- Email: [email protected]
Gene Conversion between Red and Defective Green Opsin Gene in Blue Cone Monochromacy
GENOMICS
29, 323–328 (1995)
Gene Conversion between Red and Defective Green Opsin Gene in Blue Cone Monochromacy EDWIN REYNIERS,* MARIE-NOE¨LLE VAN THIENEN,* FRANC¸OISE MEIRE,† KRISTEL DE BOULLE,* KRISTINE DEVRIES,* PHILIP KESTELIJN,† AND PATRICK J. WILLEMS*,1 *Department of Medical Genetics, University of Antwerp, Antwerp, Belgium; and †Department of Ophthalmology, University of Ghent, Ghent, Belgium Received March 20, 1995; accepted June 23, 1995
Blue cone monochromacy is an X-linked condition in which the function of both the red pigment gene (RCP) and the green pigment gene (GCP) is impaired. Blue cone monochromacy can be due to a red/green gene array rearrangement existing of a single red/ green hybrid gene and an inactivating C203R point mutation in GCP. We describe here a family with blue cone monochromacy due to the presence of the C203R mutation in both RCP and GCP. The flanking sequences of the C203R mutation in exon 4 of RCP were characteristic for GCP, indicating that this mutation was transferred from GCP into RCP by gene conversion. q 1995 Academic Press, Inc.
INTRODUCTION
Three classes of cone photoreceptors are involved in normal color vision. A blue cone opsin is encoded by a gene on chromosome 7, and red and green cone opsin genes are located on the X chromosome in Xq28. Individuals with normal color vision have one red opsin gene (RCP) followed downstream by one or more green opsin genes (GCP) in head to tail tandem array. The RCP and GCP genes are highly homologous, thereby predisposing them to unequal inter- and intragenic homologous recombinations (Nathans et al., 1986a). Common types of color blindness such as dichromacy (loss of red or green opsin) or anomalous trichromacy (a shift in the spectrum of red or green opsin) arise from such inter- and intragenic recombinations between RCP and GCP leading to red–green hybrid genes (Nathans et al., 1986b; Vollrath et al., 1988; Deeb et al., 1992). In this case only one of the red or green pigment genes remains intact, leading to absence or anomalous function of red or green opsin. Patients with blue cone monochromacy, an infrequent X-linked condition, have no functional RCP or 1 To whom correspondence should be addressed at the Department of Medical Genetics, University of Antwerp, 2610 Antwerp, Belgium. Telephone: (32)3-820.25.70. Fax: (32)3-820.25.66.
GCP and only a single cone system (Blackwell and Blackwell, 1961; Alpern, 1974; Pokorny et al., 1979; Hess et al., 1989). This leads to impaired discrimination of colors, photophobia, low acuity, nystagmus, and in some cases progressive retinal degeneration. Genetic heterogeneity has been described among blue cone monochromats by Nathans et al. (1993). Blue cone monochromacy can be associated with deletions of a control region upstream of the red opsin gene. All of these deletions have a 579-bp overlap region located 3–4 kb upstream of the transcription start of RCP. This deletion results in loss of expression of both RCP and GCP (Nathans et al., 1989). Blue cone monochromacy can also be due to missense point mutations in RCP or GCP that lead to amino acid changes inactivating the red and green opsins. A common mutation is a thymine to cytosine substitution at nucleotide position 648 of GCP (Winderickx et al., 1992). This mutation disrupts a highly conserved disulfide bridge, as the essential cysteine at amino acid position 203 is replaced by an arginine (C203R). Two other inactivating point mutations have been reported: A247T in RCP and P307L in a RCP/GCP hybrid gene (Nathans et al., 1993). In this class of blue cone monochromacy the RCP/GCP array has usually been reduced to a single repeat unit by unequal homologous recombination, the single repeat unit containing an inactivating point mutation. This paper describes a third kind of mutation leading to blue cone monochromacy, e.g., the presence of the C203R mutation in both RCP and GCP. The C203R mutation in exon 4 of RCP was found to be flanked by GCP-specific sequences. These findings make it likely that a gene conversion event has taken place between the RCP and the GCP gene, leading to the presence of the C203R point mutation and flanking GCP-specific sequences in RCP. MATERIALS AND METHODS Patients. This family has already been described by Franc¸ois et al. (1966) (Fig. 1). All affected men (with the exception of IV11) and all obligate carriers were ophthalmologically examined. The clinical
323
/ m3709$3604
08-24-95 11:39:09
gnma
0888-7543/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Genomics
324
REYNIERS ET AL.
FIG. 1. Pedigree of the family with blue cone monochromacy and haplotypes of the markers DXS52, RCP/GCP, G6PD, and F8. The disease segregates with the haplotype 2-2-1-2. characteristics of the affected men consist of reduced visual acuity (0.1–0.3), myopia, and color blindness. In half of the patients myopia was more than six diopters. The patients showed total red and green color defectiveness, but they could distinguish figures on Berson plates. Funduscopy in two older affected men (53 and 58 years, respectively) revealed atrophy of the retinal pigment epithelium and choriocapillaris in the macular region. No photopic response could be found with standard electroretinography (ERG) in all affected patients. The obligate carriers had normal visual acuity and showed discrete abnormalities on color vision testing. DNA was isolated from seven male patients, four female obligate carriers, one unaffected male, and one unaffected relative from this blue cone monochromacy family (Fig. 1). Linkage analysis. DNA markers DXS52 (F814), RCP/GCP (CA repeat), G6PD, and F8 (CA repeat) on Xq28 were used to perform linkage analysis between the disorder and the RCP/GCP locus. Twopoint lod scores were calculated using the MLINK program of the LINKAGE 5.1 package. To exclude a gene locus for progressive cone dystrophy on the short arm of the X chromosome (Bartley et al., 1989; Bergen et al., 1993), we also performed linkage analysis with DNA markers MAOA (CA repeat), DXS7 (CA repeat), DXS426 (CA repeat), and DXS255 (M27b) located in Xp11.2–p11.4. Southern blot analysis. Southern blot analysis of DNA extracted from peripheral blood was performed according to standard procedures. To study gross DNA rearrangements in RCP and GCP, the entire red pigment cDNA clone hs7, a 300-bp EcoRI/BamHI fragment of hs7, and a 900-bp EcoRI/BamHI fragment of hs7 were used on EcoRI digests, EcoRI/BamHI double digests, and RsaI digests, as previously described by Nathans et al. (1986a). Southern blot analysis of the 5* regulatory region located 3–4 kb upstream of RCP was performed with an 800-bp HindIII/BamHI fragment of clone gJHN60 (Nathans et al., 1989) on a HindIII digest. gJHN60 is a genomic clone containing part of the RCP gene and the 8.6-kb region upstream of the RCP start codon.
/ m3709$3604
08-24-95 11:39:09
gnma
PCR analysis. The upstream promotor of RCP and GCP was studied using primer L1 (5*GGAATTCCCTTTCTTGGGCCGCCACTCGC3*) and primer L2 (5*GGAATTCCCCAGCCTTGTCCCATTACCG3*). Primer L1 is located 54 bp upstream of the 579-bp deletion overlap region (Nathans et al., 1989). Primer L2 is located 36 bp downstream of this region. Exons 2, 3, 4, and 5 of RCP were further studied using gene-specific primers as described by Winderickx et al. (1993). Primers E2CR, E4DR, E5CR, and E5DR are RCP-specific primers. Primer E4DG is a GCP-specific primer. Primers E3B, E3D, E4A, and E5A attach to both RCP and GCP templates. PCR products were separated on 1.5% agarose gel, extracted from the agarose gel by centrifugation, and purified using Wizard DNA preps (Promega). PCR products were directly sequenced on an ABI 373A automated sequencer using cycle sequencing reaction with dye terminators.
RESULTS
Linkage and Southern Blot Analysis Linkage analysis suggested linkage with the markers on Xq28 with a maximal lod score of 1.95 at u Å 0 with marker DXS52. Patients and controls showed identical patterns on the Southern blots with all of the RCP/GCP probes used. The ratio of intensities between the fragments derived from the RCP and GCP genes, suggested that the RCP gene is followed downstream by one single GCP (data not shown). Analysis of the Upstream Promotor of RCP/GCP In the majority of blue cone monochromacy patients RCP and GCP are inactivated by deletion of an up-
AP-Genomics
325
GENE CONVERSION IN BLUE CONE MONOCHROMACY
Mutation Analysis of GCP
FIG. 2. Identification of the C203R mutation in exon 4 of GCP. PCR products obtained with a GCP-specific primer set E4A–E4DR were digested with BstUI and electrophoresed on a 3% agarose gel. Substitution of cytosine for a thymine at nucleotide position 648 creates a novel BstUI site. The controls (C1, C2) lack the BstUI site and show only the wildtype allele of 138 bp. Patients (P1, P2) carrying the C203R mutation have the 110- and the 28-bp fragment, and obligate female carriers (H1, H2) show both the wildtype fragment and the mutant fragment.
stream promotor 3–4 kb upstream of RCP. To detect a deletion in the upstream promotor of RCP and GCP, DNA from patients of our family was digested with HindIII and probed with an 800-bp HindIII–BamHI fragment of gJHN60. This probe is a genomic sequence located between 9.0 and 8.2 kb upstream of the RCP gene. Southern blot analysis revealed the normal 7.2kb fragment. To detect small deletions the upstream promotor was amplified by PCR using primers L1 and L2, which are located 5* and 3* of the 579-bp overlap region between the different deletions found in the upstream promotor of blue cone monochromacy patients (Nathans et al., 1989). PCR analysis with these primers showed only PCR fragments of the normal length of 680 bp. These findings make it likely that our patients have intact upstream promotors.
The most common inactivating mutation in blue cone monochromacy is a C203R point mutation at position 648 in exon 4 of GCP. This mutation creates a novel BstUI site. The male patients were tested for the presence of this mutation with a GCP-specific primer set (E4A–E4DG) (Fig. 3). The normal PCR product is 138 bp, whereas the PCR products of the patients were cleaved into fragments of 110 and 28 bp by the novel BstUI site. The C203R mutation was present in the GCP gene of all male patients and heterozygotes from this family (Fig. 2). Mutation Analysis of RCP The eventual presence of the C203R mutation in RCP was examined with a RCP-specific primer set E4A – E4DR (Fig. 3). No PCR amplification could be obtained with this primer set from patients from our blue cone monochromacy family. Also primer set E3B – E4DR revealed no PCR product, whereas the RCP-specific primer set E4A – E5CR showed the expected PCR product of 1600 bp. This suggested that primer E4DR did not attach to the RCP sequence in exon 4 of RCP from the patients with blue cone monochromacy. Therefore, the E4A – E5CR PCR product derived from one of the patients was directly sequenced. This revealed a thymine to cytosine, a thymine to cytosine, a guanine to adenine, a cytosine to guanine, a thymine to cytosine, and an adenine to guanine transition at RCP nucleotide positions 648, 730, 738, 739, 740, and 747, respectively (Table 1, Fig. 3). As the E4DR primer contains nucleotides 730,
TABLE 1 RCP- and GCP-Specific Nucleotides Present in Exons 3, 4, and 5 or RCP in Our Patient and Frequencies of These Nucleotides in Normal RCP and GCPa Exon 3
4
5
a b
Nucleotide positionb
RCP
GCP
Our patient
494 499 506 579 648 730 738 739 740 747 861 864 866 869 871 876 890 894
G (0.772) A (0.228) C (0.772) A (0.228) G (0.772) C (0.228) T (0.660) G (0.440) T (1.000) T (0.973) C (0.027) G (0.973) A (0.027) C (0.973) G (0.027) T (0.973) C (0.027) A (0.881) G (0.119) A (1.000) T (1.000) T (1.000) G (1.000) A (1.000) G (1.000) C (1.000) A (1.000)
A (0.900) G (0.100) A (0.900) C (0.100) C (0.867) G (0.133) G (0.959) T (0.041) T (0.995) C (0.005) C (1.000) A (1.000) G (1.000) C (1.000) G (1.000) G (1.000) C (1.000) G (1.000) A (1.000) T (1.000) T (1.000) A (0.500) C (0.500) G (1.000)
G C G G C C A G C G A T T G A G C A
Winderickx et al. (1993). Nucleotide positions are according to cDNA numbering.
/ m3709$3604
08-24-95 11:39:09
gnma
AP-Genomics
326
REYNIERS ET AL.
FIG. 3. Gene conversion between RCP and GCP. GCP-specific sequences are in boldface; GCP exon boxes are shaded. The figure is not to scale. (A) Normal RCP. RCP-specific nucleotides and position of the x element are indicated below the exons. The locations of primers used for PCR amplification and sequencing are indicated above the exons. (B) Mutant RCP. GCP-specific nucleotides present in exons 3 and 4 of RCP and the C203R point mutation are indicated below the exons. The block of green sequence is represented by the shaded box. (C) Mutant GCP. GCP-specific nucleotides and the C203R mutation are indicated above the exons.
738, 739, 740, and 747, PCR amplification of DNA from the blue cone monochromacy patient was not successful. These transitions in the RCP gene result at the protein level in the substitution for Cys by Arg (C203R), Ile by Thr (I230T), Ala by Ser (A233S), and Met by Val (M236V). As the C203R mutation is present in both the RCP and the GCP gene, and as there are multiple substitutions for nucleotides typical for RCP by nucleotides typical for GCP, we suggest that a block of sequence derived from GCP is present in RCP. To determine the extent of this GCP sequence block we PCR-amplified exons 2 and 3 of RCP with a RCP-specific primer set E2CR and E3D. Sequence analysis revealed a thymine to guanine transition at nucleotide position 579, which leads to a Ser to Ala (S180A) substitution at the protein level. This substitution, however, is a common polymorphism in RCP, and a G579 is present on 44% of the RCP haplotypes (Winderickx et al., 1993). Moreover, no additional GCP sequences were found in exon 3 of RCP (Table 1, Fig. 3). Also, exon 5 was PCR-amplified and directly sequenced with primer E5A and a red-specific primer E5DR (5*CATCAAAGGGTGGAAGGCGTAA3 *). This revealed only normal RCP sequence, demonstrated by the presence of A861, T864, T866, G869, A871, G876, C890, and A894 (Table 1).
/ m3709$3604
08-24-95 11:39:09
gnma
DISCUSSION
In the family that we describe here, blue cone monochromacy is due to an inactivating C203R point mutation present in both RCP and GCP. There has been only one such case reported previously (Nathans et al., 1993). Many cases of blue cone monochromacy are due to the presence of the C203R mutation in a single 5* red–3* green hybrid gene, and one case with a RCP gene carrying the C203R mutation in the absence of a GCP gene has been reported (Nathans et al., 1993). We sequenced the flanking sequences around the C203R mutation in the RCP gene of our patient and found that the exon 4 sequence downstream of the C203R mutation contains 5 nucleotides C730, A738, G739, C740, and G747 most typical of GCP that are found only in RCP with frequencies of 2.7% for C730, A738, G839, and C740 and of 11.9% for G747 (Table 1) (Winderickx et al., 1993). Also, the RCP sequence upstream of the C203R mutation might contain nucleotides of GCP, as G579 is present in only 44% of RCP alleles and in 96% of the GCP alleles. The exon 3 region upstream of this G579 and exon 5 have a RCP-specific sequence. Although males who have C730, A738, G739, C740, and G747 in exon 4 of RCP have a decreased red pigment sensitivity due to a 3 to 4-nm shift in lmax (Merbs and Nathans, 1992),
AP-Genomics
GENE CONVERSION IN BLUE CONE MONOCHROMACY
this is not causally related to blue cone monochromacy. Our findings, however, suggest that a sequence block of GCP carrying the C203R mutation was transferred to RCP. The nonreciprocal process in which sequences from a donor gene (e.g., GCP) that remains unaffected in the process are transferred to an acceptor gene (e.g., RCP) that shares a high level of homology with the donor gene has been described as gene conversion (Kourilsky, 1986). Gene conversion has been described in many genes, including the human fetal g-globin gene cluster (Stoeckert et al., 1984), human embryonic zglobin genes (Hill et al., 1985), DRB loci of the major histocompatibility complex class II (Gyllensten et al., 1991), and the fragile X gene (van den Ouweland et al., 1994). The presence of a block of GCP sequences in RCP of all of the patients with blue cone monochromacy in this family is probably due to gene conversion, although the ancestral event of gene conversion could not be documented. Other gene conversion events between RCP and GCP have been described previously. A gene conversion event is also postulated to have occurred between RCP and GCP in an ancestral human African population, leading to a shortened RCP in one-third of African-Americans (Jorgensen et al., 1990). After the duplication of the ancestral opsin gene into RCP and GCP, DNA sequences of RCP and GCP have diverged little, as recurrent gene conversion has led to sequence homogenization (Balding et al., 1992). A hypervariable minisatellite (a x element) has been found in exon 3 of RCP and GCP (Winderickx et al., 1993). The presence of this x element might explain the high frequency of gene conversion and recombinational events in exon 3 (Nathans et al., 1993; Winderickx et al., 1993). Probably these recombination or gene conversion events are responsible for the great variety of haplotypes found in exon 3 of RCP and GCP (Winderickx et al., 1993). Among the 19 different haplotypes of RCP that have been described, one individual showed the same block of green sequence in exons 3 and 4 of RCP as in our patients, indicating a similar gene conversion event. This individual does not carry the C203R point mutation and has normal color vision. The presence of the C203R point mutation in RCP has been described in two other patients (Nathans et al., 1993). The authors postulated that this mutation was transferred from GCP into RCP by gene conversion. We have demonstrated here that not only the C203R point mutation but also its GCP-specific flanking sequences are present in the RCP gene from the patients of this family. This makes it likely that indeed the presence of the C203R mutation in RCP is due to gene conversion between RCP and GCP. Our findings together with the findings of Nathans et al. (1993) and the finding that the C203R mutation is present in one or more of the GCP genes in individuals with deuteranomalous and normal color vision (Winderickx et al., 1992) suggest that the C203R point mutation is an ancient mutation in GCP that occurred before the duplication events by unequal recombina-
/ m3709$3604
08-24-95 11:39:09
gnma
327
tion and before the gene conversion events. This might explain why this mutation might be present in humans at a high frequency of 0.5% (Nathans et al., 1993). ACKNOWLEDGMENTS We thank J. Nathans for kindly providing us with the gJHN60 clone and the red pigment cDNA clone hs7, J. Winderickx for useful advice, and K. Denecker for secretarial assistance.
REFERENCES Alpern, M. (1974). What is it that confines in a world without color? Invest. Ophthalmol. 13: 648–674. Balding, D. J., Nicols, R. A., and Hunt, D. M. (1992). Detecting gene conversion: Primate visual pigment genes. Proc. R. Soc. London 249: 275–280. Bartley, J., Gies, C., and Jacobsen, D. (1989). Cone dystrophy (Xlinked) (COD1) maps between DXS7 (L1.28) and DXS206 (XJ1.1) and is linked to DXS84 (754). Cytogenet. Cell Genet. 51: 959. Bergen, A. A. B., Meire, F., ten Brink, J., Schummen, E. J. M., Van Ommen, G. J. B., and Delleman, J. W. (1993). Additional evidence for a gene locus for progressive cone dystrophy with late rod involvement in Xp21.1–p11.3. Genomics 18: 463–464. Blackwell, H. R., and Blackwell, O. M. (1961). Rod and cone receptor mechanisms in typical and atypical congenital achromatopsia. Vision Res. 1: 62–107. Deeb, S. S., Lindsey, D. T., Hibiya, Y., Samocki, E., Winderickx, J., Teller, D. Y., and Motulsky, A. G. (1992). Genotype–phenotype relationships in human red/green color vision defects: Molecular and psychophysical studies. Am. J. Hum. Genet. 51: 687–700. Franc¸ois, J., Verriest, G., Matton-Van Leuven, M. T., De Rouck, A., and Manavian, D. (1966). Atypical achromatopia of sex-linked recessive inheritance. Am. J. Ophthalmol. 61: 161–168. Gyllensten, U. B., Sundvall, M., and Erlich, H. A. (1991). Allelic diversity is generated by intraexon sequence exchange at the DRB1 locus of primates. Proc. Natl. Acad. Sci. USA 88: 3686– 3690. Hess, R. F., Mullen, K. T., Sharpe, L. T., and Zrenner, E. (1989). The photoreceptors in atypical achromatopsia. J. Physiol. 417: 123– 149. Hill, A. V. S., Nicholls, R. D., Thein, S. L., and Higgs, D. R. (1985). Recombination within the human embryonic z-globin locus: A common z – z chromosome produced by gene conversion of the cz gene. Cell 42: 809–819. Jorgensen, A. L., Deeb, S. S., and Motulsky, A. G. (1990). Molecular genetics of X-chromosome linked color vision among populations of African and Japanese ancestry: High frequency of a shortened red pigment gene among Afro-Americans. Proc. Natl. Acad. Sci. USA 87: 6512–6516. Kourilsky, P. (1986). Molecular mechanisms for gene conversion in higher cells. Trends Genet. 2: 60–63. Merbs, S. L., and Nathans, J. (1992). Absorption spectra of the hybrid pigments responsible for anomalous color vision. Science 258: 464– 466. Nathans, J., Piantanida, T. P., Eddy, R. L., Shows, T. B., and Hogness, D. S. (1986a). Molecular genetics of inherited variation in human color vision. Science 232: 203–210. Nathans, J., Thomas, D., and Hogness, D. S. (1986b). Molecular genetics of human color vision: The genes encoding blue, green, and red pigments. Science 232: 193–202. Nathans, J., Davenport, C. M., Maumenee, I. H., Lewis, R. A., Hejtmanick, J. F., Litt, M., Lovrien, E., et al. (1989). Molecular genetics of human blue cone monochromacy. Science 245: 831–838. Nathans, J., Maumenee, I. H., Zrenner, E., Sadowski, B., Sharpe, L. T., Lewis, R. A., Hansen, E., and Rosenberg, T. (1993). Genetic
AP-Genomics
328
REYNIERS ET AL.
heterogeneity among blue cone monochromats. Am. J. Hum. Genet. 53: 987–1000. Pokorny, J., Smith, V. C., Verriest, G., and Pinckers, A. I. J. G. (1979). ‘‘Congenital and Acquired Color Vision Defects,’’ Grune & Stratton, New York. Stoeckert, C. J., Collins, F. S., and Weissman, S. M. (1984). Human fetal globin DNA sequences suggest novel conversion event. Nucleic Acids Res. 12: 4469–4479. Van den Ouweland, A. M. W., Deelen, W. H., Kunst, C. B., Giovannucci-Uzielli, M-L., Nelson, D. L., Warren, S. T., Oostra, B. A., et al. (1994). Loss of mutation at the FMR1 locus through multiple
/ m3709$3604
08-24-95 11:39:09
gnma
exchanges between maternal X chromosomes. Hum. Mol. Genet. 3: 1823–1827. Vollrath, D., Nathans, J., and Davis, R. W. (1988). Tandem array of human visual pigment genes at Xq28. Science 240: 1669–1672. Winderickx, J., Sanocki, E., Lindsey, D. T., Teller, D. Y., Motulsky, A. G., and Deeb, S. S. (1992). Defective color vision associated with a missense mutation in the green vision pigment gene. Nature Genet. 1: 251–256. Winderickx, J., Battisti, L., Hibiya, Y., Motulsky, A. G., and Deeb, S. S. (1993). Haplotype diversity in the human red and green opsin genes: Evidence for frequent sequence exchange in exon 3. Hum. Mol. Genet. 2: 1413–1421.
AP-Genomics
29, 323–328 (1995)
Gene Conversion between Red and Defective Green Opsin Gene in Blue Cone Monochromacy EDWIN REYNIERS,* MARIE-NOE¨LLE VAN THIENEN,* FRANC¸OISE MEIRE,† KRISTEL DE BOULLE,* KRISTINE DEVRIES,* PHILIP KESTELIJN,† AND PATRICK J. WILLEMS*,1 *Department of Medical Genetics, University of Antwerp, Antwerp, Belgium; and †Department of Ophthalmology, University of Ghent, Ghent, Belgium Received March 20, 1995; accepted June 23, 1995
Blue cone monochromacy is an X-linked condition in which the function of both the red pigment gene (RCP) and the green pigment gene (GCP) is impaired. Blue cone monochromacy can be due to a red/green gene array rearrangement existing of a single red/ green hybrid gene and an inactivating C203R point mutation in GCP. We describe here a family with blue cone monochromacy due to the presence of the C203R mutation in both RCP and GCP. The flanking sequences of the C203R mutation in exon 4 of RCP were characteristic for GCP, indicating that this mutation was transferred from GCP into RCP by gene conversion. q 1995 Academic Press, Inc.
INTRODUCTION
Three classes of cone photoreceptors are involved in normal color vision. A blue cone opsin is encoded by a gene on chromosome 7, and red and green cone opsin genes are located on the X chromosome in Xq28. Individuals with normal color vision have one red opsin gene (RCP) followed downstream by one or more green opsin genes (GCP) in head to tail tandem array. The RCP and GCP genes are highly homologous, thereby predisposing them to unequal inter- and intragenic homologous recombinations (Nathans et al., 1986a). Common types of color blindness such as dichromacy (loss of red or green opsin) or anomalous trichromacy (a shift in the spectrum of red or green opsin) arise from such inter- and intragenic recombinations between RCP and GCP leading to red–green hybrid genes (Nathans et al., 1986b; Vollrath et al., 1988; Deeb et al., 1992). In this case only one of the red or green pigment genes remains intact, leading to absence or anomalous function of red or green opsin. Patients with blue cone monochromacy, an infrequent X-linked condition, have no functional RCP or 1 To whom correspondence should be addressed at the Department of Medical Genetics, University of Antwerp, 2610 Antwerp, Belgium. Telephone: (32)3-820.25.70. Fax: (32)3-820.25.66.
GCP and only a single cone system (Blackwell and Blackwell, 1961; Alpern, 1974; Pokorny et al., 1979; Hess et al., 1989). This leads to impaired discrimination of colors, photophobia, low acuity, nystagmus, and in some cases progressive retinal degeneration. Genetic heterogeneity has been described among blue cone monochromats by Nathans et al. (1993). Blue cone monochromacy can be associated with deletions of a control region upstream of the red opsin gene. All of these deletions have a 579-bp overlap region located 3–4 kb upstream of the transcription start of RCP. This deletion results in loss of expression of both RCP and GCP (Nathans et al., 1989). Blue cone monochromacy can also be due to missense point mutations in RCP or GCP that lead to amino acid changes inactivating the red and green opsins. A common mutation is a thymine to cytosine substitution at nucleotide position 648 of GCP (Winderickx et al., 1992). This mutation disrupts a highly conserved disulfide bridge, as the essential cysteine at amino acid position 203 is replaced by an arginine (C203R). Two other inactivating point mutations have been reported: A247T in RCP and P307L in a RCP/GCP hybrid gene (Nathans et al., 1993). In this class of blue cone monochromacy the RCP/GCP array has usually been reduced to a single repeat unit by unequal homologous recombination, the single repeat unit containing an inactivating point mutation. This paper describes a third kind of mutation leading to blue cone monochromacy, e.g., the presence of the C203R mutation in both RCP and GCP. The C203R mutation in exon 4 of RCP was found to be flanked by GCP-specific sequences. These findings make it likely that a gene conversion event has taken place between the RCP and the GCP gene, leading to the presence of the C203R point mutation and flanking GCP-specific sequences in RCP. MATERIALS AND METHODS Patients. This family has already been described by Franc¸ois et al. (1966) (Fig. 1). All affected men (with the exception of IV11) and all obligate carriers were ophthalmologically examined. The clinical
323
/ m3709$3604
08-24-95 11:39:09
gnma
0888-7543/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
AP-Genomics
324
REYNIERS ET AL.
FIG. 1. Pedigree of the family with blue cone monochromacy and haplotypes of the markers DXS52, RCP/GCP, G6PD, and F8. The disease segregates with the haplotype 2-2-1-2. characteristics of the affected men consist of reduced visual acuity (0.1–0.3), myopia, and color blindness. In half of the patients myopia was more than six diopters. The patients showed total red and green color defectiveness, but they could distinguish figures on Berson plates. Funduscopy in two older affected men (53 and 58 years, respectively) revealed atrophy of the retinal pigment epithelium and choriocapillaris in the macular region. No photopic response could be found with standard electroretinography (ERG) in all affected patients. The obligate carriers had normal visual acuity and showed discrete abnormalities on color vision testing. DNA was isolated from seven male patients, four female obligate carriers, one unaffected male, and one unaffected relative from this blue cone monochromacy family (Fig. 1). Linkage analysis. DNA markers DXS52 (F814), RCP/GCP (CA repeat), G6PD, and F8 (CA repeat) on Xq28 were used to perform linkage analysis between the disorder and the RCP/GCP locus. Twopoint lod scores were calculated using the MLINK program of the LINKAGE 5.1 package. To exclude a gene locus for progressive cone dystrophy on the short arm of the X chromosome (Bartley et al., 1989; Bergen et al., 1993), we also performed linkage analysis with DNA markers MAOA (CA repeat), DXS7 (CA repeat), DXS426 (CA repeat), and DXS255 (M27b) located in Xp11.2–p11.4. Southern blot analysis. Southern blot analysis of DNA extracted from peripheral blood was performed according to standard procedures. To study gross DNA rearrangements in RCP and GCP, the entire red pigment cDNA clone hs7, a 300-bp EcoRI/BamHI fragment of hs7, and a 900-bp EcoRI/BamHI fragment of hs7 were used on EcoRI digests, EcoRI/BamHI double digests, and RsaI digests, as previously described by Nathans et al. (1986a). Southern blot analysis of the 5* regulatory region located 3–4 kb upstream of RCP was performed with an 800-bp HindIII/BamHI fragment of clone gJHN60 (Nathans et al., 1989) on a HindIII digest. gJHN60 is a genomic clone containing part of the RCP gene and the 8.6-kb region upstream of the RCP start codon.
/ m3709$3604
08-24-95 11:39:09
gnma
PCR analysis. The upstream promotor of RCP and GCP was studied using primer L1 (5*GGAATTCCCTTTCTTGGGCCGCCACTCGC3*) and primer L2 (5*GGAATTCCCCAGCCTTGTCCCATTACCG3*). Primer L1 is located 54 bp upstream of the 579-bp deletion overlap region (Nathans et al., 1989). Primer L2 is located 36 bp downstream of this region. Exons 2, 3, 4, and 5 of RCP were further studied using gene-specific primers as described by Winderickx et al. (1993). Primers E2CR, E4DR, E5CR, and E5DR are RCP-specific primers. Primer E4DG is a GCP-specific primer. Primers E3B, E3D, E4A, and E5A attach to both RCP and GCP templates. PCR products were separated on 1.5% agarose gel, extracted from the agarose gel by centrifugation, and purified using Wizard DNA preps (Promega). PCR products were directly sequenced on an ABI 373A automated sequencer using cycle sequencing reaction with dye terminators.
RESULTS
Linkage and Southern Blot Analysis Linkage analysis suggested linkage with the markers on Xq28 with a maximal lod score of 1.95 at u Å 0 with marker DXS52. Patients and controls showed identical patterns on the Southern blots with all of the RCP/GCP probes used. The ratio of intensities between the fragments derived from the RCP and GCP genes, suggested that the RCP gene is followed downstream by one single GCP (data not shown). Analysis of the Upstream Promotor of RCP/GCP In the majority of blue cone monochromacy patients RCP and GCP are inactivated by deletion of an up-
AP-Genomics
325
GENE CONVERSION IN BLUE CONE MONOCHROMACY
Mutation Analysis of GCP
FIG. 2. Identification of the C203R mutation in exon 4 of GCP. PCR products obtained with a GCP-specific primer set E4A–E4DR were digested with BstUI and electrophoresed on a 3% agarose gel. Substitution of cytosine for a thymine at nucleotide position 648 creates a novel BstUI site. The controls (C1, C2) lack the BstUI site and show only the wildtype allele of 138 bp. Patients (P1, P2) carrying the C203R mutation have the 110- and the 28-bp fragment, and obligate female carriers (H1, H2) show both the wildtype fragment and the mutant fragment.
stream promotor 3–4 kb upstream of RCP. To detect a deletion in the upstream promotor of RCP and GCP, DNA from patients of our family was digested with HindIII and probed with an 800-bp HindIII–BamHI fragment of gJHN60. This probe is a genomic sequence located between 9.0 and 8.2 kb upstream of the RCP gene. Southern blot analysis revealed the normal 7.2kb fragment. To detect small deletions the upstream promotor was amplified by PCR using primers L1 and L2, which are located 5* and 3* of the 579-bp overlap region between the different deletions found in the upstream promotor of blue cone monochromacy patients (Nathans et al., 1989). PCR analysis with these primers showed only PCR fragments of the normal length of 680 bp. These findings make it likely that our patients have intact upstream promotors.
The most common inactivating mutation in blue cone monochromacy is a C203R point mutation at position 648 in exon 4 of GCP. This mutation creates a novel BstUI site. The male patients were tested for the presence of this mutation with a GCP-specific primer set (E4A–E4DG) (Fig. 3). The normal PCR product is 138 bp, whereas the PCR products of the patients were cleaved into fragments of 110 and 28 bp by the novel BstUI site. The C203R mutation was present in the GCP gene of all male patients and heterozygotes from this family (Fig. 2). Mutation Analysis of RCP The eventual presence of the C203R mutation in RCP was examined with a RCP-specific primer set E4A – E4DR (Fig. 3). No PCR amplification could be obtained with this primer set from patients from our blue cone monochromacy family. Also primer set E3B – E4DR revealed no PCR product, whereas the RCP-specific primer set E4A – E5CR showed the expected PCR product of 1600 bp. This suggested that primer E4DR did not attach to the RCP sequence in exon 4 of RCP from the patients with blue cone monochromacy. Therefore, the E4A – E5CR PCR product derived from one of the patients was directly sequenced. This revealed a thymine to cytosine, a thymine to cytosine, a guanine to adenine, a cytosine to guanine, a thymine to cytosine, and an adenine to guanine transition at RCP nucleotide positions 648, 730, 738, 739, 740, and 747, respectively (Table 1, Fig. 3). As the E4DR primer contains nucleotides 730,
TABLE 1 RCP- and GCP-Specific Nucleotides Present in Exons 3, 4, and 5 or RCP in Our Patient and Frequencies of These Nucleotides in Normal RCP and GCPa Exon 3
4
5
a b
Nucleotide positionb
RCP
GCP
Our patient
494 499 506 579 648 730 738 739 740 747 861 864 866 869 871 876 890 894
G (0.772) A (0.228) C (0.772) A (0.228) G (0.772) C (0.228) T (0.660) G (0.440) T (1.000) T (0.973) C (0.027) G (0.973) A (0.027) C (0.973) G (0.027) T (0.973) C (0.027) A (0.881) G (0.119) A (1.000) T (1.000) T (1.000) G (1.000) A (1.000) G (1.000) C (1.000) A (1.000)
A (0.900) G (0.100) A (0.900) C (0.100) C (0.867) G (0.133) G (0.959) T (0.041) T (0.995) C (0.005) C (1.000) A (1.000) G (1.000) C (1.000) G (1.000) G (1.000) C (1.000) G (1.000) A (1.000) T (1.000) T (1.000) A (0.500) C (0.500) G (1.000)
G C G G C C A G C G A T T G A G C A
Winderickx et al. (1993). Nucleotide positions are according to cDNA numbering.
/ m3709$3604
08-24-95 11:39:09
gnma
AP-Genomics
326
REYNIERS ET AL.
FIG. 3. Gene conversion between RCP and GCP. GCP-specific sequences are in boldface; GCP exon boxes are shaded. The figure is not to scale. (A) Normal RCP. RCP-specific nucleotides and position of the x element are indicated below the exons. The locations of primers used for PCR amplification and sequencing are indicated above the exons. (B) Mutant RCP. GCP-specific nucleotides present in exons 3 and 4 of RCP and the C203R point mutation are indicated below the exons. The block of green sequence is represented by the shaded box. (C) Mutant GCP. GCP-specific nucleotides and the C203R mutation are indicated above the exons.
738, 739, 740, and 747, PCR amplification of DNA from the blue cone monochromacy patient was not successful. These transitions in the RCP gene result at the protein level in the substitution for Cys by Arg (C203R), Ile by Thr (I230T), Ala by Ser (A233S), and Met by Val (M236V). As the C203R mutation is present in both the RCP and the GCP gene, and as there are multiple substitutions for nucleotides typical for RCP by nucleotides typical for GCP, we suggest that a block of sequence derived from GCP is present in RCP. To determine the extent of this GCP sequence block we PCR-amplified exons 2 and 3 of RCP with a RCP-specific primer set E2CR and E3D. Sequence analysis revealed a thymine to guanine transition at nucleotide position 579, which leads to a Ser to Ala (S180A) substitution at the protein level. This substitution, however, is a common polymorphism in RCP, and a G579 is present on 44% of the RCP haplotypes (Winderickx et al., 1993). Moreover, no additional GCP sequences were found in exon 3 of RCP (Table 1, Fig. 3). Also, exon 5 was PCR-amplified and directly sequenced with primer E5A and a red-specific primer E5DR (5*CATCAAAGGGTGGAAGGCGTAA3 *). This revealed only normal RCP sequence, demonstrated by the presence of A861, T864, T866, G869, A871, G876, C890, and A894 (Table 1).
/ m3709$3604
08-24-95 11:39:09
gnma
DISCUSSION
In the family that we describe here, blue cone monochromacy is due to an inactivating C203R point mutation present in both RCP and GCP. There has been only one such case reported previously (Nathans et al., 1993). Many cases of blue cone monochromacy are due to the presence of the C203R mutation in a single 5* red–3* green hybrid gene, and one case with a RCP gene carrying the C203R mutation in the absence of a GCP gene has been reported (Nathans et al., 1993). We sequenced the flanking sequences around the C203R mutation in the RCP gene of our patient and found that the exon 4 sequence downstream of the C203R mutation contains 5 nucleotides C730, A738, G739, C740, and G747 most typical of GCP that are found only in RCP with frequencies of 2.7% for C730, A738, G839, and C740 and of 11.9% for G747 (Table 1) (Winderickx et al., 1993). Also, the RCP sequence upstream of the C203R mutation might contain nucleotides of GCP, as G579 is present in only 44% of RCP alleles and in 96% of the GCP alleles. The exon 3 region upstream of this G579 and exon 5 have a RCP-specific sequence. Although males who have C730, A738, G739, C740, and G747 in exon 4 of RCP have a decreased red pigment sensitivity due to a 3 to 4-nm shift in lmax (Merbs and Nathans, 1992),
AP-Genomics
GENE CONVERSION IN BLUE CONE MONOCHROMACY
this is not causally related to blue cone monochromacy. Our findings, however, suggest that a sequence block of GCP carrying the C203R mutation was transferred to RCP. The nonreciprocal process in which sequences from a donor gene (e.g., GCP) that remains unaffected in the process are transferred to an acceptor gene (e.g., RCP) that shares a high level of homology with the donor gene has been described as gene conversion (Kourilsky, 1986). Gene conversion has been described in many genes, including the human fetal g-globin gene cluster (Stoeckert et al., 1984), human embryonic zglobin genes (Hill et al., 1985), DRB loci of the major histocompatibility complex class II (Gyllensten et al., 1991), and the fragile X gene (van den Ouweland et al., 1994). The presence of a block of GCP sequences in RCP of all of the patients with blue cone monochromacy in this family is probably due to gene conversion, although the ancestral event of gene conversion could not be documented. Other gene conversion events between RCP and GCP have been described previously. A gene conversion event is also postulated to have occurred between RCP and GCP in an ancestral human African population, leading to a shortened RCP in one-third of African-Americans (Jorgensen et al., 1990). After the duplication of the ancestral opsin gene into RCP and GCP, DNA sequences of RCP and GCP have diverged little, as recurrent gene conversion has led to sequence homogenization (Balding et al., 1992). A hypervariable minisatellite (a x element) has been found in exon 3 of RCP and GCP (Winderickx et al., 1993). The presence of this x element might explain the high frequency of gene conversion and recombinational events in exon 3 (Nathans et al., 1993; Winderickx et al., 1993). Probably these recombination or gene conversion events are responsible for the great variety of haplotypes found in exon 3 of RCP and GCP (Winderickx et al., 1993). Among the 19 different haplotypes of RCP that have been described, one individual showed the same block of green sequence in exons 3 and 4 of RCP as in our patients, indicating a similar gene conversion event. This individual does not carry the C203R point mutation and has normal color vision. The presence of the C203R point mutation in RCP has been described in two other patients (Nathans et al., 1993). The authors postulated that this mutation was transferred from GCP into RCP by gene conversion. We have demonstrated here that not only the C203R point mutation but also its GCP-specific flanking sequences are present in the RCP gene from the patients of this family. This makes it likely that indeed the presence of the C203R mutation in RCP is due to gene conversion between RCP and GCP. Our findings together with the findings of Nathans et al. (1993) and the finding that the C203R mutation is present in one or more of the GCP genes in individuals with deuteranomalous and normal color vision (Winderickx et al., 1992) suggest that the C203R point mutation is an ancient mutation in GCP that occurred before the duplication events by unequal recombina-
/ m3709$3604
08-24-95 11:39:09
gnma
327
tion and before the gene conversion events. This might explain why this mutation might be present in humans at a high frequency of 0.5% (Nathans et al., 1993). ACKNOWLEDGMENTS We thank J. Nathans for kindly providing us with the gJHN60 clone and the red pigment cDNA clone hs7, J. Winderickx for useful advice, and K. Denecker for secretarial assistance.
REFERENCES Alpern, M. (1974). What is it that confines in a world without color? Invest. Ophthalmol. 13: 648–674. Balding, D. J., Nicols, R. A., and Hunt, D. M. (1992). Detecting gene conversion: Primate visual pigment genes. Proc. R. Soc. London 249: 275–280. Bartley, J., Gies, C., and Jacobsen, D. (1989). Cone dystrophy (Xlinked) (COD1) maps between DXS7 (L1.28) and DXS206 (XJ1.1) and is linked to DXS84 (754). Cytogenet. Cell Genet. 51: 959. Bergen, A. A. B., Meire, F., ten Brink, J., Schummen, E. J. M., Van Ommen, G. J. B., and Delleman, J. W. (1993). Additional evidence for a gene locus for progressive cone dystrophy with late rod involvement in Xp21.1–p11.3. Genomics 18: 463–464. Blackwell, H. R., and Blackwell, O. M. (1961). Rod and cone receptor mechanisms in typical and atypical congenital achromatopsia. Vision Res. 1: 62–107. Deeb, S. S., Lindsey, D. T., Hibiya, Y., Samocki, E., Winderickx, J., Teller, D. Y., and Motulsky, A. G. (1992). Genotype–phenotype relationships in human red/green color vision defects: Molecular and psychophysical studies. Am. J. Hum. Genet. 51: 687–700. Franc¸ois, J., Verriest, G., Matton-Van Leuven, M. T., De Rouck, A., and Manavian, D. (1966). Atypical achromatopia of sex-linked recessive inheritance. Am. J. Ophthalmol. 61: 161–168. Gyllensten, U. B., Sundvall, M., and Erlich, H. A. (1991). Allelic diversity is generated by intraexon sequence exchange at the DRB1 locus of primates. Proc. Natl. Acad. Sci. USA 88: 3686– 3690. Hess, R. F., Mullen, K. T., Sharpe, L. T., and Zrenner, E. (1989). The photoreceptors in atypical achromatopsia. J. Physiol. 417: 123– 149. Hill, A. V. S., Nicholls, R. D., Thein, S. L., and Higgs, D. R. (1985). Recombination within the human embryonic z-globin locus: A common z – z chromosome produced by gene conversion of the cz gene. Cell 42: 809–819. Jorgensen, A. L., Deeb, S. S., and Motulsky, A. G. (1990). Molecular genetics of X-chromosome linked color vision among populations of African and Japanese ancestry: High frequency of a shortened red pigment gene among Afro-Americans. Proc. Natl. Acad. Sci. USA 87: 6512–6516. Kourilsky, P. (1986). Molecular mechanisms for gene conversion in higher cells. Trends Genet. 2: 60–63. Merbs, S. L., and Nathans, J. (1992). Absorption spectra of the hybrid pigments responsible for anomalous color vision. Science 258: 464– 466. Nathans, J., Piantanida, T. P., Eddy, R. L., Shows, T. B., and Hogness, D. S. (1986a). Molecular genetics of inherited variation in human color vision. Science 232: 203–210. Nathans, J., Thomas, D., and Hogness, D. S. (1986b). Molecular genetics of human color vision: The genes encoding blue, green, and red pigments. Science 232: 193–202. Nathans, J., Davenport, C. M., Maumenee, I. H., Lewis, R. A., Hejtmanick, J. F., Litt, M., Lovrien, E., et al. (1989). Molecular genetics of human blue cone monochromacy. Science 245: 831–838. Nathans, J., Maumenee, I. H., Zrenner, E., Sadowski, B., Sharpe, L. T., Lewis, R. A., Hansen, E., and Rosenberg, T. (1993). Genetic
AP-Genomics
328
REYNIERS ET AL.
heterogeneity among blue cone monochromats. Am. J. Hum. Genet. 53: 987–1000. Pokorny, J., Smith, V. C., Verriest, G., and Pinckers, A. I. J. G. (1979). ‘‘Congenital and Acquired Color Vision Defects,’’ Grune & Stratton, New York. Stoeckert, C. J., Collins, F. S., and Weissman, S. M. (1984). Human fetal globin DNA sequences suggest novel conversion event. Nucleic Acids Res. 12: 4469–4479. Van den Ouweland, A. M. W., Deelen, W. H., Kunst, C. B., Giovannucci-Uzielli, M-L., Nelson, D. L., Warren, S. T., Oostra, B. A., et al. (1994). Loss of mutation at the FMR1 locus through multiple
/ m3709$3604
08-24-95 11:39:09
gnma
exchanges between maternal X chromosomes. Hum. Mol. Genet. 3: 1823–1827. Vollrath, D., Nathans, J., and Davis, R. W. (1988). Tandem array of human visual pigment genes at Xq28. Science 240: 1669–1672. Winderickx, J., Sanocki, E., Lindsey, D. T., Teller, D. Y., Motulsky, A. G., and Deeb, S. S. (1992). Defective color vision associated with a missense mutation in the green vision pigment gene. Nature Genet. 1: 251–256. Winderickx, J., Battisti, L., Hibiya, Y., Motulsky, A. G., and Deeb, S. S. (1993). Haplotype diversity in the human red and green opsin genes: Evidence for frequent sequence exchange in exon 3. Hum. Mol. Genet. 2: 1413–1421.
AP-Genomics