Gene cloning, expression, and function analysis of SpL14-3-3ζ in Spodoptera litura and its response to the entomopathogenic fungus Nomuraea rileyi

Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Gene cloning, expression, and function analysis of SpL14-3-3ζ in Spodoptera litura and its response to the entomopathogenic fungus Nomuraea rileyi Eryan Feng a, Huan Chen b, Yan Li a, Wei Jiang a, Zhongkang Wang a, Youping Yin a,⁎ a b

School of Life Science, Chongqing University, Chongqing Engineering Research Center for Fungal Insecticide, 400030, China Institute of Plant Physiology and Ecology, Chinese Academy of Sciences Key Laboratory of Insect Developmental and Evolutionary Biology, CAS, Shanghai, 200032, China

a r t i c l e

i n f o

Article history: Received 28 November 2013 Received in revised form 7 April 2014 Accepted 9 April 2014 Available online 16 April 2014 Keywords: 14-3-3ζ Gene function Nomuraea rileyi RNA interference Spodoptera litura

a b s t r a c t The 14-3-3 proteins, a highly evolutionarily conserved and ubiquitous protein family in eukaryotic cells, have a range of biological functions including regulation of signal transduction, stress response, apoptosis, and control of the cell cycle. To investigate the function of 14-3-3 in Spodoptera litura, the full length of 14-3-3ζ was cloned from S. litura on the basis of an expressed sequence tag of 14-3-3ζ from the S. litura fat body suppression subtractive hybridization library, and named SpL14-3-3ζ. SpL14-3-3ζ cDNA was 1196 bp with an open reading frame of 744 bp, encoding 247 amino acids. Multiple alignment analysis revealed the putative amino acids shared N80% homology with 14-3-3ζ from other organisms and shared typical conservative structures. Phylogenetic analysis confirmed SpL14-3-3ζ was closely related to other available Lepidoptera 14-3-3ζ. Real-time PCR analysis indicated SpL14-3-3ζ was expressed throughout the developmental stages of S. litura, with a relatively high expression level in pre-pupa, and was expressed constitutively in all examined tissues with relatively high levels in hemocytes and midgut. Moreover, the transcription level of SpL14-3-3ζ could be induced by Nomuraea rileyi infection, up-regulated in hemocytes, followed by head, fat body and midgut. Knocking down SpL14-3-3ζ transcripts by RNAi significantly increased S. litura sensitivity to fungal infection, and resulted in higher mortality of S. litura during the larval development. These results provide novel insights into the 14-3-3ζ signal regulation which may be related to host defense as well as larval development in S. litura. © 2014 Elsevier Inc. All rights reserved.

1. Introduction The 14-3-3 proteins, a highly conservative enigmatic family, were discovered originally in mammals in 1967 with a high level of expression observed in the brain (Moore and Perez, 1967). The name was based on their separation by two-dimensional diethyl aminoethyl cellulose column chromatography and their specific migration patterns upon starch gel electrophoresis. All the recorded 14-3-3 proteins are acidsoluble proteins, with a molecular mass of ~30 kDa, no transmembrane segment sequence and 14-3-3 proteins interact with a variety of different biological functional proteins in forms of homo or hetero dimers (David et al., 1995; Baxter et al., 2002; Alastair, 2006). The 14-3-3 proteins were first found in plants in the 1990s, now they are thought to be ubiquitous in eukaryotic cells, ranging from amphibious animals, insects, plants, fish, elegans to yeast and humans, and involved in diverse physiological processes, including cell survival (Hemert et al., 2001; Gavin et al., 2006; Liou et al., 2006; Alyson and Deborah, 2011), apoptosis (Xing et al., 2000; Hemert et al., 2001; Rosenquist, 2003; Macha ⁎ Corresponding author at: School of Life Science, Chongqing University, 400030, China. Tel./fax: 86 023 65120489. E-mail address: [email protected] (Y. Yin).

http://dx.doi.org/10.1016/j.cbpb.2014.04.003 1096-4959/© 2014 Elsevier Inc. All rights reserved.

et al., 2010), signal transduction (Alexander and Morris, 2006), molecular chaperone (Sluchanko et al., 2012), host defense (Chen et al., 2006; Sonia et al., 2012) and stress response (Michael et al., 2002; Chongsatja et al., 2007; Elmayan et al., 2007), by binding their ligands based on specific binding motifs, including RSxpSxP, Rx1-2Sx2-3S, other phosphoserine motifs and non-phosphorylated motifs (Fu et al., 2000; Yong et al., 2009). Currently, the largest 14-3-3 protein members known are in Arabidopsis thaliana with a total of 15 isoforms, among which at least 13 expressed (Rosenquist et al., 2001). Similarly, seven 14-3-3 mammalian isoforms have been described and named α to η; α and δ are the phosphorylated forms of β and ζ, respectively (Heusden et al., 1995; Voigt et al., 2000; Nunes et al., 2004; Heusden and Steensma, 2006). Only the ε and ζ 14-3-3 isoforms have been reported in insects, and few of intensive studies of genetics and molecular functions of 14-3-3 s in insects are mainly conducted on Drosophila melanogaster. It has been reported that Drosophila 14-3-3ε has a crucial role in anti-microbial peptide secretion and innate immunity (Shandala et al., 2011). Drosophila 14-3-3ζ functioned as a stress-induced molecular chaperone to protect cells against physiological stress by dissolving thermal-aggregated proteins (Yano et al., 2006), and its enrichment in neurons was essential for learning and memory of Drosophila (Messaritou et al., 2009). Besides, Johanna et al. found 14-3-3ζ was involved in Drosophila resistance

50

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

against Staphylococcus aureus (Johanna et al., 2011). In Lepidoptera insects, Bombyx mori 14-3-3ζ may be involved in the metamorphosis and its immune response against virus (BmNPV) infection (Kong et al., 2007; Bao et al., 2009). S. litura is an economically important polyphagous and worldwide agricultural pest that can harm nearly 100 families (N 300 species) of plants and is difficult to control by chemical pesticides owing to its developmental resistance mechanisms (Kranthi et al., 2002; Pan et al., 2005; Ahmad et al., 2007). Naturally occurring entomopathogens are important regulatory factors of insect populations. Nomuraea rileyi, a dimorphic hyphomycete that can infect more than 30 Lepidoptera pests, has strong pathogenicity especially toward Noctuidae insects, including Heliothis armigera, S. litura and Heliothis virescens, and can be used as a potential biocontrol agent in pest control (Srisukchayakul et al., 2005; Suwannakut et al., 2005; Sandhu et al., 2012). In this study, we cloned a SpL14-3-3ζ gene from the S. litura fat body suppression subtractive library (SSH; Chen et al., 2012), and studied its role in S. litura and its response to N. rileyi infection. Our results will be helpful for understanding the molecular response mechanism of S. litura to N. rileyi infection, providing a scientific basis for controlling S. litura with the 14-3-3 protein as the target.

2. Materials and methods 2.1. Breeding S. litura and culture of N. rileyi S. litura larvae were reared on an artificial diet at 27 ± 1 °C in a 16 h: 8 h light:dark photoperiod and 75 ± 5% relative humidity (RH). Entomopathogenic fungus N. rileyi strain CQNr129, provided by the Genetic Engineering Research Center of Chongqing University, was cultured on Sabouraud maltose agar fortified with 1% (w/w) yeast extract (SMAY) at 28 °C for 10 days until conidiation. A conidia suspension was prepared in phosphate-buffered saline (PBS) at a concentration of 1 × 108 spores/mL.

2.2. cDNA cloning of 14-3-3ζ from S. litura On the basis of an expressed sequence tag (EST) of 14-3-3ζ from the fat body SSH library (Chen et al., 2012), we designed the gene-specific primers for 3′- and 5′-rapid amplification of cDNA ends (RACE). Total RNAs were extracted from the 4th instar larvae using Trizol® reagent (Invitrogen, USA) and about 2 μg of RNA was used to synthesize the first-strand cDNA using the oligo-anchor primer CDSIII and the SMARTII oligonucleotide with SuperScript® II Reverse Transcriptase (Invitrogen, USA) following the manufacturer's instructions. 3′-RACE was done with CDSIII and 14-3-3 F, 5′-RACE was done with SMARTII oligonucleotide and 14-3-3R1 by Touch Down PCR. The secondary nested PCR was carried out with SMARTII oligonucleotide and 14-3-3R2 by diluting the primary PCR product as the template as follows the 3′-RACE. Both the 5′- and 3′-RACE products were cloned into pMD-19 Teasy vector (TaKaRa), sequenced by Sangon. The full length of 14-3-3ζ was obtained by overlapping the two fragments, and named as SpL14-3-3ζ. Primers 14-3-3TF and 14-3-3TR were designed to amplify the entire coding region of SpL14-3-3ζ. All primers used are given in Table 1. 2.3. Analysis of SpL14-3-3ζ genome structure To identify the SpL14-3-3ζ genome structure, we extracted S. litura genomic DNA using E.I.N.A.TM Insect DNA Kit (Omega) according to the manufacturer's instructions. A pair of primers (J14-3-3 F/J14-3-3R) was designed and synthesized according to the full-length cDNA of SpL14-3-3ζ and the amplified PCR product was cloned and sequenced as described above.

Table 1 PCR primers used in present study. Name of primer

Sequence 5′-3′

Cloning SpL14-3-3ζ 3′-RACE CDSIII SMARTII oligonucleotide 14-3-3F 14-3-3R1 14-3-3R2 14-3-3TF 14-3-3TR J14-3-3F J14-3-3R

ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30VN AAGCAGTGGTATCAACGCAGAGTACGCGGG CTGGCGTTAAATTTCTCCGT GGGCAGGTACGAGTCTTCAT ACGGAGAAATTTAACGCCAG GACAAGGAGGAACTGGTGC ATTAGTTGTCGCCGCCCTC AGTGAAGTAATCCTCTCCC ACACCAATGAGAACAAATG

Real time PCR D14-3-3F D14-3-3R Ds14-3-3F Ds14-3-3R DActinF DActinR DGAPDHf DGAPDHr

GCCCACACACCCAATAAGGC CTGACACGCTTTGTCTGGCGA GTCGACAAGGAGGAACTGGT GCCATGTCGTCATATCGTTC TGAGACCTTCAACTCCCCCG GCGACCAGCCAAGTCCAGAC GTATGGCTTTCCGTGTTCCT TGACCTTCTGCTTGATAGCG

DsRNA synthesis for RNAi GFPTf GFPTr S14-3-3Tf S14-3-3Tr

TAATACGACTCACTATAGGGACGTAAACGGCCACAAGTTC TAATACGACTCACTATAGGGTGCTCAGGTAGTGGTTGTCG TAATACGACTCACTATAGGGTGAAGGAAGTCACGGAAACC TAATACGACTCACTATAGGGGACACGCTTTGTCTGGTGAA

Note: V = A, G, or C; N = A, G, C or T.

2.4. Bioinformatics analysis of SpL14-3-3ζ The SpL14-3-3ζ open reading frame (ORF) was identified using the NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Multiple sequence alignments were done with the deduced SpL143-3ζ protein sequence and the homologous sequences of other species in the NCBI database with software DNAMAN 5.2.2. A phylogenetic tree was constructed by the neighbor-joining method using MEGA version 4.1.

2.5. Sample preparation for expression pattern analysis of SpL14-3-3ζ Larvae of different developmental phases (n = 3) were used to analyze developmental stages expression pattern. Sixth instar larvae (n = 10) used for screening differentially expressed genes (such as 14-33ζ) from S. litura fat body SSH library were picked to analyze different tissues/organs (head, cuticle, fat body, midgut, Malpighian tubule and hemocytes) expression patterns. The other three groups of 6th instar larvae (at least 20 larvae in each group) were prepared for inducing expression as follows: group 1 was injected with 5 μL conidia suspension (1 × 108 spores/mL) to each larva; group 2 was injected with 5 μL 6 M H2O2 and group 3 was injected with 5 μL PBS as a control. After treatment, each group was reared separately under the conditions described above. After injection with N. rileyi conidia suspension for 24 h, the larvae were dissected on ice bath and samples of head, cuticle, fat body, midgut, Malpighian tubule and hemocytes were collected from group 1 and group 3 for SpL14-3-3ζ spatial expression pattern analysis after fungal infection. Besides, fat body, midgut and hemocytes were harvested from group 1, group 2 and group 3 at different time points (0 h, 1 h, 3 h, 6 h, 12 h, 24 h and 48 h) after injection to determine tissue expression patterns in different periods. All tissues were obtained by careful dissection of the insects on ice and then washed with diethylpyrocarbonate (DEPC)-treated PBS for RNA extraction, or frozen immediately in liquid nitrogen, and stored at − 80 °C for RNA preparation.

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

2.6. RNA extraction and quantitative real time PCR (qRT-PCR) Total RNAs extracted from different samples were treated with TRIzol® reagent and RNase-free DNase (Fermentas, Vilnius, Lithuania). RNA (2 μg) from each sample was used to synthesize first-strand cDNA using the Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania) following the manufacturer's instructions. Before qRT-PCR, the cDNA was verified with the β-actin gene. qRT-PCR was done with Thermal Cycler (CFX96; Bio-Rad, USA). The 25 μL reaction mixture contained the SYBR green master mix (12.5 μL), forward and reverse primer (1 μL of 10 μM), cDNA (2 μL) and double-distilled water (9.5 μL). Two housekeeping genes, β-actin gene and GAPDH gene (He et al., 2012; Lu et al., 2013; Meng et al., 2013), which showed stable expression under the given experimental conditions for the qRTPCR, were used for normalizing the target gene expression and correcting for sample-to-sample variation. The relative expression level was calculated using the 2−ΔΔCT method, where ΔΔCT is the difference between: (CTtarget gene − CTinternal control) from initial stage or tissue or time (2nd or head or time zero) and (CTtarget gene − CTinternal control)

51

from the other stages or tissues or time, following a comparative Ct (ΔΔCt) method (Livak and Schimittgen, 2001). Each treatment was done independently in triplicate. The primers used for qRT-PCR are given in Table 1.

2.7. RNA interference One pair of gene specific primers (S14-3-3Tf/S14-3-3Tr) was designed to synthesize the 419 bp region of SpL14-3-3ζ including a T7 promoter region in both sense and antisense strands. Specific doublestranded RNA (dsRNA) of SpL14-3-3ζ (SpL14-3-3ζ-dsRNA) was prepared using the Mega script RNAi Kit according to the manufacturer's recommendations (Ambion, Austin, TX, USA). The quantity of SpL14-33ζ-dsRNA was determined by spectrophotometry at 260 nm and by agarose gel analysis. dsRNA of green fluorescence protein (GFP) was used as a negative control. The final dsRNA was dissolved in DEPCtreated water, stored at –80 °C and used within a week. The primers used for dsRNA synthesis are given in Table 1.

Fig. 1. Characterization of SpL14-3-3ζ gene. (A) Nucleotide and deduced amino acid sequence of S. litura 14-3-3ζ. The start codon (ATG) was shown in black frame and * as termination codon (TAA). (B) S. litura SpL14-3-3ζ genome structure. Black and gray boxes were used to highlight exons and introns, separately; the number of bases in each box was shown the size of exon and the number of bases below each box was shown the size of intron. (C) A phylogenetic tree generated by the neighbor-joining distance method with 14-3-3ζ from Heliothis virescens (ACR07788.1), Heliothis armigera (ACS12990.1), Bombyx mori (NP_001040164.1), Papilio xuthus (BAM17746.1), Artemia franciscana (ADB03180.1), Bombus terrestris (AEW70333. 1), Megachile rotundata (AEW70348.1), Drosophila melanogaster (NP_724885.1), Acromyrmex echinatior (AEW70342.1), Camponotus floridanus (AEW70331.1), Fenneropenaeus merguiensis (ADI87601.1), Scylla paramamosain (AFD33362.1), Bursaphelenchus xylophilus (ACZ13351.1), Danio rerio (AAH86710.1), Homo sapiens (AAH73141.1), Mus musculus (BAA11751.1), Xenopus laevis (NP_001080117.1), Xenopus tropicalis (NP_989173.1), Chlamydomonas reinhardti (XP_001702812.1), Saccharomyces cerevisiae (CAA46959.1), Schizosaccharomyces pombe (CAB16570.1), Brassica napus (ACN73532.1), Arabidopsis thaliana (NP_849698.1), Gossypium raimondii (ADY68781.1), Solanum lycopersicum (CAA65150.1), Nicotiana tabacum (BAD10938.1). The numbers at each branch represented as percentage of bootstrap values in 1000 sampling replicates (Mega 4.1, Bootstraps = 1000).

52

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

To test RNAi efficiency and observe phenotype, larvae (n = 60) that had just molted into the 6th instar were injected with 5 μg SpL14-3-3ζdsRNA from the intersegment of the second abdominal segment using a 10 μL microsyringe (Hamilton), and 5 μg GFP-dsRNA injected as a control. Fat body, midgut and hemocytes were collected from 10 individual larvae after dsRNA injection at first day and second day, respectively, and used to calculate the tissue-specific efficiency after RNAi. The remaining animals were reared as described above for phenotype observation after treatment for 24 h. All assays were done three times. The same stages of larvae were injected with 5 μg SpL14-3-3ζdsRNA, and then after 6 h, 5 μL N. rileyi conidia suspension were injected as above to do the survival assay experiment, this group named as DsSpL14-3-3ζ-infected. Meanwhile, as controls, another four groups were treated as follows: (1) GFP-dsRNA and N. rileyi conidia suspension (DsGFP-infected); (2) DEPC-treated water and N. rileyi conidia suspension (DEPC-infected); (3) PBS without N. rileyi conidia suspension (PBSinjected); (4) inoculated with N. rileyi conidia suspension only (Infected). Each group had 60 individuals in each of three replicates. After injection, all treated groups were cultured as described above for survival assay. All assays were done three times. 2.8. Statistical analysis The quantitative data are presented as mean ± S.E.M. for each experiment. The relative expression level of the SpL14-3-3ζ gene was analyzed by SPSS using one-way analysis of variance (ANOVA) followed by Duncan's Multiple Range test using the SPSS 17 program. 3. Results 3.1. Gene cloning and sequence analysis of SpL14-3-3ζ We obtained the full-length cDNA sequence of S. litura 14-3-3ζ (GenBank accession number KF640688) by RT-PCR and SMART™ RACE and named it SpL14-3-3ζ. The full length of SpL14-3-3ζ cDNA was 1196 bp, including a 123 bp 5′ untranslated region (UTR), a 744 bp ORF encoding 247 amino acid residues and a 329 bp 3′ UTR with a poly A site (AAAAAA) (Fig. 1A). Comparing SpL14-3-3ζ cDNA with its genomic DNA sequence, we obtained the characteristic SpL143-3ζ gene with four exons interrupted by three introns (Fig. 1B). The predicted molecular mass was 28.0 kDa and a predicted isoelectric point of 4.6, without signal peptide or the transmembrane domain. 3.2. Alignments of SpL14-3-3ζ proteins

3.4. Temporal and spatial expression patterns of SpL14-3-3ζ The expression profiles of SpL14-3-3ζ gene analysis showed SpL143-3ζ was expressed during the whole developmental stages in S. litura, with the highest level of expression in pre-pupa, which was 22.8-fold greater compared to 2nd instar larvae, and the lowest level of expression occurred in 5th instar larvae (Fig. 2). Moreover, SpL14-3-3ζ was expressed constitutively in all examined 6th instar larvae tissues/organs including head, cuticle, fat body, midgut, malpighian tube, hemocytes. In normal tissues, high levels appeared in hemocytes and midgut, which were N22.4- and 6.2-fold greater compared to in head, respectively, whereas levels of expression in cuticle and Malpighian tube were relatively low (Fig. 3A). However, after challenged with N. rileyi for 24 h, the expression of SpL14-3-3ζ can be induced in certain tissue. Compared to each normal tissue, the expression levels of SpL14-3-3ζ were enhanced in hemocytes, head, fat body and midgut by 6.5-, 3.7-, 2.0- and 2.8-fold (Fig. 3B). During the time course studied, after the challenge with N. rileyi, the expression level of SpL14-3-3ζ in hemocytes was increased and peaked at 12 h post-infection and then declined gradually. In fat body, the trend of SpL14-3-3ζ expression was nearly the same with hemocytes, but reached only half level of expression compared to hemocytes at 12 h time point (Fig. 4A–B). By contrast, the expression of SpL14-3-3ζ in midgut was increased to a peak at 6 h, and later decreased to the original level (Fig. 4C). 3.5. RNA interference and survival assay After injecting dsRNA into the hemocele of 6th instar larvae at first day and second day, the expression of SpL14-3-3ζ in hemocytes, fat body and midgut were detected by qRT-PCR. The results indicated that SpL14-3-3ζ-dsRNA efficiently reduced levels of SpL14-3-3ζ transcripts, and different tissues showed different levels of interference efficiency. The fat body exhibited the most efficient interference when tested in first day of dsRNA injection, then in midgut, whereas in hemocytes, a significantly efficient interference was detected in second day after injection with dsRNA (Fig. 5A–C). After RNAi, the mortality rates of SpL14-3-3ζ-dsRNA injected group and GFP-dsRNA injected group were both 0%, and 100% of larvae could molt and enter into pupate. Whereas comparing with GFP-dsRNA injected control group, in SpL143-3ζ-dsRNA injected group, 55 ± 2% pupa could not emerge to adult and 35 ± 3% pupa emerged into malformed adults (Fig. 6). These data suggest that SpL14-3-3ζ participates in signal regulation of larval development.

A multiple sequence alignment of the predicted protein sequence of SpL14-3-3ζ with recorded 14-3-3ζ using BlastP showed 14-3-3ζ was extremely conservative. SpL14-3-3ζ had a N80% sequence homology with other organisms, and up to 95% homology with lepidopteran insects, such as H. virescens 14-3-3ζ and B. mori 14-3-3ζ. The five highly conserved regions and nine anti-parallel α-helixes reported by Wang and Shakes (1996) were found also. In SpL14-3-3ζ, R20 (helix 2), S60 (helix 3), Y84 and E91 (helix 4) were involved in dimerization, K51 (helix 3), R129 and Y130 (helix 5) were closely related to combine with the 14-3-3 protein ligands (Supplemental Data 1). 3.3. Phylogenetic analysis of SpL14-3-3ζ Twenty-six 14-3-3ζ recorded in GenBank, which came from arthropoda, nemathelminthes, chordata, fungi and plants were selected for phylogenetic analysis with SpL14-3-3ζ by the neighbor-joining distance method, using ClustalW and MEGA version 4.1. As shown in Fig. 1C, the 14-3-3ζ in different organisms was considerably conserved. SpL14-3-3ζ had the closest genetic relationship with Lepidoptera insects, such as H. virescens 14-3-3ζ, B. mori 14-3-3ζ and H. armigera 14-3-3ζ, whereas it was far away from fungi and plants.

Fig. 2. Expression profile analysis of SpL14-3-3ζ during different development stages of S. litura. The relative expression levels of SpL14-3-3ζ at different stages were presented by threshold cycle (Ct) values and normalized with the expression of the housekeeping genes β-actin and GAPDH run on the same plate. In each assay, the expression level was shown relative to the 2nd expression level, which was arbitrarily set to one. All samples were tested in triplicate. The mean ± SEM. was used for analysis of relative transcript levels for each stage using the 2−ΔΔCt method. * and ** indicated statistical significance at P b 0.05 and P b 0.01, respectively.

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

53

Fig. 3. Spatial expression patterns of SpL14-3-3ζ in S. litura. (A) qRT-PCR analysis of the SpL14-3-3ζ expression levels in different normal tissues. (B) qRT-PCR analysis of the SpL14-3-3ζ relative induction expression levels in S. litura after N. rileyi-challenged for 24 h in all tested tissues compared with each normal control tissue. Each value was given as the mean ± SEM. of three replicates. * and ** indicated statistical significance at P b 0.05 and P b 0.01, respectively.

The role of SpL14-3-3ζ in resistance against fungal pathogen was investigated by RNAi-mediated SpL14-3-3ζ silencing in S. litura 6th instar larvae inoculated with N. rileyi. After injected with conidia suspension, the mortality rates of DsSpL14-3-3ζ-infected group at day 2, 3, 4, 5, 6, 7 were significantly different from that of DsGFP-infected control group, and reached 80% at 5 days post-infection after SpL14-3-3ζ was knocked down (Fig. 5D). LT50 (time required to reach 50% mortality) of DEPC-infected, DsGFP-infected and fungus-infected group were 4.6, 4.6 and 4.7 days, which were significantly higher than in DsSpL14-33ζ-infected mutants (3.9 days) (P b 0.01) (Fig. 5E). These data suggest

that SpL14-3-3ζ may be involved in signal regulation of resistance against N. rileyi infection. 4. Discussion The 14-3-3 acid proteins are reported to involve in a variety of biological functions. In this study, we cloned a 14-3-3ζ from S. litura (SpL14-3-3ζ), which showed a high level of identity compared to known insects. Larval developmental stage expression pattern analysis demonstrated SpL14-3-3ζ expressed during all developmental phases

Fig. 4. Time course expression patterns of SpL14-3-3ζ in S. litura after infection with N. rileyi in three indicated tissues. (A) Hemocytes; (B) Fat body; (C) Midgut. The relative expression levels of SpL14-3-3ζ at different time points were presented by threshold cycle (Ct) values and normalized with the expression of the housekeeping genes β-actin and GAPDH run on the same plate. In each assay, the expression level was shown relative to the expression level of 0 h, which was arbitrarily set to one. All samples were tested in triplicate. The mean ± SEM. was used for analysis of relative transcript levels for each time point using the 2−ΔΔCt method. * and ** indicated statistical significance at P b 0.05 and P b 0.01, respectively.

54

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

Fig. 5. Effects of dsRNA interference on transcript levels of SpL14-3-3ζ in S. litura 6th larvae, and the results of bioassay. Larvae were injected with GFP dsRNA as negative control. (A) Transcript levels of SpL14-3-3ζ in hemocytes two days after injection with dsRNA. (B) Transcript levels of SpL14-3-3ζ in fat body one day after injection with dsRNA. (C) Transcript levels of SpL14-3-3ζ in midgut one day after injection with dsRNA. (D) Survival rate of S. litura larvae after SpL14-3-3ζ interfered by RNAi. (E) LT50 in different treatments. Values shown were the mean ± SEM. of three experiments. * and ** indicated statistical significance at P b 0.05 and P b 0.01, respectively.

in S. litura and high levels of expression occurred at pre-pupa and adult stages. Likewise, Bm14-3-3ζ and Ansi14-3-3ζ maintained high levels of expression at the late stages of larva, pupa and adult (Kong et al., 2007; Hiroko et al., 2008; Yong et al., 2009). By interfering SpL14-3-3ζ gene, some pupa could not emerge or emerged into malformed adult, suggesting the transcription of SpL14-3-3ζ might be universal and SpL14-3-3ζ may be related to larval developmental signal regulation. A high level of SpL14-3-3ζ expression was detected in hemocytes in normal tissues. After injection with N. rileyi conidia suspension for 24 h,

the relatively higher inducing expression levels appeared in hemocytes, fat body and midgut, indicating that the expression of SpL14-3-3ζ can be induced by fungal infection and the gene has a vital role in S. litura defense. Similar results showed in other organisms that 14-3-3 s involved in host defense and stress responses. In rice, four 14-3-3 s can be regulated differentially by rice-Magnaporthe grisea and rice-Xanthomonas oryzae pv. oryzae (Chen et al., 2006), and in maize, the level of expression of the ZmGF14-6 gene increased in response to fungal infection (Sonia et al., 2012). In other invertebrates, such as Heliothis virescens

Fig. 6. The phenotypic changes of S. litura after SpL14-3-3ζ knocked down by RNAi. A: normal pupa in the negative control group. Larvae were injected with GFP dsRNA; B–C: pupa in the experimental group. Larvae were injected with SpL14-3-3ζ-dsRNA, showing pupa could not emerge to adult; D: normal adult in the negative control group. Larvae were injected with GFP dsRNA; E–F: adults in the experimental group. Larvae were injected with SpL14-3-3ζ-dsRNA, showing pupa has emerged into a malformed adult.

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

and Penaeus vannamei, 14-3-3ζ can be induced from immune-stimulated hemocytes (Chongsatja et al., 2007; Shelby and Holly, 2009), also in mosquito heads in response to malaria parasite Plasmodium berghei infection (Thierry et al., 2007). In vertebrates, 14-3-3 could be upregulated in lung cancer, and has been suggested as a potential biomarker (Fan et al., 2007). After SpL14-3-3ζ expression was interfered, S. litura larvae were more sensitive to N. rileyi infection, and compared with control groups, LT50 value shortened, further proving that the expression of SpL14-3-3ζ was essential to host defense. The spatial expression pattern of SpL14-3-3ζ infected by N. rileyi, showed the relatively higher inducing expression occurred in hemocytes, fat body and midgut, and these three tissues are regarded as vital organs involved in insect immune response (Jules, 1995; Hong et al., 2007; Tsakas and Marmaras, 2010; He et al., 2012). For this reason, they were chosen to analyze SpL14-3-3ζ time course expression patterns, and the results showed SpL14-3-3ζ exhibited different expression trends in these tissues. In hemocytes and fat body, the level of SpL14-33ζ expression appeared maximal induction at 12 h after infection in both cases, at this time point, by contrast, hemocytes showed nearly 2-fold expression level compared with fat body, and midgut showed the lowest expression level. These results might be closely related with hemocytes firstly response to foreign particles. Nevertheless, with spore rapid propagation, SpL14-3-3ζ mRNA levels started to reduce dramatically at 48 h post infection in tested tissues, which might be a result from weakening insect immune response. In this study, we found that SpL14-3-3ζ could be induced by H2O2 in hemocytes, fat body and midgut, and SpL14-3-3ζ expression levels in all tissues reaching a peak at 1 h after infection (Supplemental Data 2), it might indicate that S. litura has a wide range of defense mechanisms against pathogen invasion. When invaded by pathogens, insects can trigger some signal pathway through rapid and intense accumulation of reactive oxygen species, mainly superoxide anion (O2 −) and hydrogen peroxide (H2O2), to induce the expression of immune proteins. This phenomenon has been proved in other organisms also (Chen et al., 2006; Elmayan et al., 2007). In conclusion, SpL14-3-3ζ shared high level of conservation with other 14-3-3ζ homologues and was expressed continuously but unevenly during the larval developmental stages and in different tissues tested. The expression can be induced by N. rileyi infection and higher levels of expression appeared in the tissues involved in insect immunity. After interference, the larvae showed a higher mortality and lower LT50 when infected by N. rileyi. All these data suggested SpL14-3-3ζ has important roles in anti-entomopathogenic fungal infection and larval development. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbpb.2014.04.003.

Acknowledgments This work was funded and sponsored by “Special Fund for Agroscientific Research in the Public Interest” (201103002) and the National High Technology Research and Development Program 863 of China (2011AA10A201).

References Ahmad, M., Iqbal, A.M., Ahmad, M., 2007. Occurrence of insecticide resistance in field populations of Spodoptera litura (Lepidoptera: Noctuidae) in Pakistan. Crop. Prot. 26, 809–817. Alastair, A., 2006. 14-3-3 proteins: a historic overview. Semin. Cancer Biol. 16, 162–172. Alexander, R.D., Morris, P.C., 2006. A proteomic analysis of 14-3-3 binding proteins from developing barley grains. Proteomics 6, 1886–1896. Alyson, K.F., Deborah, K.M., 2011. 14-3-3 proteins: diverse functions in cell proliferation and cancer progression. Semin. Cell Dev. Biol. 22, 681–687. Bao, Y.Y., Tang, X.D., Lv, Z.Y., et al., 2009. Gene expression profiling of resistant and susceptible Bombyx moristrains reveals nucleopolyhedrovirus-associated variations in host gene transcript levels. Genomics. 94, 138–145.

55

Baxter, H.C., Liu, W.G., Forster, J.L., Aitken, A., Fraser, J.R., 2002. Immunolocalisation of 14-3-3 isoforms in normal and scrapie-infected murine brain. Neuroscience 109 (1), 5–14. Chen, F., Li, Q., Sun, L.X., He, Z.H., 2006. The rice 14-3-3 gene family and its involvement in responses to biotic and abiotic stress. DNA Res. 13, 53–63. Chen, H., Yin, Y., Li, Y., Mahmud, M.S., Wang, Z., 2012. Identification and analysis of genes differentially expressed in the Spodoptera litura fat body in response to the biocontrol fungus, Nomuraea rileyi. Comp. Biochem. Physiol. B 163, 203–210. Chongsatja, P., Bourchookarn, A., Lo, Chu Fang, Thongboonkerd, V., Krittanai, C., 2007. Proteomic analysis of differentially expressed proteins in Penaeus vannamei hemocytes upon Taura syndrome virus infection. Proteomics 7, 3592–3601. David, H.J., Steven, L., Alastair, A., 1995. Isoforms of 14-3-3 protein can form homo- and heterodimers in vivo and in vitro: implications for function as adapter proteins. FEBS Lett. 368, 55–58. Elmayan, T., Fromentin, J., Riondetr, C., Alcaraz, G., Jean-Pierre, Blein, Simon-Plas, Francoise, 2007. Regulation of reactive oxygen species production by a 14-3-3 protein in elicited tobacco cells. Plant Cell Environ. 30, 722–732. Fan, T., Li, R.Y., Todd, N.W., Qiu, Q., Fang, B., Wang, H.J., Shen, J.J., Richard, Y.Z., Nancy, P.C., Ruth, L.K., Sanford, A.S., Jiang, F., 2007. Up-regulated of 14-3-3ζ in lung cancer and its implication as prognostic and therapeutic target. Cancer Res. 67 (16), 7901–7906. Fu, H., Romesh, R.S., Shane, C.M., 2000. 14-3-3 PROTEINS: structure, function, and regulation. Annu. Rev. Pharmacol. Toxicol. 40, 617–647. Gavin, W.P., Fadlo, R.K., Fu, H., 2006. Dynamic 14-3-3/client protein interactions integrate survival and apoptotic pathways. Semin. Cancer Biol. 16, 193–202. He, W.Y., Rao, Z.C., Zhou, D.H., 2012. Analysis of expressed sequence tags and characterization of a novel gene, Slmg7, in the midgut of the common cutworm, Spodoptera litura. PLoS ONE 7 (3), e33621. Hemert, M.J., Steensma, H.Y., Heusden, G.P.H., 2001. 14-3-3 proteins: key regulators of cell division, signalling and apoptosis. BioEssays 23, 936–946. Heusden, G.P.H., Steensma, H.Y., 2006. Yeast 14-3-3 proteins. Yeast 23, 159–171. Heusden, G.P.H.V., Dominic, J.F.G., Jon, C.F., Thomas, F.C.C., Peter, A.T.S., Anthony, M.C., de S, H.Y., 1995. The 14-3-3 proteins encoded by the BMHl and BMH2 genes are essential in the yeast Saccharomyces cerevisiae and can be replaced by a plant homologue. Eur. J. Biochem. 229, 45–53. Hiroko, T., Toru, S., Yutaka, B., Ryoichi, S., Hideyuki, K., Kazuei, M., Jun-ichi, S., 2008. Identification of Bombyx mori 14-3-3 orthologs and the interactor Hsp60. Neurosci. Res. 61, 271–280. Hong, M.L., Chen, L.Q., Sun, X.J., 2007. Metabolic and immune responses in Chinese mitten-handed crab (Eriocheir sinensis) juveniles exposed to elevated ambient ammonia. Comp. Biochem. Physiol. C 145, 363–369. Johanna, U., Leena-Maija, V., Anni, K., Mari, V.-M., Milka, V., Sinikka, E., Dan, H., Christine, K., Mikko, H., Mataleena, P., Mika, R., 2011. Cofilin regulator 14-3-3 is an evolutionarily conserved protein required for phagocytosis and microbial resistance. J. Leukocyte Biol. 89, 649–659. Jules, A.H., 1995. Innate immunity of insects. Curr. Opin. Immunol. 7, 4–10. Kong, L.Y., Lv, Z.B., Chen, J., Nie, Z.M., Wang, D., Shen, H.D., Wang, X.D., Wu, X.F., Zhang, Y.Z. , 2007. Expression analysis and tissue distribution of two 14-3-3 proteins in silkworm (Bombyx mori). Biochim. Biophys. Acta 1770, 1598–1604. Kranthi, K.R., Jadhav, D.R., Kranthi, S., Wanjari, R.R., Ali, S.S., Russell, D.A., 2002. Insecticide resistance in five major insect pests of cotton in India. Crop. Prot. 21, 449–460. Liou, J.Y., Lee, S., Ghelani, D., Nevenka, M.A., Kenneth, K.W., 2006. Protection of endothelial survival by peroxisome proliferator-activated receptor-δ mediated 14-3-3 upregulation. Arterioscler. Thromb. Vasc. Biol. 26, 1481–1487. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(− Delta Delta C (T)) method. Methods 25 (4), 402–408. Lu, Y., Yuan, M., Gao, X., Kang, T., Zhan, S., et al., 2013. Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae). PLoS ONE 8 (7), e68059. http://dx.doi.org/10.1371/journal. pone.0068059. Macha, M.A., Ajay, M., Chauhan, S.S., Michael, K.W.S., Ranju, R., 2010. 14-3-3 zeta is a molecular target in guggulsterone induced apoptosis in head and neck cancer cells. BMC Cancer 10, 655. Meng, X., Hu, J.J., Xu, X.X., Wang, Z.Q., Hu, Q.B., Jin, F.L., Ren, S.X., 2013. Toxic effect of destruxin A on abnormal wing disc-like (SLAWD) in Spodoptera litura Fabricius (Lepidoptera:Noctuidae). PLoS One 8 (2), e57213. Messaritou, G., Leptourgidou, F., Franco, M., Skoulakis, E.M.C., 2009. A third functional isoform enriched in mushroom body neurons is encoded by the Drosophila 14-3-3 ζ gene. FEBS Lett. 583, 2934–2938. Michael, R.R., Julio, S., David, B.C., 2002. 14-3-3 proteins and the response to abiotic and biotic stress. Plant Mol. Biol. 1031, 1031–1039. Moore, B.W., Perez, V.J., 1967. Specific acidic proteins of the nervous system. In: Carlson, F. D. (Ed.), Physiological and biochemical aspects of nervous integration. Prentice-Hall, Englewood Cliffs, NJ, pp. 343–359. Nunes, C.P., Arnaldo, Z., Bruno, G., Norbert, M., Marı'a del, M.S.L., 2004. 14-3-3 gene characterization and description of a second 14-3-3 isoform in both Echinococcus granulosus and E. multilocularis. Parasitol. Res. 93, 403–409. Pan, L.J., Li, Z.F., Gong, Y.X., Yu, M., Yang, K., Pang, Y., 2005. Characterization of gp41gene of Spodoptera litura multicapsid nucleopolyhedrovirus. Virus Res. 110, 73–79. Rosenquist, M., 2003. 14-3-3 proteins in apoptosis. Braz. J. Med. Biol. Res. 36, 403–408. Rosenquist, M., Alsterfjord, M., Larsson, C., Sommarin, M., 2001. Data mining the Arabidopsis genome reveals fifteen 14-3-3 genes. Expression is demonstrated for two out of five novel genes. Plant Physiol. 127, 142–149. Sandhu, S.S., Anil, K.S., Beniwal, V., Goel, G.J., Batra, P., Anil, K., Jaglan, S., Sharma, A.K., Sonal, M., 2012. Myco-biocontrol of insect pests: factors involved, mechanism, and regulation. J. Pathog. 10, xx.

56

E. Feng et al. / Comparative Biochemistry and Physiology, Part B 172–173 (2014) 49–56

Shandala, T., Joanna, M.W., Ng, Yeap, Biggs, Lisa, Efthimios, M.C.S., Brooks, Doug A., Lopez, Angel F., et al., 2011. Drosophila 14-3-3ε has a crucial role in anti-microbial peptide secretion and innate immunity. J. Cell Sci. 123 (13), 2165–2174. Shelby, K.S., Holly, J.R.P., 2009. Analysis of ESTs generated from immune-stimulated hemocytes of larval Heliothis virescens. J. Invertebr. Pathol. 101, 86–95. Sluchanko, N.N., Natalya, V.A., Maria, V.S., 2012. Monomeric 14-3-3 ζ has a chaperone-like activity and is stabilized by phosphorylated HspB6. Biochemistry 51, 6127–6138. Sonia, C., Peris-Peris, Cristina, Laura, M., 2012. Expression of the maize ZmGF14-6 gene in rice confers tolerance to drought stress while enhancing susceptibility to pathogen infection. J. Exp. Bot. 63 (2), 983–999. Srisukchayakul, P., Chanpen, W., Somsak, P., 2005. Studies on the pathogenesis of the local isolates of Nomuraea rileyi against Spodoptera litura. ScienceAsia 31, 273–276. Suwannakut, S., Drion, G.B., Chanpen, W., 2005. Genotypic analysis of Nomuraea rileyi collected from various noctuid hosts. J. Invertebr. Pathol. 90, 169–176. Thierry, L., Frédéric, T., Alex, S., Elena, L., Stéphanie, B., Brizard, J.P., Bourligu, L.L., Edith, D., Renaud, F., David, G.B., 2007. Malaria Plasmodium agent induces alteration in the head proteome of their Anopheles mosquito host. Proteomics 7, 1908–1915.

Tsakas, S., Marmaras, V.J., 2010. Insect immunity and its signalling: an overview. Invertebr. Surviv. J. 7, 228–238. Voigt, J., Liebich, I., Johannes, W., Adam, K.H., Marquardt, O., 2000. Nucleotide sequence, genomic organization and cell-cycle-dependent expression of a Chlamydomonas 143-3 gene. Biochim. Biophys. Acta 1492, 395–405. Wang, W., Shakes, D.C., 1996. Molecular evolution of the 14–3–3 protein family. J. Mol. Evol. 43 (4), 384–398. Xing, H.M., Zhang, S.S., Weinheimer, C., Kovacs, A., Anthony, J.M., 2000. 14-3-3 proteins block apoptosis and differentially regulate MAPK cascades. EMBO J. 19 (3), 349–358. Yano, M., Nakamuta, S., Wu, X.J., Yuushi, O., Hiroshi, K., 2006. A novel function of 14-3-3 protein: 14-3-3 Is a heat-shock–related molecular chaperone that dissolves thermal-aggregated proteins. Mol. Biol. Cell 17, 4769–4779. Yong, H.J., Mi, Y.N., Se, W.K., 2009. Molecular cloning and expression pattern of 14-3-3ζ from the malaria vector, Anopheles sinensis. Entomol. Res. 39, 123–128.