- Email: [email protected]
Gene expression analysis in post-embryonic pericardial cells of Drosophila
Gene Expression Patterns 8 (2008) 199–205 www.elsevier.com/locate/gep
Gene expression analysis in post-embryonic pericardial cells of Drosophila Debjani Das, D. Ashoka, Rajaguru Aradhya, Maneesha Inamdar
*
Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur P.O., Bangalore 560064, India Received 7 August 2007; received in revised form 19 October 2007; accepted 24 October 2007 Available online 1 November 2007
Abstract Increasing evidence suggests conservation of cardiovascular molecules between vertebrates and invertebrates. Vertebrate Rudhira, an evolutionary conserved WD40 protein is expressed during primitive erythropoiesis, neoangiogenesis and tumors. We report here the expression profile of the Drosophila ortholog of Rudhira (DRudh) in the fly life cycle. DRudh is expressed specifically in all post-embryonic pericardial cells (PCs) and garland cells (GCs). This is the first report of a cytoplasmic marker highly specific to post-embryonic PCs. Embryonic PCs belong to three distinct genetic classes based on Odd-skipped (Odd), Even-skipped (Eve) and Tinman (Tin) expression. To identify which among these three classes of PCs expresses DRudh in post-embryonic stages, we analyzed expression of embryonic PC markers in the post-embryonic stages. Unlike in the embryo all larval PCs show an identical gene expression profile. While Odd and Eve expression is mutually exclusive in the embryonic PCs, these two markers are co-expressed in larval PCs but show a distinct subcellular localization. Tin is not expressed in any post-embryonic PC. Additionally larval PCs also express the GATA factor, Serpent (Srp) and the extracellular matrix protein, Pericardin (Prc). While PC number is known to decrease post-embryogenesis, which of the Odd or Eve lineage embryonic PCs persists is not known. Co-expression of the two distinct lineage markers only in post-embryonic stages indicates a complex temporal regulation of gene expression in PCs. Ó 2007 Elsevier B.V. All rights reserved. Keywords: Pericardial cell; Odd-skipped; Even-skipped; Serpent; Rudhira; Tinman; Seven up; Pericardin; Post-embryonic
1. Results and discussion In spite of the rather obvious morphological differences between vertebrates and invertebrates, the underlying molecular mechanisms orchestrating different developmental processes are remarkably conserved. This is true even for the cardiovascular system although invertebrates possess a simple linear heart compared to the multi-chambered branched structure of the vertebrate. In the past few decades a number of gene functions and transcriptional networks have been identified that are utilized by both vertebrates and invertebrates for cardiogenesis (Bodmer and Venkatesh, 1998; Cripps
*
Corresponding author. Tel.: +91 80 2208 2818; fax: +91 80 2208 2766. E-mail address: [email protected] (M. Inamdar).
1567-133X/$ - see front matter Ó 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2007.10.008
and Olson, 2002; Zaffran and Frasch, 2002) and hematopoiesis (Evans and Banerjee, 2003; Evans et al., 2003; Lebestky et al., 2000; Mandal et al., 2004). We had earlier reported a novel WD40 domain protein, Rudhira (Rudh) expressed during primitive erythropoiesis and neo-vascularization (Siva and Inamdar, 2006). The human homolog (Breast Cancer Amplified Sequence 3) is implicated in breast cancer progression (Gururaj et al., 2007). Rudh is highly conserved across species and the Drosophila ortholog corresponds to the uncharacterized gene CG32663 (NCBI Accession # NM_167309) (Siva and Inamdar, 2006). To analyze whether Drosophila Rudhira (DRudh) is a cardiovascular molecule like its murine counterpart we examined DRudh expression in all stages of the fly life cycle. We also report the morphology and gene expression pattern of post-embryonic PCs.
200
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
1.1. Drosophila Rudhira is a novel marker for postembryonic PCs To analyze the expression of DRudh protein during the fly life cycle we raised polyclonal antibodies against a 183 aa fragment of the encoded protein (see Section 2 and Fig. S1) and used it for immunostaining on embryos and all post-embryonic tissues. We did not observe DRudh expression in the embryo (see supplementary information and Fig. S2). Among the larval stages we first detected DRudh expression in the second instar in a few cells in the dorsal-most region of the posterior abdominal segments (see supplementary Fig. S3 C). Similar staining was not observed in larvae immunostained with preimmune serum (see supplementary Fig. S3 E). The location of DRudh-expressing cells along the dorsal midline suggested that these could be cells of the dorsal vessel. The Drosophila heart or dorsal vessel is a simple contractile tube of cardioblasts (CBs) flanked by accessory pericardial cells (PCs) (Bodmer and Frasch, 1999). To test if DRudh is indeed expressed in dorsal vessel cells we analyzed co-localization of DRudh expression with markers that identify the dorsal vessel. Brodu et al. (1999) had reported expression of Serpent (Srp), a GATA factor in larval PCs. A serpent-GAL4 construct driving UAS-EGFP was available (Bruckner et al., 2004) which faithfully replicates the Srp expression in all post-embryonic PCs (see supplementary Fig. S4 A–C). Hence we used srpHemo-GAL, UAS-EGFP animals for Rudh expression analysis for post-embryonic stages. While larval PCs could be detected by GFP fluorescence in srpHemo-GAL, UAS-EGFP animals from 48 h after egg laying (AEL) (supplementary Fig. S3 B), DRudh expression was first seen only from 56 h AEL and co-localized with GFP in PCs (supplementary Fig. S3 D). DRudh expression increased steadily and by early third larval instar (L3) strong expression was observed in PCs which
now appeared as two rows of large cells neatly arranged along the dorsal midline (Fig. 1A and E). Complete colocalization of DRudh and GFP expression was seen in L3 PCs of srpHemo-GAL, UAS-EGFP animals (Fig. 1C and D). GFP controlled by hand-C promoter is expressed in all cardiac and pericardial nuclei (Sellin et al., 2006). In the third larval instar the large PC nuclei can be easily distinguished from the much smaller cardiac nuclei (Fig. 1F arrowheads). DRudh expression in hand-C-GFP transgenic animals was observed in cells with large GFPexpressing nucleus, i.e. PCs (Fig. 1F–H) but not in CBs (Fig. 1F) indicating that DRudh is specifically expressed in PCs. This also establishes DRudh as a cytoplasmic protein [also verified through co-localization with the nuclear marker, DAPI (Fig. 1B)]. We also observed DRudh expression in garland cells (GCs) in the third larval instar (Fig. 1I–K). DRudh expression continues throughout larval development, during metamorphosis [representative image of 24 hour after puparium formation (APF) shown in Fig. 2A and B] and in adults (Fig. 2C and D), identifying all PCs even at these later stages. Variable levels of DRudh expression in PCs were seen in the pupa (Fig. 2A and data not shown). Similar variation is also detected in GFP expression in srpHemo-GAL4 UAS-EGFP animals (Fig. 2B and data not shown). DRudh expression in adult PCs (Fig. 2C and D) was uniform and stronger compared to that in pupae. Due to very low level of GFP expression in adult PCs of srpHemo-GAL4 UAS-EGFP animals we used Prc for identifying the adult dorsal vessel (Fig. 2D). These data establish DRudh as a very specific marker for post-embryonic PCs and GCs. A homologous structure to insect PCs has not been identified in vertebrates. Based on evolutionary-developmental considerations and gene expression evidence Drosophila dorsal vessel cells are now thought to be as closely related to the vertebrate vascular endothelial cells
Fig. 1. DRudh is a cytoplasmic marker for PCs and GCs. (A, C, and D) srpHemo-GAL4 UAS-EGFP or (E–J) handC-GFP or (B and K) wild type third instar larvae immunostained with anti-DRudh (red). Expression is seen in (A–H) PCs or (I–K) GCs. GFP expression in green (C, D, F–H, and J) and DAPI staining in blue (B, D, and K) is shown in the merged panels. Arrowheads indicate cardiac nuclei. Dorsal view with anterior to the left. Scale bar = 50 lm (A), 20 lm (B, F and I) and 10 lm (K).
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
201
Fig. 2. DRudh is expressed in pupal and adult PCs. (A and B) srpHemo-GAL4 UAS-EGFP 24 h APF or (C and D) wild type adult PCs immunostained with anti-DRudh (red in A and B and green in C and D) and (D) Prc (red). (B and D) Merged images of respective panels to their left. Asterisk indicates lymph gland lobes and # indicates autofluorescence from fat. Dorsal view with anterior to the left. Scale bar = 50 lm (A) and 100 lm (C).
as to the myocardium and endocardium (Hartenstein et al., 1992; Hartenstein and Mandal, 2006). It is interesting to note in this context that while Drudh is expressed in PCs, its murine ortholog is expressed in endothelial precursors during vasculogenesis and angiogenesis (Siva and Inamdar, 2006). 1.2. Embryonic and post-embryonic PCs are morphologically different To characterize the DRudh-expressing PCs further we analyzed morphology of post-embryonic PCs. Unlike embryonic PCs, post-embryonic PCs have not been studied in great detail. However even a cursory observation indicates gross differences in embryonic- with post-embryonic PCs. A comparison between these stages shows significant differences in number and arrangement (Fig. 3A–C and F). Compared to the 100–110 PCs observed at the end of embryogenesis only 40–42 PCs are present in the third larval instar (Sellin et al., 2006) (Fig. 3F). As reported by Sellin et al. (2006), in the late stage embryo PCs are present in a neat ‘‘pearl necklace’’ like arrangement and remain tightly associated with CBs. But L3 PCs are fewer in number and appear more disorganized and are loosely attached to CBs. In addition at this stage we also observe asymmetric distribution of PCs on either side of the cardiac tube (Figs. 3B, 1A and E and 4B and E) with differences of 1– 4 cells. PCs flanking the aorta are longer with more stretched- out ‘‘spindle’’ shape (Fig. 3B and D). Further decrease in PC numbers in adults to 30–36 is accounted for by the loss of eight PCs in the 7th and 8th abdominal segments during metamorphosis (Sellin et al., 2006) (Fig. 3C and F). Embryonic PCs can be broadly classified into three subpopulations based on gene expression profile, cell lineage and morphology – two Even-skipped (Eve)-, four Oddskipped (Odd)- and four Tin-expressing cells per hemisegment (Alvarez et al., 2003) (Fig. 3A and A 0 ). This could potentially differentiate between pure or mixed lineage contributions of embryonic PCs to the larval structure. Further this raises the question of whether larval PCs can also be divided into subsets based on gene expression pro-
Fig. 3. Schematic representation of Drosophila dorsal vessel showing embryonic, larval and adult PCs [modified from Alvarez et al. (2003) and Curtis et al. (1999)]. (A) PCs in the context of the embryo showing arrangement of Odd+ (red), Eve+ (blue) and Tin+ (green) cells. Region demarcated by broken lines magnified in (A 0 ). Representation of (B) third instar larval and (C) adult PCs. During metamorphosis eight PCs at the posterior tip of the larval ventricle are lost in the remodeling process reducing the PC count further in adults. Loss of lymph glands during metamorphosis leaves a distinct gap between pericardial cell pairs in the anterior part of the adult heart. (D) Elongated and (E) spherical PCs of third instar larva showing GFP expression and nuclear staining (DAPI). (F) Schematic representation of PC number decrease in the life cycle of Drosophila. A1–A8: abdominal segments, T1–T3: thoracic segments; am: alary muscles; ao: aorta; he: heart; lg: lymph gland; tr: trachea; Em: embryo; L1–L3: first to third larval instars; Pu: pupa; Ad: adult. Dorsal view, anterior to the left. Scale bar = 20 lm (A), 100 lm (B, C and G), and 10 lm (D and E).
file. But these issues have remained unresolved since the post-embryonic expression profile of the embryonic PC lineage markers has not been systematically investigated.
202
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
Jung et al. (2005) reported expression of Odd, while Brodu et al. (1999) demonstrated expression of Serpent (Srp), a GATA factor in third larval instar (L3) PCs. However it is not clear from these reports whether all PCs observed at this stage express Odd and Srp. 1.3. Embryonic PC markers Odd and Eve but not Tin and Svp are expressed again in all PCs of the third larval instar To check whether larval PCs can be grouped based on their marker gene expression we examined Odd, Eve, Tin and Svp expression in these cells. Odd (Fig. 4A–C) and Eve (Fig. 4D–F) are expressed in all L3 PCs. However we did not observe Tin expression in any L3 PCs although
expression was detected in CBs (Fig. 4G). Embryonic Odd+ PCs can be further subdivided based on Svp expression. Two out of four Odd+ PCs per hemisegment express Svp along with two Tin-CBs. In the third larval instar Svp is expressed in CBs but not in any PCs (Fig. 4H). Pericardin (Prc), a collagen-like extracellular matrix protein is also reported as a marker for embryonic PCs. In the embryo Prc is expressed in Odd+ and Tin+ PCs in addition to a subset of CBs and oenocytes (Chartier et al., 2002). We observed expression of Prc in all larval stages (Fig. 4I–K) and also in adults (Fig. 2D). Prc is an extremely useful marker to identify the dorsal vessel in post-embryonic stages but its extracellular localization fails to provide information about changes in cell number.
Fig. 4. Larval PCs express Odd, Eve but not Tin and Svp. (A–G) srpHemoGAL4, UAS-EGFP or (H) svp-lacZ or (I–M) wild type (A–H, K–M) third instar larvae or (I) 24 h AEL or (J) 48 h AEL immunostained to show expression of (A–C) Odd (red), (D–F) Eve (red), (G) Tin (red), (H) b-galactosidase (red) and (I–K) Prc (green). (B, E, G, and H) are merged images showing (B, E, and G) GFP expression (green) or (H) DRudh (green). (C and F) Higher magnification images of individual PCs from the same preparation as on their immediate left. Single nucleus of larval ðL–L000 Þ PC or ðM–M000 Þ muscle cell from the same preparation co-immunostained for (L and M) Eve (red), (L 0 and M 0 ) Fibrillarin (Fib) (green), a nucleolar marker. (L00 , L000 , M00 , and M000 ) Merged image also showing (L000 and M000 ) nucleus stained with DAPI. Asterisks indicate lymph gland lobes, arrowheads indicate background staining from the cuticle and arrows indicate cardiac nuclei. Dorsal view, anterior to the left. Scale bar = 50 lm (A and J), 10 lm (C, G and L), 100 lm (I and K) and 20 lm (M).
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
The number of PCs we observe in our dissected preparations (see Section 2) at this stage agrees with the number reported from live imaging studies (Sellin et al., 2006) indicating that we have included the entire PC population in our analysis. We used srpHemo-GAL4 UAS-EGFP flies for the co-localization experiments to avoid cross-reactivity problems in analyzing the immunostaining results as all antibodies used were raised in rabbit. GFP expression in this stock faithfully replicates the wild type Srp expression pattern in PCs (see supplementary Fig. S4 A–C). This expression analysis clearly shows that post-embryonic PCs do not express all embryonic lineage markers. Hence, post-embryogenesis PCs not only decrease in number but they also show uniform gene expression pattern unlike their embryonic counterparts. Both Odd and Eve are transcription factors and hence nuclear localized (Frasch et al., 1987; Ward and Coulter, 2000). Interestingly, while Odd expression is seen covering the entire nucleus of PCs (Fig. 4C) the expression of Eve appears restricted to a small region within the nucleus (Fig. 4F and L–L000 ). Such restricted pattern is not seen for muscle nuclei which also express Eve (Fig. 4M–M000 ). To investigate this further we co-immunostained for Eve and a nucleolar marker, Fibrillarin (Fib). We observed partial overlap between expressions of Eve and Fib only in PCs (Fig. 4L00 and L000 ). The significance of this interesting expression pattern is not clear. Whether Eve has any role in the nucleolus or it is simply stored in the nucleolus when not required remains to be investigated. Odd and Eve have non-overlapping expression pattern in the embryo (Frasch et al., 1987; Ward and Coulter, 2000). Apart from the PCs we do not observe Eve expression in Odd+ lymph glands nor is Odd expressed in the Eve+ muscles even in post-embryonic stages. This coexpression of Odd and Eve in L3 PCs has raised interesting issues about post-embryonic PC number reduction and their lineage. It is possible that only Odd+ PCs persist post-embryogenesis which then start expressing Eve. The equivalence in numbers of only Odd+ PCs in all developmental stages [especially in abdominal segments (A1–A5) where all PCs are found in the adult stage] has led to the belief that only the embryonic Odd PC lineage persists post-embryogenesis. In this context it is important to note that Fujioka et al. report a reduced number of postembryonic PCs in mutants where embryonic Eve+ PCs have been eliminated (Fujioka et al., 2005). This observation suggests a possible contribution of Eve+ embryonic PCs to the post-embryonic population. These issues regarding post-embryonic PC lineage are likely to be resolved through live tracking of PCs through development. Such a study by Sellin et al. using handC-GFP transgenic animals clearly demonstrated that PCs are lost from the aorta region in the second larval instar (L2). However which subset of PCs is lost could not be determined since handC-GFP expresses in all embryonic PCs. The mechanism of reduction was also not clear. Thus fur-
203
ther analysis would require identification of additional markers and live tracking of particular PC subsets through development. 1.4. Uniform gene expression pattern in post-embryonic PCs Our study has provided a highly specific marker for PCs, namely DRudh. It is the only cytoplasmic marker for PCs to be reported till date. Co-localization with GFP-expressing PCs shows that DRudh identifies the same set of PCs as Odd, Eve and Srp in the third larval instar. Both DRudh and Srp are post-embryonic PC markers. Based on GFP expression in srpHemo-GAL4 UAS-EGFP animals, Srp expression precedes DRudh. Different subsets of embryonic PCs are morphologically distinct. The Odd+ cells are the largest among all PC subsets and lie in the plane of the cardiac tube. In the postembryonic stages especially in the third larval instar one observes distinct morphological features between PCs associated with the aorta and the heart. However with respect to all the markers tested L3 PCs are a homogenous population. Also the co-expression of Odd and Eve in postembryonic PCs we observe suggests a complex and dynamic temporal regulation of gene expression in postembryonic PCs. 2. Experimental procedures 2.1. Fly stocks All stocks were cultured on Cornmeal media. Canton-S was used as the wild type reference strain. The following fly lines were used: srpHemoGAL4 UAS-EGFP (II) #1643 B (V. Sriram); svp-lacZ, cg-GAL4 (K. VijayRaghavan).
2.2. Generation of transgenic fly lines Drudh full-length cDNA (4.1 kbp) (BDGP clone ID LD27278, NCBI Accession # AY075392) was subcloned into pPUAST vector using EcoRI/XhoI sites to generate UAS-Drudh construct. The construct was injected according to standard procedures (Rubin and Spradling, 1982). Germline transformed, transgenic flies were selected by red eye color (w+) and maintained as homozygotes. Multiple lines for each construct were analyzed.
2.3. Generation of anti-DRudh polyclonal antibodies Rabbit polyclonal antibodies were raised against a 183 aa fragment of DRudh [clone pDmrudIII (aa 518–701)], amplified using primers 1905 III F (5 0 CGGCGGCGCCATGGTCGTAT 3 0 ) and 1905 III R (5 0 GGCTCACTCGAGGCTAGCTTCGTGTC 3 0 ), subcloned into pET23d (Novagen, USA), expressed in Escherichia coli and purified by Ni–NTA binding followed by electroelution. Western blot analysis showed that the antisera reacted specifically with overexpressed protein and not with pre-immune serum (supplementary Fig. S1 A and B). Both antisera and pre-immune serum were treated with caprylic acid to purify IgG (Harlow and Lane, 1988). Specificity of the purified anti-DRudh polyclonal antibodies was confirmed by competition assay (see supplementary information and Fig. S1 C–J). A 1:200 dilution of the caprylic acid-purified polyclonal antiserum was used for immunostaining.
204
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
2.4. Immunostaining and microscopy Immunostaining was performed on embryos as described previously (Rothwell and Sullivan, 2000). First and second instar larvae were fixed in 4% paraformaldehyde for 5 min, washed with phosphate-buffered saline (PBS) three times, then with 0.1% Tween 20 in PBS (PT) and weakly sonicated in PT for permeabilization of antibody (Goto et al., 2003). Immunostaining was performed similar to that for embryo. All dissections were in phosphate-buffered saline (PBS). Wandering third instar larvae or white pre-pupae were immobilized by cooling, pinned ventral side up on a Sylgard dish (Sylgard 184, Dow Corning Corp., Midland, MI, USA) and a longitudinal incision was made using fine scissors. Viscera and excess parts of body wall were removed, leaving a thin strip of body wall to which the heart remains attached. The nervous system and other anterior structures including the imaginal discs were left intact to keep the heart in place. Pupae or adults were pinned through the thorax with their ventral side facing up, cuticle was removed and abdomen was finally detached from the rest of the body taking care not to damage the first pair of PCs. Dissected preparations were fixed in 4% formaldehyde in PBS for 30 min then transferred to tubes. All subsequent steps were with gentle agitation on a flat bed rotator, using 1 ml of each solution at room temperature, except for the antibody incubations which were performed at 4 °C. Fixed preps were washed three times with PBS containing 0.1% Triton X-100 (PBST), incubated for 30 min with 10% normal sheep serum in PBST (PBST-N), followed by overnight incubation in appropriate primary antibody diluted in PBST-N. Samples were then washed four times, 30 min each in PBST, blocked in PBST-N, and incubated with secondary antibody diluted in PBST-N for 2.5 h. After four final washes in PBST samples were mounted in 70% glycerol diluted in PBS and observed using fluorescence microscopy. Images were obtained with a Zeiss LSM510-Meta confocal microscope and analyzed using the software LSM Image Examiner (Carl Zeiss, Inc.). The following antibodies and fluorescent reagents were used: rabbit anti-Rudh, 1:200; rabbit anti-Eve, 1:3000 and rabbit anti-Tin, 1:800 (from M. Frasch); rabbit anti-Odd, 1:400 (from R. Cripps); rabbit anti-Srp, 1:1500 (from D.K. Hoshizaki); mouse anti-Prc, 1:500 (DSHB); mouse anti-b-galactosidase, 1:50 (DSHB). Secondary antibodies were either Alexa-488 or Alexa-568 conjugated (Molecular Probes, Inc.) and used at 1:500 dilution.
Acknowledgements We thank V. Sriram, D.K. Hoshizaki, Manfred Frasch, Richard Cripps, Kryztof Jagla, Michael Semeriva, Volker Hartenstein, Helen Skaer and K. VijayRaghavan for fly stocks, reagents and valuable comments. We thank Suma B.S. for help with confocal microscopy. D.D. is supported by a CSIR-SPM fellowship. This work was funded by the JNCASR, the Council of Scientific and Industrial Research, and Department of Biotechnology, Government of India. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.gep.2007. 10.008. References Alvarez, A.D., Shi, W., Wilson, B.A., Skeath, J.B., 2003. Pannier and pointed P2 act sequentially to regulate Drosophila heart development. Development 130, 3015–3026.
Bodmer, R., Frasch, M., 1999. Genetic determination of Drosophila heart development. In: Rosenthal, N. (Ed.), Heart Development. Academic Press, San Diego, pp. 65–90. Bodmer, R., Venkatesh, T.V., 1998. Heart development in Drosophila and vertebrates: conservation of molecular mechanisms. Dev. Genet. 22, 181–186. Brodu, V., Mugat, B., Roignant, J.Y., Lepesant, J.A., Antoniewski, C., 1999. Dual requirement for the EcR/USP nuclear receptor and the dGATAb factor in an ecdysone response in Drosophila melanogaster. Mol. Cell. Biol. 19, 5732–5742. Bruckner, K., Kockel, L., Duchek, P., Luque, C.M., Rorth, P., Perrimon, N., 2004. The PDGF/VEGF receptor controls blood cell survival in Drosophila. Dev. Cell 7, 73–84. Chartier, A., Zaffran, S., Astier, M., Semeriva, M., Gratecos, D., 2002. Pericardin, a Drosophila type IV collagen-like protein is involved in the morphogenesis and maintenance of the heart epithelium during dorsal ectoderm closure. Development 129, 3241–3253. Cripps, R.M., Olson, E.N., 2002. Control of cardiac development by an evolutionarily conserved transcriptional network. Dev. Biol. 246, 14– 28. Curtis, N.J., Ringo, J.M., Dowse, H.B., 1999. Morphology of the pupal heart, adult heart, and associated tissues in the fruit fly, Drosophila melanogaster. J. Morphol. 240, 225–235. Evans, C.J., Banerjee, U., 2003. Transcriptional regulation of hematopoiesis in Drosophila. Blood Cells Mol. Dis. 30, 223–228. Evans, C.J., Hartenstein, V., Banerjee, U., 2003. Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell 5, 673–690. Frasch, M., Hoey, T., Rushlow, C., Doyle, H., Levine, M., 1987. Characterization and localization of the even-skipped protein of Drosophila. EMBO J. 6, 749–759. Fujioka, M., Wessells, R.J., Han, Z., Liu, J., Fitzgerald, K., Yusibova, G.L., Zamora, M., Ruiz-Lozano, P., Bodmer, R., Jaynes, J.B., 2005. Embryonic even skipped-dependent muscle and heart cell fates are required for normal adult activity, heart function, and lifespan. Circ. Res. 97, 1108–1114. Goto, A., Kadowaki, T., Kitagawa, Y., 2003. Drosophila hemolectin gene is expressed in embryonic and larval hemocytes and its knock down causes bleeding defects. Dev. Biol. 264, 582–591. Gururaj, A.E., Peng, S., Vadlamudi, R.K., Kumar, R., 2007. Estrogen induces expression of BCAS3, a novel estrogen receptor-{alpha} coactivator, through proline-, glutamic acid-, and leucine-rich protein1 (PELP1). Mol. Endocrinol. 21, 1847–1860. Harlow, E., Lane, D., 1988. Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Hartenstein, A.Y., Rugendorff, A., Tepass, U., Hartenstein, V., 1992. The function of the neurogenic genes during epithelial development in the Drosophila embryo. Development 116, 1203–1220. Hartenstein, V., Mandal, L., 2006. The blood/vascular system in a phylogenetic perspective. Bioessays 28, 1203–1210. Jung, S.H., Evans, C.J., Uemura, C., Banerjee, U., 2005. The Drosophila lymph gland as a developmental model of hematopoiesis. Development 132, 2521–2533. Lebestky, T., Chang, T., Hartenstein, V., Banerjee, U., 2000. Specification of Drosophila hematopoietic lineage by conserved transcription factors. Science 288, 146–149. Mandal, L., Banerjee, U., Hartenstein, V., 2004. Evidence for a fruit fly hemangioblast and similarities between lymph-gland hematopoiesis in fruit fly and mammal aorta-gonadal-mesonephros mesoderm. Nat. Genet. 36, 1019–1023. Rothwell, W.F., Sullivan, W., 2000. Fluorescent analysis of Drosophila embryos. In: Sullivan, W., Ashburner, M., Hawley, R.S. (Eds.), Drosophila Protocols. Cold Spring Harbor Laboratory Press, New York, pp. 141–158. Rubin, G.M., Spradling, A.C., 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218, 348–353. Sellin, J., Albrecht, S., Kolsch, V., Paululat, A., 2006. Dynamics of heart differentiation, visualized utilizing heart enhancer elements of the
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205 Drosophila melanogaster bHLH transcription factor hand. Gene Expr. Patterns 6, 360–375. Siva, K., Inamdar, M.S., 2006. Rudhira is a cytoplasmic WD40 protein expressed in mouse embryonic stem cells and during embryonic erythropoiesis. Gene Expr. Patterns 6, 225–234.
205
Ward, E.J., Coulter, D.E., 2000. Odd-skipped is expressed in multiple tissues during Drosophila embryogenesis. Mech. Dev. 96, 233–236. Zaffran, S., Frasch, M., 2002. Early signals in cardiac development. Circ. Res. 91, 457–469.
Gene expression analysis in post-embryonic pericardial cells of Drosophila Debjani Das, D. Ashoka, Rajaguru Aradhya, Maneesha Inamdar
*
Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur P.O., Bangalore 560064, India Received 7 August 2007; received in revised form 19 October 2007; accepted 24 October 2007 Available online 1 November 2007
Abstract Increasing evidence suggests conservation of cardiovascular molecules between vertebrates and invertebrates. Vertebrate Rudhira, an evolutionary conserved WD40 protein is expressed during primitive erythropoiesis, neoangiogenesis and tumors. We report here the expression profile of the Drosophila ortholog of Rudhira (DRudh) in the fly life cycle. DRudh is expressed specifically in all post-embryonic pericardial cells (PCs) and garland cells (GCs). This is the first report of a cytoplasmic marker highly specific to post-embryonic PCs. Embryonic PCs belong to three distinct genetic classes based on Odd-skipped (Odd), Even-skipped (Eve) and Tinman (Tin) expression. To identify which among these three classes of PCs expresses DRudh in post-embryonic stages, we analyzed expression of embryonic PC markers in the post-embryonic stages. Unlike in the embryo all larval PCs show an identical gene expression profile. While Odd and Eve expression is mutually exclusive in the embryonic PCs, these two markers are co-expressed in larval PCs but show a distinct subcellular localization. Tin is not expressed in any post-embryonic PC. Additionally larval PCs also express the GATA factor, Serpent (Srp) and the extracellular matrix protein, Pericardin (Prc). While PC number is known to decrease post-embryogenesis, which of the Odd or Eve lineage embryonic PCs persists is not known. Co-expression of the two distinct lineage markers only in post-embryonic stages indicates a complex temporal regulation of gene expression in PCs. Ó 2007 Elsevier B.V. All rights reserved. Keywords: Pericardial cell; Odd-skipped; Even-skipped; Serpent; Rudhira; Tinman; Seven up; Pericardin; Post-embryonic
1. Results and discussion In spite of the rather obvious morphological differences between vertebrates and invertebrates, the underlying molecular mechanisms orchestrating different developmental processes are remarkably conserved. This is true even for the cardiovascular system although invertebrates possess a simple linear heart compared to the multi-chambered branched structure of the vertebrate. In the past few decades a number of gene functions and transcriptional networks have been identified that are utilized by both vertebrates and invertebrates for cardiogenesis (Bodmer and Venkatesh, 1998; Cripps
*
Corresponding author. Tel.: +91 80 2208 2818; fax: +91 80 2208 2766. E-mail address: [email protected] (M. Inamdar).
1567-133X/$ - see front matter Ó 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.gep.2007.10.008
and Olson, 2002; Zaffran and Frasch, 2002) and hematopoiesis (Evans and Banerjee, 2003; Evans et al., 2003; Lebestky et al., 2000; Mandal et al., 2004). We had earlier reported a novel WD40 domain protein, Rudhira (Rudh) expressed during primitive erythropoiesis and neo-vascularization (Siva and Inamdar, 2006). The human homolog (Breast Cancer Amplified Sequence 3) is implicated in breast cancer progression (Gururaj et al., 2007). Rudh is highly conserved across species and the Drosophila ortholog corresponds to the uncharacterized gene CG32663 (NCBI Accession # NM_167309) (Siva and Inamdar, 2006). To analyze whether Drosophila Rudhira (DRudh) is a cardiovascular molecule like its murine counterpart we examined DRudh expression in all stages of the fly life cycle. We also report the morphology and gene expression pattern of post-embryonic PCs.
200
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
1.1. Drosophila Rudhira is a novel marker for postembryonic PCs To analyze the expression of DRudh protein during the fly life cycle we raised polyclonal antibodies against a 183 aa fragment of the encoded protein (see Section 2 and Fig. S1) and used it for immunostaining on embryos and all post-embryonic tissues. We did not observe DRudh expression in the embryo (see supplementary information and Fig. S2). Among the larval stages we first detected DRudh expression in the second instar in a few cells in the dorsal-most region of the posterior abdominal segments (see supplementary Fig. S3 C). Similar staining was not observed in larvae immunostained with preimmune serum (see supplementary Fig. S3 E). The location of DRudh-expressing cells along the dorsal midline suggested that these could be cells of the dorsal vessel. The Drosophila heart or dorsal vessel is a simple contractile tube of cardioblasts (CBs) flanked by accessory pericardial cells (PCs) (Bodmer and Frasch, 1999). To test if DRudh is indeed expressed in dorsal vessel cells we analyzed co-localization of DRudh expression with markers that identify the dorsal vessel. Brodu et al. (1999) had reported expression of Serpent (Srp), a GATA factor in larval PCs. A serpent-GAL4 construct driving UAS-EGFP was available (Bruckner et al., 2004) which faithfully replicates the Srp expression in all post-embryonic PCs (see supplementary Fig. S4 A–C). Hence we used srpHemo-GAL, UAS-EGFP animals for Rudh expression analysis for post-embryonic stages. While larval PCs could be detected by GFP fluorescence in srpHemo-GAL, UAS-EGFP animals from 48 h after egg laying (AEL) (supplementary Fig. S3 B), DRudh expression was first seen only from 56 h AEL and co-localized with GFP in PCs (supplementary Fig. S3 D). DRudh expression increased steadily and by early third larval instar (L3) strong expression was observed in PCs which
now appeared as two rows of large cells neatly arranged along the dorsal midline (Fig. 1A and E). Complete colocalization of DRudh and GFP expression was seen in L3 PCs of srpHemo-GAL, UAS-EGFP animals (Fig. 1C and D). GFP controlled by hand-C promoter is expressed in all cardiac and pericardial nuclei (Sellin et al., 2006). In the third larval instar the large PC nuclei can be easily distinguished from the much smaller cardiac nuclei (Fig. 1F arrowheads). DRudh expression in hand-C-GFP transgenic animals was observed in cells with large GFPexpressing nucleus, i.e. PCs (Fig. 1F–H) but not in CBs (Fig. 1F) indicating that DRudh is specifically expressed in PCs. This also establishes DRudh as a cytoplasmic protein [also verified through co-localization with the nuclear marker, DAPI (Fig. 1B)]. We also observed DRudh expression in garland cells (GCs) in the third larval instar (Fig. 1I–K). DRudh expression continues throughout larval development, during metamorphosis [representative image of 24 hour after puparium formation (APF) shown in Fig. 2A and B] and in adults (Fig. 2C and D), identifying all PCs even at these later stages. Variable levels of DRudh expression in PCs were seen in the pupa (Fig. 2A and data not shown). Similar variation is also detected in GFP expression in srpHemo-GAL4 UAS-EGFP animals (Fig. 2B and data not shown). DRudh expression in adult PCs (Fig. 2C and D) was uniform and stronger compared to that in pupae. Due to very low level of GFP expression in adult PCs of srpHemo-GAL4 UAS-EGFP animals we used Prc for identifying the adult dorsal vessel (Fig. 2D). These data establish DRudh as a very specific marker for post-embryonic PCs and GCs. A homologous structure to insect PCs has not been identified in vertebrates. Based on evolutionary-developmental considerations and gene expression evidence Drosophila dorsal vessel cells are now thought to be as closely related to the vertebrate vascular endothelial cells
Fig. 1. DRudh is a cytoplasmic marker for PCs and GCs. (A, C, and D) srpHemo-GAL4 UAS-EGFP or (E–J) handC-GFP or (B and K) wild type third instar larvae immunostained with anti-DRudh (red). Expression is seen in (A–H) PCs or (I–K) GCs. GFP expression in green (C, D, F–H, and J) and DAPI staining in blue (B, D, and K) is shown in the merged panels. Arrowheads indicate cardiac nuclei. Dorsal view with anterior to the left. Scale bar = 50 lm (A), 20 lm (B, F and I) and 10 lm (K).
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
201
Fig. 2. DRudh is expressed in pupal and adult PCs. (A and B) srpHemo-GAL4 UAS-EGFP 24 h APF or (C and D) wild type adult PCs immunostained with anti-DRudh (red in A and B and green in C and D) and (D) Prc (red). (B and D) Merged images of respective panels to their left. Asterisk indicates lymph gland lobes and # indicates autofluorescence from fat. Dorsal view with anterior to the left. Scale bar = 50 lm (A) and 100 lm (C).
as to the myocardium and endocardium (Hartenstein et al., 1992; Hartenstein and Mandal, 2006). It is interesting to note in this context that while Drudh is expressed in PCs, its murine ortholog is expressed in endothelial precursors during vasculogenesis and angiogenesis (Siva and Inamdar, 2006). 1.2. Embryonic and post-embryonic PCs are morphologically different To characterize the DRudh-expressing PCs further we analyzed morphology of post-embryonic PCs. Unlike embryonic PCs, post-embryonic PCs have not been studied in great detail. However even a cursory observation indicates gross differences in embryonic- with post-embryonic PCs. A comparison between these stages shows significant differences in number and arrangement (Fig. 3A–C and F). Compared to the 100–110 PCs observed at the end of embryogenesis only 40–42 PCs are present in the third larval instar (Sellin et al., 2006) (Fig. 3F). As reported by Sellin et al. (2006), in the late stage embryo PCs are present in a neat ‘‘pearl necklace’’ like arrangement and remain tightly associated with CBs. But L3 PCs are fewer in number and appear more disorganized and are loosely attached to CBs. In addition at this stage we also observe asymmetric distribution of PCs on either side of the cardiac tube (Figs. 3B, 1A and E and 4B and E) with differences of 1– 4 cells. PCs flanking the aorta are longer with more stretched- out ‘‘spindle’’ shape (Fig. 3B and D). Further decrease in PC numbers in adults to 30–36 is accounted for by the loss of eight PCs in the 7th and 8th abdominal segments during metamorphosis (Sellin et al., 2006) (Fig. 3C and F). Embryonic PCs can be broadly classified into three subpopulations based on gene expression profile, cell lineage and morphology – two Even-skipped (Eve)-, four Oddskipped (Odd)- and four Tin-expressing cells per hemisegment (Alvarez et al., 2003) (Fig. 3A and A 0 ). This could potentially differentiate between pure or mixed lineage contributions of embryonic PCs to the larval structure. Further this raises the question of whether larval PCs can also be divided into subsets based on gene expression pro-
Fig. 3. Schematic representation of Drosophila dorsal vessel showing embryonic, larval and adult PCs [modified from Alvarez et al. (2003) and Curtis et al. (1999)]. (A) PCs in the context of the embryo showing arrangement of Odd+ (red), Eve+ (blue) and Tin+ (green) cells. Region demarcated by broken lines magnified in (A 0 ). Representation of (B) third instar larval and (C) adult PCs. During metamorphosis eight PCs at the posterior tip of the larval ventricle are lost in the remodeling process reducing the PC count further in adults. Loss of lymph glands during metamorphosis leaves a distinct gap between pericardial cell pairs in the anterior part of the adult heart. (D) Elongated and (E) spherical PCs of third instar larva showing GFP expression and nuclear staining (DAPI). (F) Schematic representation of PC number decrease in the life cycle of Drosophila. A1–A8: abdominal segments, T1–T3: thoracic segments; am: alary muscles; ao: aorta; he: heart; lg: lymph gland; tr: trachea; Em: embryo; L1–L3: first to third larval instars; Pu: pupa; Ad: adult. Dorsal view, anterior to the left. Scale bar = 20 lm (A), 100 lm (B, C and G), and 10 lm (D and E).
file. But these issues have remained unresolved since the post-embryonic expression profile of the embryonic PC lineage markers has not been systematically investigated.
202
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
Jung et al. (2005) reported expression of Odd, while Brodu et al. (1999) demonstrated expression of Serpent (Srp), a GATA factor in third larval instar (L3) PCs. However it is not clear from these reports whether all PCs observed at this stage express Odd and Srp. 1.3. Embryonic PC markers Odd and Eve but not Tin and Svp are expressed again in all PCs of the third larval instar To check whether larval PCs can be grouped based on their marker gene expression we examined Odd, Eve, Tin and Svp expression in these cells. Odd (Fig. 4A–C) and Eve (Fig. 4D–F) are expressed in all L3 PCs. However we did not observe Tin expression in any L3 PCs although
expression was detected in CBs (Fig. 4G). Embryonic Odd+ PCs can be further subdivided based on Svp expression. Two out of four Odd+ PCs per hemisegment express Svp along with two Tin-CBs. In the third larval instar Svp is expressed in CBs but not in any PCs (Fig. 4H). Pericardin (Prc), a collagen-like extracellular matrix protein is also reported as a marker for embryonic PCs. In the embryo Prc is expressed in Odd+ and Tin+ PCs in addition to a subset of CBs and oenocytes (Chartier et al., 2002). We observed expression of Prc in all larval stages (Fig. 4I–K) and also in adults (Fig. 2D). Prc is an extremely useful marker to identify the dorsal vessel in post-embryonic stages but its extracellular localization fails to provide information about changes in cell number.
Fig. 4. Larval PCs express Odd, Eve but not Tin and Svp. (A–G) srpHemoGAL4, UAS-EGFP or (H) svp-lacZ or (I–M) wild type (A–H, K–M) third instar larvae or (I) 24 h AEL or (J) 48 h AEL immunostained to show expression of (A–C) Odd (red), (D–F) Eve (red), (G) Tin (red), (H) b-galactosidase (red) and (I–K) Prc (green). (B, E, G, and H) are merged images showing (B, E, and G) GFP expression (green) or (H) DRudh (green). (C and F) Higher magnification images of individual PCs from the same preparation as on their immediate left. Single nucleus of larval ðL–L000 Þ PC or ðM–M000 Þ muscle cell from the same preparation co-immunostained for (L and M) Eve (red), (L 0 and M 0 ) Fibrillarin (Fib) (green), a nucleolar marker. (L00 , L000 , M00 , and M000 ) Merged image also showing (L000 and M000 ) nucleus stained with DAPI. Asterisks indicate lymph gland lobes, arrowheads indicate background staining from the cuticle and arrows indicate cardiac nuclei. Dorsal view, anterior to the left. Scale bar = 50 lm (A and J), 10 lm (C, G and L), 100 lm (I and K) and 20 lm (M).
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
The number of PCs we observe in our dissected preparations (see Section 2) at this stage agrees with the number reported from live imaging studies (Sellin et al., 2006) indicating that we have included the entire PC population in our analysis. We used srpHemo-GAL4 UAS-EGFP flies for the co-localization experiments to avoid cross-reactivity problems in analyzing the immunostaining results as all antibodies used were raised in rabbit. GFP expression in this stock faithfully replicates the wild type Srp expression pattern in PCs (see supplementary Fig. S4 A–C). This expression analysis clearly shows that post-embryonic PCs do not express all embryonic lineage markers. Hence, post-embryogenesis PCs not only decrease in number but they also show uniform gene expression pattern unlike their embryonic counterparts. Both Odd and Eve are transcription factors and hence nuclear localized (Frasch et al., 1987; Ward and Coulter, 2000). Interestingly, while Odd expression is seen covering the entire nucleus of PCs (Fig. 4C) the expression of Eve appears restricted to a small region within the nucleus (Fig. 4F and L–L000 ). Such restricted pattern is not seen for muscle nuclei which also express Eve (Fig. 4M–M000 ). To investigate this further we co-immunostained for Eve and a nucleolar marker, Fibrillarin (Fib). We observed partial overlap between expressions of Eve and Fib only in PCs (Fig. 4L00 and L000 ). The significance of this interesting expression pattern is not clear. Whether Eve has any role in the nucleolus or it is simply stored in the nucleolus when not required remains to be investigated. Odd and Eve have non-overlapping expression pattern in the embryo (Frasch et al., 1987; Ward and Coulter, 2000). Apart from the PCs we do not observe Eve expression in Odd+ lymph glands nor is Odd expressed in the Eve+ muscles even in post-embryonic stages. This coexpression of Odd and Eve in L3 PCs has raised interesting issues about post-embryonic PC number reduction and their lineage. It is possible that only Odd+ PCs persist post-embryogenesis which then start expressing Eve. The equivalence in numbers of only Odd+ PCs in all developmental stages [especially in abdominal segments (A1–A5) where all PCs are found in the adult stage] has led to the belief that only the embryonic Odd PC lineage persists post-embryogenesis. In this context it is important to note that Fujioka et al. report a reduced number of postembryonic PCs in mutants where embryonic Eve+ PCs have been eliminated (Fujioka et al., 2005). This observation suggests a possible contribution of Eve+ embryonic PCs to the post-embryonic population. These issues regarding post-embryonic PC lineage are likely to be resolved through live tracking of PCs through development. Such a study by Sellin et al. using handC-GFP transgenic animals clearly demonstrated that PCs are lost from the aorta region in the second larval instar (L2). However which subset of PCs is lost could not be determined since handC-GFP expresses in all embryonic PCs. The mechanism of reduction was also not clear. Thus fur-
203
ther analysis would require identification of additional markers and live tracking of particular PC subsets through development. 1.4. Uniform gene expression pattern in post-embryonic PCs Our study has provided a highly specific marker for PCs, namely DRudh. It is the only cytoplasmic marker for PCs to be reported till date. Co-localization with GFP-expressing PCs shows that DRudh identifies the same set of PCs as Odd, Eve and Srp in the third larval instar. Both DRudh and Srp are post-embryonic PC markers. Based on GFP expression in srpHemo-GAL4 UAS-EGFP animals, Srp expression precedes DRudh. Different subsets of embryonic PCs are morphologically distinct. The Odd+ cells are the largest among all PC subsets and lie in the plane of the cardiac tube. In the postembryonic stages especially in the third larval instar one observes distinct morphological features between PCs associated with the aorta and the heart. However with respect to all the markers tested L3 PCs are a homogenous population. Also the co-expression of Odd and Eve in postembryonic PCs we observe suggests a complex and dynamic temporal regulation of gene expression in postembryonic PCs. 2. Experimental procedures 2.1. Fly stocks All stocks were cultured on Cornmeal media. Canton-S was used as the wild type reference strain. The following fly lines were used: srpHemoGAL4 UAS-EGFP (II) #1643 B (V. Sriram); svp-lacZ, cg-GAL4 (K. VijayRaghavan).
2.2. Generation of transgenic fly lines Drudh full-length cDNA (4.1 kbp) (BDGP clone ID LD27278, NCBI Accession # AY075392) was subcloned into pPUAST vector using EcoRI/XhoI sites to generate UAS-Drudh construct. The construct was injected according to standard procedures (Rubin and Spradling, 1982). Germline transformed, transgenic flies were selected by red eye color (w+) and maintained as homozygotes. Multiple lines for each construct were analyzed.
2.3. Generation of anti-DRudh polyclonal antibodies Rabbit polyclonal antibodies were raised against a 183 aa fragment of DRudh [clone pDmrudIII (aa 518–701)], amplified using primers 1905 III F (5 0 CGGCGGCGCCATGGTCGTAT 3 0 ) and 1905 III R (5 0 GGCTCACTCGAGGCTAGCTTCGTGTC 3 0 ), subcloned into pET23d (Novagen, USA), expressed in Escherichia coli and purified by Ni–NTA binding followed by electroelution. Western blot analysis showed that the antisera reacted specifically with overexpressed protein and not with pre-immune serum (supplementary Fig. S1 A and B). Both antisera and pre-immune serum were treated with caprylic acid to purify IgG (Harlow and Lane, 1988). Specificity of the purified anti-DRudh polyclonal antibodies was confirmed by competition assay (see supplementary information and Fig. S1 C–J). A 1:200 dilution of the caprylic acid-purified polyclonal antiserum was used for immunostaining.
204
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205
2.4. Immunostaining and microscopy Immunostaining was performed on embryos as described previously (Rothwell and Sullivan, 2000). First and second instar larvae were fixed in 4% paraformaldehyde for 5 min, washed with phosphate-buffered saline (PBS) three times, then with 0.1% Tween 20 in PBS (PT) and weakly sonicated in PT for permeabilization of antibody (Goto et al., 2003). Immunostaining was performed similar to that for embryo. All dissections were in phosphate-buffered saline (PBS). Wandering third instar larvae or white pre-pupae were immobilized by cooling, pinned ventral side up on a Sylgard dish (Sylgard 184, Dow Corning Corp., Midland, MI, USA) and a longitudinal incision was made using fine scissors. Viscera and excess parts of body wall were removed, leaving a thin strip of body wall to which the heart remains attached. The nervous system and other anterior structures including the imaginal discs were left intact to keep the heart in place. Pupae or adults were pinned through the thorax with their ventral side facing up, cuticle was removed and abdomen was finally detached from the rest of the body taking care not to damage the first pair of PCs. Dissected preparations were fixed in 4% formaldehyde in PBS for 30 min then transferred to tubes. All subsequent steps were with gentle agitation on a flat bed rotator, using 1 ml of each solution at room temperature, except for the antibody incubations which were performed at 4 °C. Fixed preps were washed three times with PBS containing 0.1% Triton X-100 (PBST), incubated for 30 min with 10% normal sheep serum in PBST (PBST-N), followed by overnight incubation in appropriate primary antibody diluted in PBST-N. Samples were then washed four times, 30 min each in PBST, blocked in PBST-N, and incubated with secondary antibody diluted in PBST-N for 2.5 h. After four final washes in PBST samples were mounted in 70% glycerol diluted in PBS and observed using fluorescence microscopy. Images were obtained with a Zeiss LSM510-Meta confocal microscope and analyzed using the software LSM Image Examiner (Carl Zeiss, Inc.). The following antibodies and fluorescent reagents were used: rabbit anti-Rudh, 1:200; rabbit anti-Eve, 1:3000 and rabbit anti-Tin, 1:800 (from M. Frasch); rabbit anti-Odd, 1:400 (from R. Cripps); rabbit anti-Srp, 1:1500 (from D.K. Hoshizaki); mouse anti-Prc, 1:500 (DSHB); mouse anti-b-galactosidase, 1:50 (DSHB). Secondary antibodies were either Alexa-488 or Alexa-568 conjugated (Molecular Probes, Inc.) and used at 1:500 dilution.
Acknowledgements We thank V. Sriram, D.K. Hoshizaki, Manfred Frasch, Richard Cripps, Kryztof Jagla, Michael Semeriva, Volker Hartenstein, Helen Skaer and K. VijayRaghavan for fly stocks, reagents and valuable comments. We thank Suma B.S. for help with confocal microscopy. D.D. is supported by a CSIR-SPM fellowship. This work was funded by the JNCASR, the Council of Scientific and Industrial Research, and Department of Biotechnology, Government of India. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.gep.2007. 10.008. References Alvarez, A.D., Shi, W., Wilson, B.A., Skeath, J.B., 2003. Pannier and pointed P2 act sequentially to regulate Drosophila heart development. Development 130, 3015–3026.
Bodmer, R., Frasch, M., 1999. Genetic determination of Drosophila heart development. In: Rosenthal, N. (Ed.), Heart Development. Academic Press, San Diego, pp. 65–90. Bodmer, R., Venkatesh, T.V., 1998. Heart development in Drosophila and vertebrates: conservation of molecular mechanisms. Dev. Genet. 22, 181–186. Brodu, V., Mugat, B., Roignant, J.Y., Lepesant, J.A., Antoniewski, C., 1999. Dual requirement for the EcR/USP nuclear receptor and the dGATAb factor in an ecdysone response in Drosophila melanogaster. Mol. Cell. Biol. 19, 5732–5742. Bruckner, K., Kockel, L., Duchek, P., Luque, C.M., Rorth, P., Perrimon, N., 2004. The PDGF/VEGF receptor controls blood cell survival in Drosophila. Dev. Cell 7, 73–84. Chartier, A., Zaffran, S., Astier, M., Semeriva, M., Gratecos, D., 2002. Pericardin, a Drosophila type IV collagen-like protein is involved in the morphogenesis and maintenance of the heart epithelium during dorsal ectoderm closure. Development 129, 3241–3253. Cripps, R.M., Olson, E.N., 2002. Control of cardiac development by an evolutionarily conserved transcriptional network. Dev. Biol. 246, 14– 28. Curtis, N.J., Ringo, J.M., Dowse, H.B., 1999. Morphology of the pupal heart, adult heart, and associated tissues in the fruit fly, Drosophila melanogaster. J. Morphol. 240, 225–235. Evans, C.J., Banerjee, U., 2003. Transcriptional regulation of hematopoiesis in Drosophila. Blood Cells Mol. Dis. 30, 223–228. Evans, C.J., Hartenstein, V., Banerjee, U., 2003. Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell 5, 673–690. Frasch, M., Hoey, T., Rushlow, C., Doyle, H., Levine, M., 1987. Characterization and localization of the even-skipped protein of Drosophila. EMBO J. 6, 749–759. Fujioka, M., Wessells, R.J., Han, Z., Liu, J., Fitzgerald, K., Yusibova, G.L., Zamora, M., Ruiz-Lozano, P., Bodmer, R., Jaynes, J.B., 2005. Embryonic even skipped-dependent muscle and heart cell fates are required for normal adult activity, heart function, and lifespan. Circ. Res. 97, 1108–1114. Goto, A., Kadowaki, T., Kitagawa, Y., 2003. Drosophila hemolectin gene is expressed in embryonic and larval hemocytes and its knock down causes bleeding defects. Dev. Biol. 264, 582–591. Gururaj, A.E., Peng, S., Vadlamudi, R.K., Kumar, R., 2007. Estrogen induces expression of BCAS3, a novel estrogen receptor-{alpha} coactivator, through proline-, glutamic acid-, and leucine-rich protein1 (PELP1). Mol. Endocrinol. 21, 1847–1860. Harlow, E., Lane, D., 1988. Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Hartenstein, A.Y., Rugendorff, A., Tepass, U., Hartenstein, V., 1992. The function of the neurogenic genes during epithelial development in the Drosophila embryo. Development 116, 1203–1220. Hartenstein, V., Mandal, L., 2006. The blood/vascular system in a phylogenetic perspective. Bioessays 28, 1203–1210. Jung, S.H., Evans, C.J., Uemura, C., Banerjee, U., 2005. The Drosophila lymph gland as a developmental model of hematopoiesis. Development 132, 2521–2533. Lebestky, T., Chang, T., Hartenstein, V., Banerjee, U., 2000. Specification of Drosophila hematopoietic lineage by conserved transcription factors. Science 288, 146–149. Mandal, L., Banerjee, U., Hartenstein, V., 2004. Evidence for a fruit fly hemangioblast and similarities between lymph-gland hematopoiesis in fruit fly and mammal aorta-gonadal-mesonephros mesoderm. Nat. Genet. 36, 1019–1023. Rothwell, W.F., Sullivan, W., 2000. Fluorescent analysis of Drosophila embryos. In: Sullivan, W., Ashburner, M., Hawley, R.S. (Eds.), Drosophila Protocols. Cold Spring Harbor Laboratory Press, New York, pp. 141–158. Rubin, G.M., Spradling, A.C., 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218, 348–353. Sellin, J., Albrecht, S., Kolsch, V., Paululat, A., 2006. Dynamics of heart differentiation, visualized utilizing heart enhancer elements of the
D. Das et al. / Gene Expression Patterns 8 (2008) 199–205 Drosophila melanogaster bHLH transcription factor hand. Gene Expr. Patterns 6, 360–375. Siva, K., Inamdar, M.S., 2006. Rudhira is a cytoplasmic WD40 protein expressed in mouse embryonic stem cells and during embryonic erythropoiesis. Gene Expr. Patterns 6, 225–234.
205
Ward, E.J., Coulter, D.E., 2000. Odd-skipped is expressed in multiple tissues during Drosophila embryogenesis. Mech. Dev. 96, 233–236. Zaffran, S., Frasch, M., 2002. Early signals in cardiac development. Circ. Res. 91, 457–469.