain reaction. Total RNA was extracted from the parathyroid tissue by using the TRIzol reagent (Invitrogen, Carlsbad, Calif) according to the manufacturer’s instructions. Total RNA (125 ng/lL) was reverse transcribed by using random hexamers by using a first-strand cDNA synthesis kit (Amersham Biosciences, Piscataway, NJ). Real-time quantitative polymerase chain reaction (PCR) was used to measure GCMB mRNA expression relative to b-glucuronidase (GUS), as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression. The following PCR primers and sequences of the labeled probes (5#FAM-sequence3#TAMRA) were used: GCMB: 5#AGTTGATTCCTTGTCGAGGGCA 3# (forward), 5#TCGCGTTGCCATCAAGC 3# (reverse), and probe GCMB 5#AGCGGATACCCCGTAACCAACTTTTGG 3#9; GUS: 5#CTCATTTGGAATTTTGCCGATT 3# (forward), GUS 5#CCGAGTGAAGATCCCCTTTTTA 3# (reverse), and GUS probe 5#TGAACAGTCACCGACGAGAGTGCTGG 3#. Combined GAPDH primers and probe (Assays-on-Demand) were purchased from Applied Biosystems (Foster City, Calif). All PCR reactions were performed in a final volume of 50 lL on an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The PCR mixture contained 10 lL cDNA template, 10 lL 53 TM buffer, 11 lL 25 mmol/L MgCl2, 0.4 lL of 25 mmol/L deoxyribonucleoside triphosphate (deoxyadenosine monophosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and

Surgery Volume 136, Number 6

Kebebew et al 1263

Fig 1. Relative GCMB mRNA expression level in parathyroid tissues. A, Expression level by parathyroid histology in patients with primary hyperparathyroidism. Horizontal dashed line represents the highest level of GCMB mRNA expression in normal parathyroid glands. B, Comparison of relative GCMB mRNA expression level in hyperplastic parathyroid glands from primary and secondary hyperparathyroidism. Horizontal dashed line in graph represents the mean of the samples. PHPT, Primary hyperparathyroidism; SHPT, secondary hyperparathyroidism. GCMB mRNA expression level was normalized to GUS.

deoxyuridine triphosphate), 0.25 lL of 13 AmpliTaq Gold (Applied Biosystems, Foster City, Calif), 0.5 lL of forward/reverse primer (50 lmol/L), 0.5 lL of probe (20 lmol/L), and 9 lL Aquanase (RNAse free water) (Tel Test Inc, Friendswood, Tex). All experiments were done in triplicate and repeated twice. The expression levels of GCMB presented were normalized to GUS as previously described.14 Primary parathyroid tissue culture. Fresh parathyroid tissue was cultured according to the methods described by LeBoff et al.15 Parathyroid tissue was sectioned into 1- to 2-mm pieces immediately after surgical removal, digested with collagenase, and filtered. The parathyroid cells were cultured in Dulbecco modified Eagle medium with 0.1% fetal calf serum and 20 mmol/L HEPES by using variable CaCl2 concentration. The cells were incubated in 15-mL polypropylene tubes in a shaking incubator at 37°C, 95% O2 and 5% CO2. After indicated incubation periods the supernatant was collected for PTH enzyme-linked immunosorbent assay (ELISA) analysis and the cell pellet for RNA extraction and real-time quantitative reverse transcriptase PCR. Cell viability was determined at harvesting of cells by using trypan blue exclusion hemocytometry and showed greater than 90% and 70% viability at 6 and 24 hours, respectively. PTH ELISA. Quantitative measurement of PTH secretion in the primary parathyroid culture media was done by using the intact PTH ELISA kit in

accordance with the manufacturer’s protocol (MD Biosciences, St. Paul, Minn). This assay detects only the intact 84 amino acid chain of PTH. Standard curves were generated for each experiment, and samples were run in triplicate and repeated twice. Statistical analysis. All data were analyzed with the Stat View 4.51 statistical software (SAS Inc, Cary, NC). Data were compared by using analysis of variance and paired t test. To determine possible correlations between relative GCMB mRNA expression and serum calcium, PTH levels, and other clinical and histopathologic variables, the Pearson product-moment and the Spearman rank correlation coefficients were calculated. A P value less than .05 was considered statistically significant. RESULTS GCMB mRNA expression in parathyroid tissue. GCMB mRNA expression was lower in normal (0.4 ± 0.1, mean ± standard error of mean) parathyroid glands as compared to adenomas (3.5 ± 1.7), hyperplasia (3.2 ± 1.3 primary hyperparathyroidism [n = 11] and 7.6 ± 4.8 secondary hyperparathyroidism [n = 5]), and cancer (3.6 ± 1.3) (P = .001) (Table I). In 10 adenomas (53%), 4 hyperplastic glands (25%), and 2 cancers (25%), the level of GCMB mRNA expression was within the range of GCMB mRNA expression level in normal parathyroid glands (Fig 1, A). There was no difference in the level of GCMB mRNA expression between

1264 Kebebew et al

Surgery December 2004

between the level of GCMB mRNA expression and patient age, sex, parathyroid gland size (greatest diameter), and preoperative total serum calcium and PTH levels. PTH secretion and GCMB expression in parathyroid culture. In primary culture of parathyroid adenoma (n = 9) and hyperplasia (n = 2), PTH secretion was increased 2- to 15-fold with lower calcium concentration (P < .005) (Fig 2, A). In contrast, GCMB mRNA expression was down-regulated with a lower calcium concentration level (P < .005) (Fig 2, B).

Fig 2. The effect of CaCl2 on PTH secretion and GCMB mRNA expression in primary dispersed culture of parathyroid cells. A, The effect of CaCl2 (0.5 and 4.0 mmol/L at 4 h) on PTH secretion in dispersed parathyroid cell culture. B, The upper panel shows the effect of CaCl2 (0.5 and 4.0 mmol/L at 4 h) on GCMB mRNA expression level in dispersed parathyroid cell culture. The lower panel shows the effect of CaCl2 on GCMB mRNA expression with time (2 to 6 h). GCMB mRNA expression level was normalized to GUS mRNA expression level.

parathyroid adenoma, hyperplasia, and cancer. Although the GCMB mRNA expression level appeared higher in hyperplastic parathyroid glands from secondary hyperparathyroidism (7.63 ± 4.79) than those from primary hyperparathyroidism (3.19 ± 1.33), this difference was not statistically significant (Fig 1, B). Interestingly, in hyperplastic parathyroid glands (n = 2) and double adenomas (n = 2) from the same patient, GCMB mRNA expression level varied considerably, 0.7 to 11.5 and 0.6 to 25.9, respectively. There was a correlation between GCMB mRNA expression level normalized to either GUS or GAPDH (R = 0.49, P < .005). In parathyroid tissue from patients with primary hyperparathyroidism, there was no significant correlation

DISCUSSION The relationship between the 2 properties of increased parathyroid cell proliferation and abnormal PTH secretion in hyperparathyroidism is unclear. In primary hyperparathyroidism, inappropriate PTH secretion is thought to occur because of a loss in the feedback control by extracellular calcium via the calcium-sensing receptor.16 In secondary hyperparathyroidism, chronic stimulation of the parathyroid glands by exogenous factors such as low calcium and vitamin D levels or an elevated phosphorus level stimulates PTH secretion and eventually leads to hyperplastic and adenomatous overgrowth of the parathyroid gland. It remains unclear whether the oversecretion of PTH is mainly an unopposed increase of PTH synthesis/secretion at the cellular level, or whether it is due to an increase in parathyroid cell mass with only a minor or no increase in PTH production per cell. Although some of the genetic defects responsible for hyperparathyroidism have been identified, they account for only a small subset of patients with hyperparathyroidism. Some investigators consider tumorigenesis to be a ‘‘developmental disorder’’ because molecular factors that coordinate cellular proliferation and differentiation in development, when disrupted, lead to uncontrolled cell growth and dedifferentiation. Most endocrine neoplasms are unique in that they usually retain the normal cellular differentiated function and phenotype. Given that the GCMB gene appears to be a critical regulator of parathyroid development in mammals, we were interested in studying the in situ expression profile of this gene among the different parathyroid histologies. Because absent GCMB is associated with hypoparathyroidism, if the GCMB gene were involved in parathyroid tumorigenesis, one would expect an overexpression or constitutive activation of this gene to occur in parathyroid neoplasm.7 Interestingly, however, Correa et al9 have reported underexpression of gcm2 (GCMB) mRNA in para-

Kebebew et al 1265

Surgery Volume 136, Number 6

thyroid adenoma (n = 9) of primary hyperparathyroidism as compared to normal (n = 5) and hyperplastic (n = 9) parathyroid glands from patients with uremia. We, however, found a lower expression of the GCMB mRNA in normal parathyroid glands as compared to hyperplastic and neoplastic parathyroid glands causing primary and secondary hyperparathyroidism. It is unclear why there is a discrepancy between our study findings and theirs, especially when the same GCMB primer and probes and quantitative PCR technique were used in both studies. To further confirm our result, we used GAPDH mRNA expression to normalize GCMB mRNA expression, but the study findings did not change, and there was good correlation between GUS and GAPDH mRNA expression levels. The mechanism by which deregulated GCMB gene expression might play a role in parathyroid tumorigenesis is uncertain. Activating mutations or amplification of the GCMB gene might account for this. On the other hand, the deregulated expression of the GCMB gene in parathyroid neoplasm might result from upstream signals or other transcription factors such as Hoxa3, Pax1, Pax9, and Eya1, which are also important in parathyroid organogenesis and modulate gcm2 expression in transgenic mouse.17-20 Extracellular calcium is one of the main stimuli for parathyroid proliferation and PTH expression and secretion. As expected, PTH secretion was markedly increased with lower calcium concentration in primary cultures of hyperplastic and adenomatous parathyroid glands as previously reported.15 GCMB is an early response gene that encodes a labile transcription protein, similar to other early response transcriptional genes such as c-Myc.21 The down-regulation of GCMB mRNA expression observed with a low calcium concentration suggests that this gene might be important in mediating the effect of extracellular calcium on PTH expression and/or secretion in parathyroid cells. In summary, GCMB mRNA expression is upregulated in abnormal parathyroid glands of hyperparathyroidism and decreases in response to lower extracellular calcium concentration. Although determining the level of GCMB mRNA expression in parathyroid glands might prove to be useful for distinguishing abnormal from normal parathyroid glands in patients with hyperparathyroidism, there was significant overlap in the expression level of this gene between normal and abnormal parathyroid glands among different patient samples. Future studies of GCMB gene amplification, mutation, or epigenetic changes

might help elucidate the role of this gene in the pathogenesis of hyperparathyroidism, as well as the relationship of increased parathyroid cell proliferation and abnormal PTH secretion that are present in hyperparathyroidism.

REFERENCES 1. Wegner M. Expression of transcription factors during oligodendroglial development. Microsc Res Tech 2001;52: 746-52. 2. Schreiber J, Sock E, Wegner M. The regulator of early gliogenesis glial cells missing is a transcription factor with a novel type of DNA-binding domain. Proc Natl Acad Sci U S A 1997;94:4739-44. 3. Kim J, Jones BW, Zock C, et al. Isolation and characterization of mammalian homologs of the Drosophila gene glial cells missing. Proc Natl Acad Sci U S A 1998;95:12364-9. 4. Kanemura Y, Hiraga S, Arita N, et al. Isolation and expression analysis of a novel human homologue of the Drosophila glial cells missing (gcm) gene. FEBS Lett 1999; 442:151-6. 5. Schreiber J, Riethmacher-Sonnenberg E, Riethmacher D, et al. Placental failure in mice lacking the mammalian homolog of glial cells missing, GCMa. Mol Cell Biol 2000; 20:2466-74. 6. Gunther T, Chen ZF, Kim J, et al. Genetic ablation of parathyroid glands reveals another source of parathyroid hormone. Nature 2000;406:199-203. 7. Ding C, Buckingham B, Levine MA. Familial isolated hypoparathyroidism caused by a mutation in the gene for the transcription factor GCMB. J Clin Invest 2001;108: 1215-20. 8. Maret A, Bourdeau I, Ding C, Kadkol SS, Westra WH, Levine MA. Expression of GCMB by intrathymic parathyroid hormone-secreting adenomas indicates their parathyroid cell origin. J Clin Endocrinol Metab 2004;89:8-12. 9. Correa P, Akerstrom G, Westin G. Underexpression of Gcm2, a master regulatory gene of parathyroid gland development, in adenomas of primary hyperparathyroidism. Clin Endocrinol (Oxf) 2002;57:501-5. 10. Arnold A, Shattuck TM, Mallya SM, et al. Molecular pathogenesis of primary hyperparathyroidism. J Bone Miner Res 2002;17(Suppl 2):N30-6. 11. Heppner C, Kester MB, Agarwal SK, et al. Somatic mutation of the MEN1 gene in parathyroid tumours. Nat Genet 1997; 16:375-8. 12. Carling T, Correa P, Hessman O, et al. Parathyroid MEN1 gene mutations in relation to clinical characteristics of nonfamilial primary hyperparathyroidism. J Clin Endocrinol Metab 1998;83:2960-3. 13. Farnebo F, Teh BT, Kytola S, et al. Alterations of the MEN1 gene in sporadic parathyroid tumors. J Clin Endocrinol Metab 1998;83:2627-30. 14. Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 2002;30:503-12. 15. LeBoff MS, Shoback D, Brown EM, et al. Regulation of parathyroid hormone release and cytosolic calcium by extracellular calcium in dispersed and cultured bovine and pathological human parathyroid cells. J Clin Invest 1985;75:49-57. 16. Kebebew E, Clark OH. Parathyroid adenoma, hyperplasia, and carcinoma: localization, technical details of primary

1266 Kebebew et al

17.

18.

19.

20.

21.

neck exploration, and treatment of hypercalcemic crisis. Surg Oncol Clin N Am 1998;7:721-48. Xu PX, Zheng W, Laclef C, et al. Eya1 is required for the morphogenesis of mammalian thymus, parathyroid and thyroid. Development 2002;129:3033-44. Peters H, Neubuser A, Kratochwil K, Balling R. Pax9deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev 1998;12:2735-47. Su D, Ellis S, Napier A, Lee K, Manley NR. Hoxa3 and pax1 regulate epithelial cell death and proliferation during thymus and parathyroid organogenesis. Dev Biol 2001; 236:316-29. Manley NR, Capecchi MR. The role of Hoxa-3 in mouse thymus and thyroid development. Development 1995;121: 1989-2003. Tuerk EE, Schreiber J, Wegner M. Protein stability and domain topology determine the transcriptional activity of the mammalian glial cells missing homolog, GCMb. J Biol Chem 2000;275:4774-82.

DISCUSSION Dr Janice L. Pasieka (Calgary, Alberta, Canada). Did you compare your results of gcm2 gene expression with the histology? We know that parathyroid adenomas can be predominately oxyphilic or clear cell, and I am wondering whether some of your variability is based on a different parathyroid histology. Dr Melanie L. Richards (San Antonio, Tex). When patients were hypocalcemic in secondary hyperparathyroidism, their gcm2 genes were still increased in expression, but yet when the cells were exposed, the hypocalcemia decreased. Why does this occur? Dr Brad Mitchell. I was intrigued by your double adenoma and the variable expression. I wondered whether you looked at calcium set points in the lab,

Surgery December 2004

which I realize was difficult, or whether you had intraoperative PTH during the resection of those adenomas that might help get at that same question, whether this is related to the set-point in the gland. Dr Herbert Chen (Madison, Wis). Can you tell us a little bit about gcm2 downstream binding sites? Have they described target genes that might lead to increased proliferation? Dr Kebebew. Dr Pasieka, yes, we did make that comparison. In fact, we are not certain whether it is expressed in the chief cells or the oxyphilic cells. Unfortunately, there currently are no specific antibody or RNA probes to definitely address this issue. Dr Richards, there are several possible mechanisms. First, patients with secondary hyperparathyroidism had low calcium levels, but their systemic calcium levels were not hypocalcemic. Another important factor might be the effect of vitamin D and phosphorus on GCMB expression. Dr Mitchell, it is enticing to speculate that it might indeed be related to a dysregulated calcium set-point. Unfortunately, for those cases we did not have intraoperative PTH levels determined, but certainly we have other cases that we could go back to for which we did have intraoperative PTH measurements where it did not fall and then determine whether there was a difference in GCMB expression. Dr Chen, the GCMB regulated downstream genes have not been clearly defined. I think one of the things you would want to look at is its effect on PTH expression. There are other transcription factors that are in the same family such as Sp1 and Sp2, which are homologous, and regulate PTH expression. So one could speculate as such, but I think we would need to show functional repression or transactivation of the PTH gene.